File Info

Filename
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:02 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 15162667
total bases: 2289562717
Q20 bases: 2192715212(95.77%)
Q30 bases: 1998532245(87.2888%)

Read2 before filtering:
total reads: 15162667
total bases: 2289562717
Q20 bases: 2177513571(95.1061%)
Q30 bases: 1883354381(82.2583%)

Read1 after filtering:
total reads: 9544799
total bases: 894104874
Q20 bases: 887745532(99.2887%)
Q30 bases: 864244409(96.6603%)

Read2 after filtering:
total reads: 9544799
total bases: 899858738
Q20 bases: 890686851(98.9807%)
Q30 bases: 864241112(96.0419%)

Filtering result:
reads passed filter: 19089598
reads failed due to low quality: 933364
reads failed due to too many N: 9072
reads failed due to too short: 10293300
reads with adapter trimmed: 23293535
bases trimmed due to adapters: 1278919622

Duplication rate: 51.5447%

Insert size peak (evaluated by paired-end reads): 87

JSON report: BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json --html BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 32 seconds