File Info

Filename
OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:03 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 48475141
total bases: 7319746291
Q20 bases: 6875380878(93.9292%)
Q30 bases: 6217921825(84.9472%)

Read2 before filtering:
total reads: 48475141
total bases: 7319746291
Q20 bases: 7138924625(97.5297%)
Q30 bases: 6687714494(91.3654%)

Read1 after filtering:
total reads: 40165314
total bases: 3757041733
Q20 bases: 3739478988(99.5325%)
Q30 bases: 3663770094(97.5174%)

Read2 after filtering:
total reads: 40165314
total bases: 3772287706
Q20 bases: 3747478890(99.3423%)
Q30 bases: 3663395760(97.1134%)

Filtering result:
reads passed filter: 80330628
reads failed due to low quality: 986932
reads failed due to too many N: 19150
reads failed due to too short: 15613572
reads with adapter trimmed: 84281720
bases trimmed due to adapters: 4885528821

Duplication rate: 45.3502%

Insert size peak (evaluated by paired-end reads): 85

JSON report: OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.json --html OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 92 seconds