File Info

Filename
BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:03 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 42015743
total bases: 6344377193
Q20 bases: 5951482857(93.8072%)
Q30 bases: 5351673101(84.353%)

Read2 before filtering:
total reads: 42015743
total bases: 6344377193
Q20 bases: 6173394804(97.305%)
Q30 bases: 5738563336(90.4512%)

Read1 after filtering:
total reads: 33064515
total bases: 3093122923
Q20 bases: 3078944779(99.5416%)
Q30 bases: 3018429531(97.5852%)

Read2 after filtering:
total reads: 33064515
total bases: 3106912260
Q20 bases: 3083848270(99.2577%)
Q30 bases: 3008811151(96.8425%)

Filtering result:
reads passed filter: 66129030
reads failed due to low quality: 1072082
reads failed due to too many N: 15330
reads failed due to too short: 16815044
reads with adapter trimmed: 71382823
bases trimmed due to adapters: 4092254768

Duplication rate: 46.7658%

Insert size peak (evaluated by paired-end reads): 86

JSON report: BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.json --html BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 94 seconds