Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 40107246
total bases: 6056194146
Q20 bases: 5678011161(93.7554%)
Q30 bases: 5076415197(83.8219%)

Read2 before filtering:
total reads: 40107246
total bases: 6056194146
Q20 bases: 5886432668(97.1969%)
Q30 bases: 5464998721(90.2382%)

Read1 after filtering:
total reads: 30694500
total bases: 2866497868
Q20 bases: 2852792311(99.5219%)
Q30 bases: 2795090058(97.5089%)

Read2 after filtering:
total reads: 30694500
total bases: 2878866765
Q20 bases: 2858128237(99.2796%)
Q30 bases: 2789765842(96.905%)

Filtering result:
reads passed filter: 61389000
reads failed due to low quality: 884890
reads failed due to too many N: 14520
reads failed due to too short: 17926082
reads with adapter trimmed: 67279125
bases trimmed due to adapters: 3842581976

Duplication rate: 47.8543%

Insert size peak (evaluated by paired-end reads): 87

JSON report: ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json --html ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 80 seconds