File Info

Filename
SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__e7be3c7a--20260528-111100/fastp/SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.log
Size
1.6 KB
Published
May 28, 2026 1:04 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 83106995
total bases: 12549156245
Q20 bases: 12232254875(97.4747%)
Q30 bases: 11604189675(92.4699%)

Read2 before filtering:
total reads: 83106995
total bases: 12549156245
Q20 bases: 12256002882(97.664%)
Q30 bases: 11545709642(92.0039%)

Read1 after filtering:
total reads: 73627138
total bases: 7444336736
Q20 bases: 7412984897(99.5788%)
Q30 bases: 7269898691(97.6568%)

Read2 after filtering:
total reads: 73627138
total bases: 7466263156
Q20 bases: 7411438211(99.2657%)
Q30 bases: 7227664281(96.8043%)

Filtering result:
reads passed filter: 147254276
reads failed due to low quality: 1861588
reads failed due to too many N: 37626
reads failed due to too short: 17060500
reads with adapter trimmed: 143444139
bases trimmed due to adapters: 7655742210

Duplication rate: 63.9478%

Insert size peak (evaluated by paired-end reads): 98

JSON report: SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.json --html SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 169 seconds