Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 41878760
total bases: 6323692760
Q20 bases: 6059888306(95.8283%)
Q30 bases: 5632795940(89.0745%)

Read2 before filtering:
total reads: 41878760
total bases: 6323692760
Q20 bases: 6156520360(97.3564%)
Q30 bases: 5780591941(91.4117%)

Read1 after filtering:
total reads: 37936168
total bases: 3624292591
Q20 bases: 3607441317(99.535%)
Q30 bases: 3534178271(97.5136%)

Read2 after filtering:
total reads: 37936168
total bases: 3640225125
Q20 bases: 3613078638(99.2543%)
Q30 bases: 3527438100(96.9016%)

Filtering result:
reads passed filter: 75872336
reads failed due to low quality: 1027476
reads failed due to too many N: 17740
reads failed due to too short: 6839968
reads with adapter trimmed: 75647641
bases trimmed due to adapters: 4336494196

Duplication rate: 46.7317%

Insert size peak (evaluated by paired-end reads): 90

JSON report: EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1.fastp.json --html EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 89 seconds