Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 31291361
total bases: 4724995511
Q20 bases: 4375664149(92.6067%)
Q30 bases: 3890305594(82.3346%)

Read2 before filtering:
total reads: 31291361
total bases: 4724995511
Q20 bases: 4591401403(97.1726%)
Q30 bases: 4224835545(89.4146%)

Read1 after filtering:
total reads: 25491735
total bases: 2290276001
Q20 bases: 2279143362(99.5139%)
Q30 bases: 2231705294(97.4426%)

Read2 after filtering:
total reads: 25491735
total bases: 2299698044
Q20 bases: 2284923067(99.3575%)
Q30 bases: 2234208217(97.1522%)

Filtering result:
reads passed filter: 50983470
reads failed due to low quality: 711472
reads failed due to too many N: 11526
reads failed due to too short: 10876254
reads with adapter trimmed: 54914556
bases trimmed due to adapters: 3308242784

Duplication rate: 39.4316%

Insert size peak (evaluated by paired-end reads): 86

JSON report: EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.json --html EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 80 seconds