File Info

Filename
BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:03 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 38527645
total bases: 5817674395
Q20 bases: 5521667913(94.9119%)
Q30 bases: 5044333138(86.707%)

Read2 before filtering:
total reads: 38527645
total bases: 5817674395
Q20 bases: 5662802645(97.3379%)
Q30 bases: 5293097004(90.983%)

Read1 after filtering:
total reads: 33125823
total bases: 3122899194
Q20 bases: 3109022101(99.5556%)
Q30 bases: 3047860394(97.5971%)

Read2 after filtering:
total reads: 33125823
total bases: 3136358929
Q20 bases: 3113228577(99.2625%)
Q30 bases: 3037415552(96.8453%)

Filtering result:
reads passed filter: 66251646
reads failed due to low quality: 868572
reads failed due to too many N: 15726
reads failed due to too short: 9919346
reads with adapter trimmed: 66983186
bases trimmed due to adapters: 3934854042

Duplication rate: 45.8611%

Insert size peak (evaluated by paired-end reads): 88

JSON report: BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1.fastp.json --html BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 95 seconds