Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 46778364
total bases: 7063532964
Q20 bases: 6506420499(92.1128%)
Q30 bases: 5741606948(81.2852%)

Read2 before filtering:
total reads: 46778364
total bases: 7063532964
Q20 bases: 6886230017(97.4899%)
Q30 bases: 6404897165(90.6755%)

Read1 after filtering:
total reads: 36146178
total bases: 3229681265
Q20 bases: 3214274624(99.523%)
Q30 bases: 3148234323(97.4782%)

Read2 after filtering:
total reads: 36146178
total bases: 3243812685
Q20 bases: 3223119950(99.3621%)
Q30 bases: 3150891241(97.1354%)

Filtering result:
reads passed filter: 72292356
reads failed due to low quality: 949468
reads failed due to too many N: 16320
reads failed due to too short: 20298584
reads with adapter trimmed: 80159219
bases trimmed due to adapters: 4802788533

Duplication rate: 41.1998%

Insert size peak (evaluated by paired-end reads): 85

JSON report: ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1.fastp.json --html ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 89 seconds