Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 17448653
total bases: 2634746603
Q20 bases: 2420775984(91.8789%)
Q30 bases: 2143042377(81.3377%)

Read2 before filtering:
total reads: 17448653
total bases: 2634746603
Q20 bases: 2525444441(95.8515%)
Q30 bases: 2255461385(85.6045%)

Read1 after filtering:
total reads: 13685877
total bases: 1299026967
Q20 bases: 1290508195(99.3442%)
Q30 bases: 1258978025(96.917%)

Read2 after filtering:
total reads: 13685877
total bases: 1305615920
Q20 bases: 1292487463(98.9945%)
Q30 bases: 1254000392(96.0467%)

Filtering result:
reads passed filter: 27371754
reads failed due to low quality: 750334
reads failed due to too many N: 13118
reads failed due to too short: 6762100
reads with adapter trimmed: 29314280
bases trimmed due to adapters: 1658759700

Duplication rate: 27.231%

Insert size peak (evaluated by paired-end reads): 87

JSON report: EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json --html EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 44 seconds