MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-08, 13:29 UTC based on data in: /tmp/nxf.UjS4kF9b7X

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₁ columns.

Sample Name	Total Reads	Expected Distinct	RNA contaminated	RNA contamination %	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Unique Reads	Frac Antisense	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	ChrY Signature Score	Frag Length	% Aligned	M Aligned	Duplication	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
22Rv1_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	11834490	No	0.00%	28776160	0.03%	0.71%	8306431	0.56%	0.64%	0.33%	0.36%	4668885	2337090	2745538	1334679	5.91	2.00	0.03%	0.00%	0.97	0.000	25206800	0.8205	102.1bp	99.0bp	0.10%	0.53%	0.20%	0.00%	0.20%	1.61%	0.34%	0.00%	1.54				73.4%	57.3%	86.1%	12.4M	32.6%	96.4%	2743.8Mb	28.8M	61.0%	81.3%	83.4%
22Rv1_FFPE_RNA_0001_B23LG7FLT4_1_1																																				102.1bp	83.3%	12.0M												74.0%	60%	151bp	151bp	36%	17.7M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		72.4%	65%	151bp	151bp	55%	17.7M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		69.0%	60%	99bp	97bp	18%	14.4M	69.0%	60%	99bp	97bp	18%	14.4M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		68.5%	61%	99bp	97bp	9%	14.4M	68.5%	61%	99bp	97bp	9%	14.4M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	11896326	No	0.00%	26146858	0.03%	0.69%	8094880	0.60%	0.67%	0.31%	0.33%	4850797	2428285	2470125	1199010	6.21	2.00	0.04%	0.01%	0.97	0.000	23358325	0.8241	103.9bp	100.0bp	0.09%	0.52%	0.20%	0.00%	0.19%	1.59%	0.34%	0.00%	1.23				71.1%	63.7%	87.9%	11.5M	32.5%	96.4%	2559.6Mb	26.1M	60.8%	83.0%	83.5%
22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_1																																				103.9bp	85.3%	11.2M												72.0%	60%	151bp	151bp	36%	15.8M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		70.8%	65%	151bp	151bp	55%	15.8M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		67.1%	60%	101bp	102bp	18%	13.1M	67.1%	60%	101bp	102bp	18%	13.1M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		66.9%	61%	102bp	102bp	18%	13.1M	66.9%	61%	102bp	102bp	18%	13.1M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	11568932	No	0.00%	27749734	0.03%	0.70%	8352810	0.58%	0.66%	0.32%	0.34%	4875571	2439881	2645424	1285095	6.17	2.00	0.04%	0.00%	0.97	0.000	24677930	0.8250	102.7bp	99.0bp	0.10%	0.54%	0.20%	0.00%	0.21%	1.63%	0.34%	0.00%	1.81				72.1%	61.9%	87.6%	12.1M	38.7%	96.5%	2679.0Mb	27.7M	60.5%	78.6%	82.0%
22Rv1_FFPE_RNA_0001_B23LG7FLT4_3_1																																				102.7bp	84.6%	11.7M												74.4%	60%	151bp	151bp	45%	17.7M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		72.7%	66%	151bp	151bp	55%	17.7M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		68.2%	60%	100bp	97bp	18%	13.9M	68.2%	60%	100bp	97bp	18%	13.9M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		67.7%	60%	100bp	102bp	18%	13.9M	67.7%	60%	100bp	102bp	18%	13.9M
786-O_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	567400363	No	0.00%	588936758	0.01%	0.40%	353736047	0.89%	0.92%	0.10%	0.08%	316103216	159482191	34229180	14609540	620.95	240.00	0.67%	0.59%	0.97	0.000	570208994	0.9004	141.9bp	132.0bp	0.13%	0.57%	0.63%	0.00%	0.26%	1.77%	0.89%	0.00%	5.28				40.2%	89.3%	95.9%	282.4M	22.6%	96.7%	73276.9Mb	588.9M	54.8%	98.2%	57.1%
786-O_FFPE_RNA_0001_B23LG7FLT4_1_1																																				141.9bp	95.2%	280.3M												80.3%	54%	151bp	151bp	27%	467.4M
786-O_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		79.7%	55%	151bp	151bp	27%	467.4M
786-O_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		77.2%	54%	129bp	142bp	27%	294.5M	77.2%	54%	129bp	142bp	27%	294.5M
786-O_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		77.7%	55%	129bp	142bp	18%	294.5M	77.7%	55%	129bp	142bp	18%	294.5M
786-O_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	520786780	No	0.00%	589747150	0.01%	0.42%	344680619	0.89%	0.91%	0.10%	0.09%	307075671	154884469	34323116	14818160	596.66	236.00	0.67%	0.59%	0.97	0.000	571292578	0.8872	139.7bp	130.0bp	0.14%	0.58%	0.63%	0.00%	0.28%	1.79%	0.87%	0.00%	5.30				41.8%	89.4%	96.0%	283.1M	23.7%	96.9%	72958.3Mb	589.7M	54.3%	98.3%	58.4%
786-O_FFPE_RNA_0001_B23LG7FLT4_2_1																																				139.7bp	95.1%	280.5M												81.4%	53%	151bp	151bp	27%	517.4M
786-O_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		80.8%	54%	151bp	151bp	27%	517.4M
786-O_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		77.7%	54%	128bp	137bp	27%	294.9M	77.7%	54%	128bp	137bp	27%	294.9M
786-O_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		78.0%	54%	128bp	137bp	18%	294.9M	78.0%	54%	128bp	137bp	18%	294.9M
786-O_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	534744332	No	0.00%	589291564	0.01%	0.42%	343412516	0.89%	0.91%	0.10%	0.09%	306402975	154485396	33695623	14532641	590.66	228.00	0.67%	0.58%	0.97	0.000	570468875	0.8992	138.6bp	129.0bp	0.13%	0.58%	0.64%	0.00%	0.27%	1.79%	0.88%	0.00%	5.24				42.0%	89.2%	96.0%	282.7M	23.2%	96.7%	72418.8Mb	589.3M	54.8%	98.2%	59.5%
786-O_FFPE_RNA_0001_B23LG7FLT4_3_1																																				138.6bp	95.2%	280.6M												80.8%	54%	151bp	151bp	27%	485.2M
786-O_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		80.3%	54%	151bp	151bp	27%	485.2M
786-O_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		77.5%	54%	127bp	137bp	27%	294.6M	77.5%	54%	127bp	137bp	27%	294.6M
786-O_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		78.0%	55%	127bp	137bp	18%	294.6M	78.0%	55%	127bp	137bp	18%	294.6M
A549_FFPE_01_RNA_0001_B23LG7FLT4_1	9999000000	195854	Skipped	N/A%	630948	0.30%	0.56%	275736	0.01%	0.04%	0.31%	0.96%	3116	1459	84130	40181	0.00	0.00	0.00%	0.00%	0.93	0.000	82931	0.4569	38.2bp	31.0bp	0.01%	0.01%	0.00%	0.00%	0.02%	0.05%	0.00%	0.00%	0.00				80.3%	2.1%	11.0%	0.0M	56.5%	88.2%	31.4Mb	0.6M	70.4%	7.9%	52.8%
A549_FFPE_01_RNA_0001_B23LG7FLT4_1_1																																				38.2bp	2.3%	0.0M												96.6%	75%	151bp	151bp	64%	4.0M
A549_FFPE_01_RNA_0001_B23LG7FLT4_1_2																																																		93.2%	96%	151bp	151bp	55%	4.0M
A549_FFPE_01_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		67.5%	66%	55bp	32bp	36%	0.3M	67.5%	66%	55bp	32bp	36%	0.3M
A549_FFPE_01_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		67.8%	73%	58bp	32bp	45%	0.3M	67.8%	73%	58bp	32bp	45%	0.3M
A549_FFPE_01_RNA_0001_B23LG7FLT4_2	9999000000	117960	Skipped	N/A%	298544	0.39%	0.45%	163865	0.01%	0.03%	0.28%	0.97%	1524	708	46496	22288	0.00	0.00	0.00%	0.00%	0.93	0.000	36028	0.4530	39.3bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00				73.7%	2.1%	10.0%	0.0M	76.9%	90.4%	18.3Mb	0.3M	68.9%	5.0%	51.5%
A549_FFPE_01_RNA_0001_B23LG7FLT4_2_1																																				39.3bp	2.7%	0.0M												97.3%	74%	151bp	151bp	64%	3.0M
A549_FFPE_01_RNA_0001_B23LG7FLT4_2_2																																																		95.8%	97%	151bp	151bp	55%	3.0M
A549_FFPE_01_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		57.6%	65%	67bp	37bp	45%	0.1M	57.6%	65%	67bp	37bp	45%	0.1M
A549_FFPE_01_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		58.8%	72%	69bp	37bp	45%	0.1M	58.8%	72%	69bp	37bp	45%	0.1M
A549_FFPE_01_RNA_0001_B23LG7FLT4_3	9999000000	270626	Skipped	N/A%	786348	0.26%	0.61%	303747	0.01%	0.04%	0.31%	0.96%	3592	1679	92966	43983	0.00	0.00	0.00%	0.00%	0.94	0.000	99899	0.4664	35.2bp	31.0bp	0.00%	0.00%	0.14%	0.00%	0.00%	0.00%	0.10%	0.00%	0.00				83.3%	2.0%	10.8%	0.0M	68.4%	88.9%	36.6Mb	0.8M	73.1%	8.5%	53.0%
A549_FFPE_01_RNA_0001_B23LG7FLT4_3_1																																				35.2bp	1.5%	0.0M												96.5%	74%	151bp	151bp	55%	4.6M
A549_FFPE_01_RNA_0001_B23LG7FLT4_3_2																																																		93.8%	96%	151bp	151bp	55%	4.6M
A549_FFPE_01_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		69.4%	68%	51bp	32bp	55%	0.4M	69.4%	68%	51bp	32bp	55%	0.4M
A549_FFPE_01_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		70.3%	77%	54bp	32bp	55%	0.4M	70.3%	77%	54bp	32bp	55%	0.4M
A673_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	547089881	No	0.00%	590038114	0.01%	0.41%	345937749	0.88%	0.90%	0.11%	0.10%	304607513	153664086	38236814	16753854	585.25	212.00	0.66%	0.57%	0.97	0.000	570674308	0.9102	138.4bp	129.0bp	0.15%	0.86%	0.49%	0.00%	0.31%	2.48%	0.65%	0.00%	0.02				41.6%	89.1%	95.8%	282.8M	23.8%	96.9%	72666.1Mb	590.0M	53.2%	98.3%	59.5%
A673_FFPE_RNA_0001_B23LG7FLT4_1_1																																				138.4bp	94.4%	278.6M												81.0%	52%	151bp	151bp	27%	473.5M
A673_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		80.6%	53%	151bp	151bp	27%	473.5M
A673_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		77.9%	52%	127bp	137bp	27%	295.0M	77.9%	52%	127bp	137bp	27%	295.0M
A673_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		78.5%	53%	127bp	137bp	18%	295.0M	78.5%	53%	127bp	137bp	18%	295.0M
A673_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	497394678	No	0.00%	589611786	0.01%	0.43%	335752328	0.88%	0.90%	0.11%	0.10%	294348416	148361697	38145444	16827174	551.97	199.00	0.65%	0.56%	0.97	0.000	569347845	0.9105	133.0bp	123.0bp	0.16%	0.88%	0.51%	0.00%	0.32%	2.53%	0.66%	0.00%	0.03				43.3%	88.7%	95.8%	282.3M	22.7%	96.7%	71016.3Mb	589.6M	53.2%	98.3%	62.9%
A673_FFPE_RNA_0001_B23LG7FLT4_2_1																																				133.0bp	94.4%	278.3M												80.2%	53%	151bp	151bp	27%	404.1M
A673_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		79.4%	53%	151bp	151bp	27%	404.1M
A673_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		78.1%	53%	124bp	132bp	27%	294.8M	78.1%	53%	124bp	132bp	27%	294.8M
A673_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		78.3%	53%	125bp	132bp	18%	294.8M	78.3%	53%	125bp	132bp	18%	294.8M
A673_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	454334653	No	0.00%	590394896	0.01%	0.45%	323542277	0.88%	0.90%	0.11%	0.10%	284035349	143112714	36438815	16110257	525.48	186.00	0.65%	0.56%	0.97	0.000	570475906	0.9128	132.6bp	122.0bp	0.17%	0.88%	0.51%	0.00%	0.35%	2.51%	0.66%	0.00%	0.02				45.4%	89.0%	95.8%	282.9M	25.1%	97.0%	70857.4Mb	590.4M	53.6%	98.4%	64.7%
A673_FFPE_RNA_0001_B23LG7FLT4_3_1																																				132.6bp	94.7%	279.5M												79.2%	52%	151bp	151bp	27%	312.9M
A673_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		78.8%	53%	151bp	151bp	27%	312.9M
A673_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		79.0%	53%	124bp	132bp	18%	295.2M	79.0%	53%	124bp	132bp	18%	295.2M
A673_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		79.5%	53%	124bp	132bp	18%	295.2M	79.5%	53%	124bp	132bp	18%	295.2M
BT-20_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	114797750	No	0.00%	171417044	0.02%	0.61%	66396650	0.49%	0.52%	0.46%	0.48%	32781579	16404527	30624551	15094053	39.99	14.00	0.34%	0.09%	0.97	0.000	158921441	0.8174	95.9bp	93.0bp	0.14%	0.87%	0.23%	0.00%	0.30%	2.75%	0.35%	0.00%	0.36				62.4%	72.9%	91.3%	78.2M	22.3%	96.6%	15996.5Mb	171.4M	56.3%	95.9%	92.2%
BT-20_FFPE_RNA_0001_B23LG7FLT4_1_1																																				95.9bp	79.5%	68.2M												63.8%	55%	151bp	151bp	45%	89.3M
BT-20_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		62.9%	56%	151bp	151bp	45%	89.3M
BT-20_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		62.9%	56%	96bp	97bp	18%	85.7M	62.9%	56%	96bp	97bp	18%	85.7M
BT-20_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		62.9%	56%	97bp	97bp	18%	85.7M	62.9%	56%	97bp	97bp	18%	85.7M
BT-20_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	117454628	No	0.00%	170948074	0.02%	0.61%	65842874	0.48%	0.50%	0.48%	0.50%	31374270	15698939	31371433	15467046	38.19	14.00	0.33%	0.09%	0.97	0.000	158215326	0.8130	97.3bp	95.0bp	0.14%	0.86%	0.23%	0.00%	0.32%	2.72%	0.34%	0.00%	0.27				62.6%	72.2%	91.2%	77.9M	27.4%	96.6%	16123.7Mb	170.9M	55.9%	95.2%	91.5%
BT-20_FFPE_RNA_0001_B23LG7FLT4_2_1																																				97.3bp	78.8%	67.3M												64.5%	54%	151bp	151bp	45%	89.7M
BT-20_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		63.2%	56%	151bp	151bp	45%	89.7M
BT-20_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		63.5%	55%	97bp	97bp	18%	85.5M	63.5%	55%	97bp	97bp	18%	85.5M
BT-20_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		63.1%	56%	98bp	97bp	18%	85.5M	63.1%	56%	98bp	97bp	18%	85.5M
BT-20_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	113750238	No	0.00%	162204324	0.02%	0.62%	61497095	0.48%	0.51%	0.47%	0.49%	29671146	14848018	29034239	14316181	36.57	13.00	0.32%	0.08%	0.97	0.000	151136517	0.8327	98.9bp	97.0bp	0.15%	0.84%	0.22%	0.00%	0.34%	2.65%	0.33%	0.00%	0.30				63.2%	74.7%	91.8%	74.4M	24.2%	96.7%	15627.9Mb	162.2M	55.6%	96.4%	91.5%
BT-20_FFPE_RNA_0001_B23LG7FLT4_3_1																																				98.9bp	79.8%	64.7M												64.9%	54%	151bp	151bp	27%	84.1M
BT-20_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		63.5%	55%	151bp	151bp	45%	84.1M
BT-20_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		64.2%	55%	99bp	97bp	18%	81.1M	64.2%	55%	99bp	97bp	18%	81.1M
BT-20_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		63.6%	55%	100bp	97bp	9%	81.1M	63.6%	55%	100bp	97bp	9%	81.1M
BreastNB_FFPE_L01_RNA_01_B23LG7FLT4_1	9999000000	11324274	No	0.00%	90255512	0.02%	0.88%	10739506	0.44%	0.51%	0.43%	0.49%	4722571	2353785	4605133	2243944	5.63	2.00	0.03%	0.00%	0.97	0.000	82339871	0.8291	101.0bp	96.0bp	0.01%	2.10%	0.29%	0.00%	0.02%	6.38%	0.57%	0.00%	0.38				89.5%	69.3%	90.1%	40.6M	46.3%	97.2%	8755.7Mb	90.3M	59.5%	85.2%	84.6%
BreastNB_FFPE_L01_RNA_01_B23LG7FLT4_1_1																																				101.0bp	90.3%	40.7M												88.7%	58%	151bp	151bp	36%	53.0M
BreastNB_FFPE_L01_RNA_01_B23LG7FLT4_1_2																																																		87.5%	63%	151bp	151bp	55%	53.0M
BreastNB_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_1																																																		87.1%	59%	100bp	97bp	9%	45.1M	87.1%	59%	100bp	97bp	9%	45.1M
BreastNB_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_2																																																		86.7%	59%	100bp	97bp	9%	45.1M	86.7%	59%	100bp	97bp	9%	45.1M
BreastNB_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	10420853	No	0.00%	99247266	0.02%	0.90%	10314718	0.41%	0.49%	0.44%	0.51%	4220597	2099768	4560273	2226366	5.05	2.00	0.02%	0.00%	0.97	0.000	91435024	0.8339	99.3bp	95.0bp	0.01%	0.77%	0.24%	0.00%	0.02%	2.61%	0.46%	0.00%	0.69				91.0%	71.9%	90.9%	45.1M	45.7%	97.3%	9629.1Mb	99.2M	60.5%	87.9%	85.8%
BreastNB_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				99.3bp	91.2%	45.3M												89.7%	58%	151bp	151bp	36%	56.4M
BreastNB_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		88.6%	62%	151bp	151bp	55%	56.4M
BreastNB_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		88.6%	60%	100bp	97bp	9%	49.6M	88.6%	60%	100bp	97bp	9%	49.6M
BreastNB_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		88.2%	60%	100bp	97bp	9%	49.6M	88.2%	60%	100bp	97bp	9%	49.6M
BreastNB_FFPE_L03_RNA_01_B23LG7FLT4_1	9999000000	14505573	No	0.00%	147987410	0.01%	0.90%	14621469	0.42%	0.50%	0.44%	0.50%	6147662	3059660	6372987	3111808	7.32	3.00	0.04%	0.01%	0.97	0.000	137885401	0.8353	99.0bp	96.0bp	0.02%	0.82%	0.28%	0.00%	0.05%	2.64%	0.48%	0.00%	0.49				91.4%	75.3%	91.9%	68.0M	47.1%	97.3%	14415.7Mb	148.0M	59.1%	90.9%	87.6%
BreastNB_FFPE_L03_RNA_01_B23LG7FLT4_1_1																																				99.0bp	92.2%	68.2M												89.7%	56%	151bp	151bp	36%	81.4M
BreastNB_FFPE_L03_RNA_01_B23LG7FLT4_1_2																																																		88.6%	60%	151bp	151bp	55%	81.4M
BreastNB_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_1																																																		88.9%	58%	100bp	97bp	9%	74.0M	88.9%	58%	100bp	97bp	9%	74.0M
BreastNB_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_2																																																		88.6%	59%	100bp	97bp	9%	74.0M	88.6%	59%	100bp	97bp	9%	74.0M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	7113039	Skipped	N/A%	19089598	0.04%	0.72%	5314292	0.50%	0.58%	0.38%	0.42%	2640215	1321511	1996935	974158	3.20	1.00	0.01%	0.00%	0.97	0.000	16526768	0.8792	97.0bp	93.0bp	0.13%	0.55%	0.21%	0.00%	0.26%	1.63%	0.35%	0.00%	1.67				74.8%	55.7%	85.4%	8.2M	51.5%	96.4%	1728.5Mb	19.1M	60.9%	62.9%	76.8%
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				97.0bp	81.1%	7.7M												81.3%	63%	151bp	151bp	45%	15.2M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		79.2%	72%	151bp	151bp	55%	15.2M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		71.2%	60%	94bp	92bp	18%	9.5M	71.2%	60%	94bp	92bp	18%	9.5M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		70.9%	61%	94bp	92bp	27%	9.5M	70.9%	61%	94bp	92bp	27%	9.5M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2	9999000000	2592875	Skipped	N/A%	18045334	0.02%	0.86%	2569234	0.42%	0.52%	0.40%	0.48%	1088734	541398	1036956	506785	1.10	0.00	0.00%	0.00%	0.97	0.000	14956219	0.8059	86.6bp	83.0bp	0.04%	0.83%	0.57%	0.00%	0.09%	2.64%	0.97%	0.00%	0.00				87.9%	55.0%	81.5%	7.4M	61.4%	97.1%	1527.7Mb	18.0M	60.5%	54.4%	75.1%
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_1																																				86.6bp	89.2%	8.0M												91.8%	65%	151bp	151bp	45%	16.6M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_2																																																		90.9%	76%	151bp	151bp	55%	16.6M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_trimmed_1																																																		85.3%	60%	87bp	87bp	9%	9.0M	85.3%	60%	87bp	87bp	9%	9.0M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_trimmed_2																																																		85.1%	60%	87bp	87bp	18%	9.0M	85.1%	60%	87bp	87bp	18%	9.0M
BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1	9999000000	6701672	No	0.00%	66129030	0.02%	0.90%	6940551	0.47%	0.56%	0.38%	0.44%	3264202	1627907	2671329	1291102	3.70	1.00	0.01%	0.00%	0.97	0.000	57920358	0.8283	91.6bp	88.0bp	0.09%	1.42%	0.31%	0.00%	0.15%	3.59%	0.45%	0.00%	0.02				90.9%	63.1%	86.5%	28.6M	46.8%	97.2%	6027.2Mb	66.1M	57.6%	78.7%	84.9%
BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1_1																																				91.6bp	91.7%	30.3M												90.9%	59%	151bp	151bp	45%	42.0M
BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1_2																																																		89.7%	64%	151bp	151bp	55%	42.0M
BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_1																																																		88.8%	57%	94bp	92bp	9%	33.1M	88.8%	57%	94bp	92bp	9%	33.1M
BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_2																																																		88.4%	57%	94bp	92bp	9%	33.1M	88.4%	57%	94bp	92bp	9%	33.1M
BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1	9999000000	7390308	No	0.00%	66251646	0.02%	0.89%	7229720	0.45%	0.53%	0.40%	0.47%	3256973	1622919	2912145	1416934	3.80	1.00	0.02%	0.00%	0.97	0.000	60368982	0.8168	94.5bp	90.0bp	0.01%	2.11%	0.41%	0.00%	0.03%	6.32%	0.70%	0.00%	0.06				90.5%	67.5%	89.9%	29.8M	45.9%	97.2%	6085.3Mb	66.3M	60.5%	86.0%	86.9%
BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1_1																																				94.5bp	90.5%	30.0M												89.2%	60%	151bp	151bp	36%	38.5M
BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1_2																																																		88.0%	63%	151bp	151bp	55%	38.5M
BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_1																																																		87.9%	60%	94bp	92bp	9%	33.1M	87.9%	60%	94bp	92bp	9%	33.1M
BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_2																																																		87.4%	60%	95bp	92bp	9%	33.1M	87.4%	60%	95bp	92bp	9%	33.1M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1	9999000000	15030090	No	0.00%	29311958	0.02%	0.69%	9123244	0.54%	0.58%	0.40%	0.42%	4941284	2467677	3604746	1767152	5.88	2.00	0.03%	0.00%	0.97	0.000	23957374	0.8374	94.3bp	91.0bp	0.23%	0.39%	0.21%	0.00%	0.57%	1.45%	0.39%	0.00%	5.51				70.3%	54.0%	80.6%	11.8M	34.8%	96.6%	2682.7Mb	29.3M	57.1%	78.3%	84.7%
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1_1																																				94.3bp	84.9%	12.4M												74.9%	59%	151bp	151bp	45%	18.7M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1_2																																																		73.6%	64%	151bp	151bp	55%	18.7M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_1																																																		68.8%	56%	95bp	92bp	18%	14.7M	68.8%	56%	95bp	92bp	18%	14.7M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_2																																																		68.5%	57%	95bp	92bp	18%	14.7M	68.5%	57%	95bp	92bp	18%	14.7M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_2	9999000000	27569465	No	0.00%	517206040	0.02%	0.93%	34248461	0.45%	0.61%	0.30%	0.39%	15424033	7724005	10407507	4895394	22.05	5.00	0.15%	0.03%	0.97	0.000	428490457	0.8461	112.3bp	106.0bp	0.03%	1.65%	0.37%	0.00%	0.05%	4.14%	0.53%	0.00%	0.07				94.9%	58.0%	82.0%	212.1M	53.0%	96.7%	54811.2Mb	517.2M	60.3%	94.6%	82.0%
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_2_1																																				112.3bp	90.9%	235.1M												93.2%	57%	151bp	151bp	27%	273.3M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_2_2																																																		91.5%	59%	151bp	151bp	45%	273.3M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_2_trimmed_1																																																		93.2%	60%	109bp	107bp	9%	258.6M	93.2%	60%	109bp	107bp	9%	258.6M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_2_trimmed_2																																																		92.5%	60%	110bp	107bp	9%	258.6M	92.5%	60%	110bp	107bp	9%	258.6M
ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	7785806	No	0.00%	61389000	0.02%	0.88%	7544817	0.37%	0.43%	0.49%	0.57%	2769032	1377405	3719737	1821158	3.02	1.00	0.01%	0.00%	0.97	0.000	56494774	0.7538	93.4bp	91.0bp	0.02%	1.00%	0.48%	0.00%	0.04%	3.17%	0.83%	0.00%	0.10				89.2%	70.6%	90.6%	27.8M	47.9%	97.2%	5584.9Mb	61.4M	60.7%	76.5%	83.9%
ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				93.4bp	89.1%	27.3M												89.5%	60%	151bp	151bp	45%	40.1M
ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		88.5%	68%	151bp	151bp	55%	40.1M
ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		86.6%	60%	93bp	92bp	9%	30.7M	86.6%	60%	93bp	92bp	9%	30.7M
ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		86.2%	60%	94bp	92bp	9%	30.7M	86.2%	60%	94bp	92bp	9%	30.7M
ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1	9999000000	2439329	Skipped	N/A%	18190508	0.03%	0.86%	2606350	0.39%	0.50%	0.41%	0.50%	1024435	509483	1065180	518795	0.99	0.00	0.00%	0.00%	0.97	0.000	14906254	0.8162	82.2bp	79.0bp	0.07%	0.85%	0.52%	0.00%	0.15%	2.60%	0.84%	0.00%	0.27				88.2%	50.4%	80.7%	7.3M	52.9%	96.9%	1450.6Mb	18.2M	62.2%	47.7%	72.5%
ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_1																																				82.2bp	86.4%	7.9M												92.6%	65%	151bp	151bp	45%	19.1M
ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_2																																																		91.5%	79%	151bp	151bp	55%	19.1M
ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_1																																																		85.0%	61%	82bp	82bp	18%	9.1M	85.0%	61%	82bp	82bp	18%	9.1M
ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_2																																																		84.8%	62%	83bp	82bp	36%	9.1M	84.8%	62%	83bp	82bp	36%	9.1M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1	9999000000	8582027	Skipped	N/A%	19697784	0.03%	0.71%	5689605	0.47%	0.53%	0.42%	0.47%	2685316	1343039	2410000	1177529	3.27	1.00	0.01%	0.00%	0.97	0.000	15671382	0.8553	97.6bp	94.0bp	0.25%	0.45%	0.17%	0.00%	0.55%	1.50%	0.30%	0.00%	4.87				73.3%	44.9%	78.5%	7.7M	40.2%	96.0%	1794.7Mb	19.7M	62.0%	65.0%	77.2%
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1_1																																				97.6bp	79.1%	7.8M												80.7%	63%	151bp	151bp	45%	15.2M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1_2																																																		78.5%	72%	151bp	151bp	55%	15.2M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1_trimmed_1																																																		71.5%	61%	95bp	92bp	18%	9.8M	71.5%	61%	95bp	92bp	18%	9.8M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1_trimmed_2																																																		70.8%	62%	95bp	92bp	18%	9.8M	70.8%	62%	95bp	92bp	18%	9.8M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_2	9999000000	15025428	No	0.00%	242164278	0.02%	0.93%	17911316	0.47%	0.61%	0.32%	0.39%	8501586	4221256	5714246	2742011	10.74	2.00	0.06%	0.01%	0.97	0.000	213893238	0.7611	97.5bp	93.0bp	0.02%	0.80%	0.48%	0.00%	0.04%	2.38%	0.79%	0.00%	4.31				94.0%	67.5%	87.3%	105.7M	47.9%	97.2%	23847.5Mb	242.2M	60.0%	91.3%	86.1%
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_2_1																																				97.5bp	94.0%	113.8M												92.4%	57%	151bp	151bp	36%	132.6M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_2_2																																																		91.1%	61%	151bp	151bp	55%	132.6M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_2_trimmed_1																																																		92.0%	59%	101bp	97bp	9%	121.1M	92.0%	59%	101bp	97bp	9%	121.1M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_2_trimmed_2																																																		91.6%	60%	101bp	97bp	9%	121.1M	91.6%	60%	101bp	97bp	9%	121.1M
ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1	9999000000	9896024	No	0.00%	72292356	0.02%	0.87%	9550100	0.32%	0.38%	0.53%	0.62%	3073019	1530754	5055753	2481948	3.28	1.00	0.01%	0.00%	0.98	0.000	65985162	0.7716	88.4bp	86.0bp	0.02%	2.43%	0.38%	0.00%	0.04%	6.93%	0.65%	0.00%	0.44				88.5%	70.7%	90.1%	32.6M	41.2%	97.3%	6299.1Mb	72.3M	58.3%	77.3%	85.7%
ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1_1																																				88.4bp	87.3%	31.5M												88.7%	58%	151bp	151bp	45%	46.8M
ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1_2																																																		87.8%	66%	151bp	151bp	55%	46.8M
ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1_trimmed_1																																																		85.6%	58%	89bp	87bp	9%	36.1M	85.6%	58%	89bp	87bp	9%	36.1M
ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1_trimmed_2																																																		85.5%	58%	90bp	87bp	9%	36.1M	85.5%	58%	90bp	87bp	9%	36.1M
ColoN_FFPE_L08_RNA_01_B23LG7FLT4_1	9999000000	23056046	No	0.00%	216611782	0.02%	0.89%	23864286	0.42%	0.51%	0.42%	0.49%	10028745	4996847	9917155	4850703	12.18	4.00	0.10%	0.01%	0.98	0.000	201332238	0.8725	101.0bp	97.0bp	0.04%	1.19%	0.28%	0.00%	0.07%	3.71%	0.49%	0.00%	0.09				90.6%	77.3%	91.8%	99.4M	45.7%	97.4%	21271.0Mb	216.6M	57.8%	93.0%	88.2%
ColoN_FFPE_L08_RNA_01_B23LG7FLT4_1_1																																				101.0bp	91.8%	99.4M												88.7%	56%	151bp	151bp	45%	116.4M
ColoN_FFPE_L08_RNA_01_B23LG7FLT4_1_2																																																		87.8%	58%	151bp	151bp	45%	116.4M
ColoN_FFPE_L08_RNA_01_B23LG7FLT4_1_trimmed_1																																																		88.1%	57%	101bp	97bp	9%	108.3M	88.1%	57%	101bp	97bp	9%	108.3M
ColoN_FFPE_L08_RNA_01_B23LG7FLT4_1_trimmed_2																																																		88.0%	57%	101bp	97bp	9%	108.3M	88.0%	57%	101bp	97bp	9%	108.3M
EndoN_FFPE_L01_RNA_01_B23LG7FLT4_1	9999000000	95786442	No	0.00%	586332838	0.01%	0.85%	89598283	0.66%	0.71%	0.28%	0.29%	59052321	29527622	24964809	12019689	80.92	29.00	0.49%	0.22%	0.98	0.000	558416281	0.8607	107.9bp	102.0bp	0.03%	1.37%	0.64%	0.00%	0.06%	4.45%	1.07%	0.00%	0.08				85.5%	83.6%	94.2%	276.2M	47.0%	97.4%	61746.7Mb	586.3M	58.4%	97.7%	84.1%
EndoN_FFPE_L01_RNA_01_B23LG7FLT4_1_1																																				107.9bp	94.1%	275.8M												90.5%	56%	151bp	151bp	18%	641.3M
EndoN_FFPE_L01_RNA_01_B23LG7FLT4_1_2																																																		89.3%	57%	151bp	151bp	45%	641.3M
EndoN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_1																																																		86.6%	58%	108bp	107bp	9%	293.2M	86.6%	58%	108bp	107bp	9%	293.2M
EndoN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_2																																																		86.2%	58%	108bp	107bp	9%	293.2M	86.2%	58%	108bp	107bp	9%	293.2M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	21543013	No	0.00%	27371754	0.02%	0.59%	11205270	0.41%	0.44%	0.53%	0.56%	4582545	2294660	5944907	2929757	5.54	2.00	0.03%	0.00%	0.97	0.000	24683405	0.8844	96.2bp	93.0bp	0.12%	0.90%	0.23%	0.00%	0.26%	2.84%	0.36%	0.00%	0.36				60.6%	65.3%	88.9%	12.2M	27.2%	96.5%	2513.0Mb	27.4M	56.4%	78.4%	84.0%
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				96.2bp	74.1%	10.1M												67.1%	58%	151bp	151bp	45%	17.4M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		65.6%	64%	151bp	151bp	55%	17.4M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		58.9%	56%	95bp	92bp	18%	13.7M	58.9%	56%	95bp	92bp	18%	13.7M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		58.5%	56%	95bp	92bp	18%	13.7M	58.5%	56%	95bp	92bp	18%	13.7M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_2	9999000000	15133684	No	0.00%	162645136	0.02%	0.89%	17418722	0.43%	0.54%	0.38%	0.46%	7440834	3705566	6549716	3192073	8.24	2.00	0.06%	0.01%	0.98	0.000	148995512	0.8848	93.7bp	91.0bp	0.04%	1.25%	0.47%	0.00%	0.08%	3.64%	0.75%	0.00%	0.40				91.2%	71.7%	90.3%	73.4M	39.0%	97.3%	14871.6Mb	162.6M	60.6%	91.6%	91.4%
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_2_1																																				93.7bp	90.1%	73.3M												88.9%	57%	151bp	151bp	36%	88.8M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_2_2																																																		87.5%	60%	151bp	151bp	55%	88.8M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_2_trimmed_1																																																		88.2%	60%	94bp	92bp	9%	81.3M	88.2%	60%	94bp	92bp	9%	81.3M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_2_trimmed_2																																																		87.8%	60%	94bp	92bp	9%	81.3M	87.8%	60%	94bp	92bp	9%	81.3M
EndoN_FFPE_L03_RNA_01_B23LG7FLT4_1	9999000000	16407449	No	0.00%	209585550	0.01%	0.91%	18159218	0.47%	0.57%	0.37%	0.43%	8624531	4288948	6749864	3271236	10.60	3.00	0.07%	0.01%	0.97	0.000	187348019	0.8921	101.9bp	98.0bp	0.04%	0.91%	0.62%	0.00%	0.10%	3.07%	1.11%	0.00%	5.38				92.6%	68.2%	88.2%	92.5M	47.3%	97.2%	20799.1Mb	209.6M	59.9%	92.7%	87.5%
EndoN_FFPE_L03_RNA_01_B23LG7FLT4_1_1																																				101.9bp	93.1%	97.6M												90.9%	57%	151bp	151bp	36%	113.1M
EndoN_FFPE_L03_RNA_01_B23LG7FLT4_1_2																																																		89.5%	59%	151bp	151bp	45%	113.1M
EndoN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_1																																																		90.6%	59%	102bp	102bp	9%	104.8M	90.6%	59%	102bp	102bp	9%	104.8M
EndoN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_2																																																		90.1%	60%	102bp	102bp	9%	104.8M	90.1%	60%	102bp	102bp	9%	104.8M
EndoN_FFPE_L04_RNA_01_B23LG7FLT4_1	9999000000	91334906	No	0.00%	585643630	0.01%	0.85%	86064435	0.63%	0.69%	0.29%	0.31%	54572085	27267803	25070228	12095482	73.27	27.00	0.48%	0.20%	0.97	0.000	556171749	0.8195	108.5bp	104.0bp	0.03%	1.29%	0.52%	0.00%	0.07%	4.19%	0.87%	0.00%	0.11				86.3%	83.1%	94.0%	275.1M	47.9%	97.3%	61894.0Mb	585.6M	58.5%	97.6%	84.3%
EndoN_FFPE_L04_RNA_01_B23LG7FLT4_1_1																																				108.5bp	94.1%	275.6M												90.1%	55%	151bp	151bp	18%	514.4M
EndoN_FFPE_L04_RNA_01_B23LG7FLT4_1_2																																																		88.4%	57%	151bp	151bp	45%	514.4M
EndoN_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_1																																																		87.3%	58%	108bp	107bp	9%	292.8M	87.3%	58%	108bp	107bp	9%	292.8M
EndoN_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_2																																																		86.5%	58%	109bp	107bp	9%	292.8M	86.5%	58%	109bp	107bp	9%	292.8M
EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1	9999000000	7541667	No	0.00%	50983470	0.01%	0.86%	7315238	0.41%	0.46%	0.49%	0.54%	3003004	1497455	3566704	1751875	3.17	1.00	0.01%	0.00%	0.97	0.000	47558066	0.8741	88.8bp	86.0bp	0.04%	1.41%	0.53%	0.00%	0.08%	4.11%	0.77%	0.00%	0.13				86.9%	74.8%	91.8%	23.4M	39.4%	97.3%	4465.9Mb	51.0M	57.1%	81.5%	87.7%
EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1_1																																				88.8bp	88.7%	22.6M												86.9%	56%	151bp	151bp	45%	31.3M
EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1_2																																																		86.0%	63%	151bp	151bp	55%	31.3M
EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1_trimmed_1																																																		84.2%	56%	90bp	87bp	9%	25.5M	84.2%	56%	90bp	87bp	9%	25.5M
EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1_trimmed_2																																																		84.1%	57%	90bp	87bp	9%	25.5M	84.1%	57%	90bp	87bp	9%	25.5M
EndoN_FFPE_L06_RNA_01_B23LG7FLT4_1	9999000000	50492028	No	0.00%	423102832	0.01%	0.89%	47526042	0.48%	0.54%	0.41%	0.46%	22670194	11304652	19720680	9617296	28.28	9.00	0.25%	0.05%	0.97	0.000	397095707	0.8776	102.3bp	97.0bp	0.02%	1.37%	0.49%	0.00%	0.05%	4.42%	0.86%	0.00%	0.11				89.9%	77.9%	92.9%	196.5M	45.2%	97.3%	42353.3Mb	423.1M	59.4%	96.2%	88.0%
EndoN_FFPE_L06_RNA_01_B23LG7FLT4_1_1																																				102.3bp	92.3%	195.3M												88.8%	56%	151bp	151bp	27%	219.8M
EndoN_FFPE_L06_RNA_01_B23LG7FLT4_1_2																																																		87.7%	59%	151bp	151bp	45%	219.8M
EndoN_FFPE_L06_RNA_01_B23LG7FLT4_1_trimmed_1																																																		88.6%	59%	103bp	102bp	9%	211.6M	88.6%	59%	103bp	102bp	9%	211.6M
EndoN_FFPE_L06_RNA_01_B23LG7FLT4_1_trimmed_2																																																		88.4%	59%	103bp	102bp	9%	211.6M	88.4%	59%	103bp	102bp	9%	211.6M
EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1	9999000000	8307853	No	0.00%	75872336	0.02%	0.87%	9634188	0.49%	0.60%	0.34%	0.40%	4692180	2340166	3241814	1577799	5.27	1.00	0.03%	0.00%	0.97	0.000	69211677	0.8614	95.7bp	93.0bp	0.04%	0.97%	0.44%	0.00%	0.08%	2.90%	0.69%	0.00%	0.86				89.3%	70.5%	89.8%	34.1M	46.7%	97.2%	7061.6Mb	75.9M	61.0%	90.6%	90.3%
EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1_1																																				95.7bp	90.1%	34.2M												87.1%	58%	151bp	151bp	36%	41.9M
EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1_2																																																		86.0%	61%	151bp	151bp	55%	41.9M
EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1_trimmed_1																																																		86.2%	60%	96bp	92bp	9%	37.9M	86.2%	60%	96bp	92bp	9%	37.9M
EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1_trimmed_2																																																		85.8%	61%	96bp	92bp	9%	37.9M	85.8%	61%	96bp	92bp	9%	37.9M
EndoN_FFPE_L09_RNA_01_B23LG7FLT4_1	9999000000	96347628	No	0.00%	587828224	0.01%	0.85%	90334299	0.69%	0.74%	0.25%	0.26%	62733782	31377731	22746041	10892423	86.68	34.00	0.52%	0.25%	0.97	0.000	561983878	0.8862	110.7bp	105.0bp	0.02%	1.50%	0.53%	0.00%	0.04%	4.75%	0.89%	0.00%	0.05				85.3%	84.7%	94.7%	278.2M	49.7%	97.4%	63107.6Mb	587.8M	58.1%	98.0%	82.7%
EndoN_FFPE_L09_RNA_01_B23LG7FLT4_1_1																																				110.7bp	94.9%	279.0M												91.5%	55%	151bp	151bp	18%	696.7M
EndoN_FFPE_L09_RNA_01_B23LG7FLT4_1_2																																																		89.6%	57%	151bp	151bp	45%	696.7M
EndoN_FFPE_L09_RNA_01_B23LG7FLT4_1_trimmed_1																																																		87.5%	57%	110bp	107bp	9%	293.9M	87.5%	57%	110bp	107bp	9%	293.9M
EndoN_FFPE_L09_RNA_01_B23LG7FLT4_1_trimmed_2																																																		86.6%	58%	110bp	107bp	9%	293.9M	86.6%	58%	110bp	107bp	9%	293.9M
FFPE_HD789_01_RNA_0002_B23LG7FLT4_1	9990000000	394474736	Yes	63.27%	588870310	0.01%	0.46%	320811083	0.89%	0.92%	0.09%	0.08%	286978661	145154687	30236558	12354015	587.34	255.00	0.71%	0.61%	0.97	0.000	567572924	0.9239	151.4bp	139.0bp	0.10%	0.99%	0.47%	0.00%	0.19%	2.90%	0.71%	0.00%	3.91				45.8%	88.1%	95.7%	281.6M	27.4%	96.8%	75010.4Mb	588.9M	55.7%	98.1%	50.8%
FFPE_HD789_01_RNA_0002_B23LG7FLT4_1_1																																				151.4bp	95.3%	280.6M												80.7%	54%	151bp	151bp	27%	381.0M
FFPE_HD789_01_RNA_0002_B23LG7FLT4_1_2																																																		80.1%	55%	151bp	151bp	18%	381.0M
FFPE_HD789_01_RNA_0002_B23LG7FLT4_1_trimmed_1																																																		78.9%	55%	132bp	147bp	27%	294.4M	78.9%	55%	132bp	147bp	27%	294.4M
FFPE_HD789_01_RNA_0002_B23LG7FLT4_1_trimmed_2																																																		79.4%	56%	132bp	147bp	18%	294.4M	79.4%	56%	132bp	147bp	18%	294.4M
FFPE_HD789_01_RNA_0004_B23LG7FLT4_1	9990000000	405762343	Yes	63.11%	592127520	0.01%	0.47%	311553794	0.94%	0.96%	0.05%	0.04%	291396838	147517792	16942065	5682729	608.98	225.00	0.70%	0.60%	0.97	0.000	572408847	0.9561	158.3bp	143.0bp	0.03%	2.06%	1.17%	0.00%	0.06%	5.64%	1.58%	0.00%	3.67				47.6%	90.3%	96.0%	284.3M	35.4%	97.3%	76697.1Mb	592.1M	55.2%	98.7%	46.1%
FFPE_HD789_01_RNA_0004_B23LG7FLT4_1_1																																				158.3bp	97.6%	289.1M												93.6%	54%	151bp	151bp	18%	2419.4M
FFPE_HD789_01_RNA_0004_B23LG7FLT4_1_2																																																		91.8%	55%	151bp	151bp	18%	2419.4M
FFPE_HD789_01_RNA_0004_B23LG7FLT4_1_trimmed_1																																																		84.9%	54%	133bp	151bp	9%	296.1M	84.9%	54%	133bp	151bp	9%	296.1M
FFPE_HD789_01_RNA_0004_B23LG7FLT4_1_trimmed_2																																																		84.2%	55%	133bp	151bp	9%	296.1M	84.2%	55%	133bp	151bp	9%	296.1M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_1	9999000000	372739393	No	0.00%	550834208	0.01%	0.47%	290708833	0.87%	0.90%	0.11%	0.10%	253453600	128204811	33137186	14167394	507.99	132.00	0.60%	0.52%	0.97	0.000	529523417	0.9335	147.7bp	136.0bp	0.12%	1.14%	0.80%	0.00%	0.23%	3.16%	1.12%	0.00%	6.59				47.6%	88.1%	95.2%	262.3M	28.4%	96.9%	69704.2Mb	550.8M	54.5%	98.4%	53.2%
FFPE_V4_0001_RNA_0001_B23LG7FLT4_1_1																																				147.7bp	93.2%	256.8M												78.5%	53%	151bp	151bp	36%	280.0M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_1_2																																																		78.7%	54%	151bp	151bp	18%	280.0M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		78.6%	54%	130bp	147bp	18%	275.4M	78.6%	54%	130bp	147bp	18%	275.4M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		79.6%	54%	131bp	147bp	9%	275.4M	79.6%	54%	131bp	147bp	9%	275.4M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_2	9999000000	307737477	No	0.00%	592125118	0.01%	0.54%	275300759	0.92%	0.95%	0.06%	0.05%	253664817	128326890	17722863	6447758	503.17	110.00	0.58%	0.51%	0.97	0.000	569493015	0.9717	146.9bp	133.0bp	0.04%	2.45%	2.20%	0.00%	0.06%	6.24%	2.69%	0.00%	6.28				53.9%	89.1%	95.4%	282.4M	36.9%	97.4%	74522.6Mb	592.1M	55.1%	98.7%	53.0%
FFPE_V4_0001_RNA_0001_B23LG7FLT4_2_1																																				146.9bp	96.4%	285.5M												93.7%	53%	151bp	151bp	18%	1932.9M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_2_2																																																		91.8%	55%	151bp	151bp	18%	1932.9M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		85.5%	54%	129bp	147bp	9%	296.1M	85.5%	54%	129bp	147bp	9%	296.1M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		84.8%	55%	129bp	147bp	9%	296.1M	84.8%	55%	129bp	147bp	9%	296.1M
HeadNeckN_FFPE_L01_RNA_01_B23LG7FLT4_1	9999000000	15051986	No	0.00%	247333524	0.01%	0.93%	17705925	0.48%	0.60%	0.34%	0.40%	8484474	4240943	5943020	2828650	11.24	2.00	0.07%	0.01%	0.97	0.000	214204239	0.9399	105.9bp	101.0bp	0.05%	1.52%	0.38%	0.00%	0.09%	3.94%	0.55%	0.00%	0.05				94.1%	62.5%	85.7%	105.9M	56.1%	97.1%	25275.7Mb	247.3M	59.4%	92.7%	84.6%
HeadNeckN_FFPE_L01_RNA_01_B23LG7FLT4_1_1																																				105.9bp	92.6%	114.5M												92.5%	57%	151bp	151bp	36%	133.4M
HeadNeckN_FFPE_L01_RNA_01_B23LG7FLT4_1_2																																																		90.7%	60%	151bp	151bp	45%	133.4M
HeadNeckN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_1																																																		92.3%	59%	105bp	102bp	9%	123.7M	92.3%	59%	105bp	102bp	9%	123.7M
HeadNeckN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_2																																																		91.6%	59%	105bp	102bp	9%	123.7M	91.6%	59%	105bp	102bp	9%	123.7M
HeadNeckN_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	13902011	No	0.00%	195077468	0.01%	0.92%	16022835	0.46%	0.57%	0.36%	0.43%	7356799	3674244	5789600	2787504	8.82	2.00	0.05%	0.01%	0.97	0.000	172757667	0.8800	95.8bp	92.0bp	0.08%	1.54%	0.29%	0.00%	0.14%	3.89%	0.43%	0.00%	0.16				93.2%	68.0%	87.6%	85.4M	48.0%	97.3%	18660.0Mb	195.1M	56.8%	91.0%	88.7%
HeadNeckN_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				95.8bp	93.1%	90.8M												91.9%	55%	151bp	151bp	45%	107.2M
HeadNeckN_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		90.2%	59%	151bp	151bp	55%	107.2M
HeadNeckN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		91.4%	56%	98bp	97bp	9%	97.5M	91.4%	56%	98bp	97bp	9%	97.5M
HeadNeckN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		90.7%	57%	99bp	97bp	9%	97.5M	90.7%	57%	99bp	97bp	9%	97.5M
HeadNeckN_FFPE_L03_RNA_01_B23LG7FLT4_1	9999000000	11729099	No	0.00%	135201276	0.01%	0.91%	12420230	0.47%	0.56%	0.38%	0.44%	5898700	2935102	4739364	2305828	7.05	2.00	0.04%	0.01%	0.98	0.000	126319258	0.8213	97.4bp	94.0bp	0.04%	1.26%	0.38%	0.00%	0.08%	4.04%	0.68%	0.00%	0.05				92.0%	77.5%	92.1%	62.3M	43.6%	97.4%	13037.1Mb	135.2M	58.3%	91.6%	88.9%
HeadNeckN_FFPE_L03_RNA_01_B23LG7FLT4_1_1																																				97.4bp	93.8%	63.4M												90.4%	57%	151bp	151bp	45%	73.8M
HeadNeckN_FFPE_L03_RNA_01_B23LG7FLT4_1_2																																																		89.3%	59%	151bp	151bp	55%	73.8M
HeadNeckN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_1																																																		89.8%	58%	99bp	97bp	9%	67.6M	89.8%	58%	99bp	97bp	9%	67.6M
HeadNeckN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_2																																																		89.5%	58%	99bp	97bp	9%	67.6M	89.5%	58%	99bp	97bp	9%	67.6M
HeadNeckN_FFPE_L04_RNA_01_B23LG7FLT4_1	9999000000	9788873	No	0.00%	103976672	0.01%	0.90%	10737725	0.55%	0.64%	0.31%	0.36%	5921852	2946027	3378629	1625544	7.09	2.00	0.04%	0.01%	0.97	0.000	94504489	0.8393	102.8bp	99.0bp	0.03%	0.85%	0.66%	0.00%	0.07%	2.83%	1.25%	0.00%	5.07				90.9%	68.1%	89.7%	46.6M	48.6%	97.1%	10241.1Mb	104.0M	62.0%	88.7%	85.8%
HeadNeckN_FFPE_L04_RNA_01_B23LG7FLT4_1_1																																				102.8bp	92.5%	48.1M												89.6%	60%	151bp	151bp	36%	58.6M
HeadNeckN_FFPE_L04_RNA_01_B23LG7FLT4_1_2																																																		88.1%	63%	151bp	151bp	55%	58.6M
HeadNeckN_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_1																																																		88.7%	61%	101bp	102bp	9%	52.0M	88.7%	61%	101bp	102bp	9%	52.0M
HeadNeckN_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_2																																																		88.1%	62%	102bp	102bp	9%	52.0M	88.1%	62%	102bp	102bp	9%	52.0M
HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1	9999000000	4127363	No	0.00%	32870144	0.03%	0.86%	4540088	0.48%	0.59%	0.34%	0.41%	2166720	1079842	1527744	741320	2.27	0.00	0.01%	0.00%	0.97	0.000	28470535	0.8458	87.0bp	84.0bp	0.03%	0.74%	0.68%	0.00%	0.05%	1.87%	0.89%	0.00%	3.87				88.5%	58.0%	85.4%	14.0M	46.4%	97.2%	2846.4Mb	32.9M	59.2%	70.4%	82.3%
HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1_1																																				87.0bp	89.2%	14.7M												90.4%	61%	151bp	151bp	45%	23.4M
HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1_2																																																		89.3%	69%	151bp	151bp	55%	23.4M
HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1_trimmed_1																																																		86.7%	58%	89bp	87bp	9%	16.4M	86.7%	58%	89bp	87bp	9%	16.4M
HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1_trimmed_2																																																		86.2%	59%	89bp	87bp	9%	16.4M	86.2%	59%	89bp	87bp	9%	16.4M
HeadNeckN_FFPE_L06_RNA_01_B23LG7FLT4_1	9999000000	26574433	No	0.00%	136817496	0.02%	0.81%	26412086	0.63%	0.69%	0.29%	0.31%	16512109	8256722	7600887	3680283	20.83	7.00	0.19%	0.03%	0.98	0.000	125803360	0.8662	102.0bp	97.0bp	0.04%	1.70%	0.58%	0.00%	0.07%	4.69%	0.86%	0.00%	0.09				82.1%	75.0%	90.9%	62.2M	40.9%	97.4%	13611.1Mb	136.8M	57.3%	93.4%	87.1%
HeadNeckN_FFPE_L06_RNA_01_B23LG7FLT4_1_1																																				102.0bp	91.2%	62.4M												83.3%	55%	151bp	151bp	27%	73.3M
HeadNeckN_FFPE_L06_RNA_01_B23LG7FLT4_1_2																																																		82.0%	58%	151bp	151bp	45%	73.3M
HeadNeckN_FFPE_L06_RNA_01_B23LG7FLT4_1_trimmed_1																																																		82.4%	57%	102bp	102bp	9%	68.4M	82.4%	57%	102bp	102bp	9%	68.4M
HeadNeckN_FFPE_L06_RNA_01_B23LG7FLT4_1_trimmed_2																																																		82.0%	57%	102bp	102bp	9%	68.4M	82.0%	57%	102bp	102bp	9%	68.4M
HeadNeckN_FFPE_L08_RNA_01_B23LG7FLT4_1	9999000000	83133968	No	0.00%	585941436	0.01%	0.87%	75319878	0.60%	0.67%	0.31%	0.33%	45345784	22669267	23252223	11183706	62.55	21.00	0.43%	0.17%	0.97	0.000	554210270	0.8303	113.7bp	109.0bp	0.02%	1.35%	0.43%	0.00%	0.04%	4.22%	0.75%	0.00%	0.07				88.2%	81.2%	93.6%	274.1M	52.9%	97.2%	63897.2Mb	585.9M	60.5%	97.7%	81.4%
HeadNeckN_FFPE_L08_RNA_01_B23LG7FLT4_1_1																																				113.7bp	93.6%	274.3M												90.8%	57%	151bp	151bp	18%	561.9M
HeadNeckN_FFPE_L08_RNA_01_B23LG7FLT4_1_2																																																		89.0%	59%	151bp	151bp	45%	561.9M
HeadNeckN_FFPE_L08_RNA_01_B23LG7FLT4_1_trimmed_1																																																		87.8%	60%	112bp	112bp	9%	293.0M	87.8%	60%	112bp	112bp	9%	293.0M
HeadNeckN_FFPE_L08_RNA_01_B23LG7FLT4_1_trimmed_2																																																		87.0%	60%	112bp	112bp	9%	293.0M	87.0%	60%	112bp	112bp	9%	293.0M
HeadNeckN_FFPE_L09_RNA_01_B23LG7FLT4_1	9999000000	21322875	No	0.00%	276638386	0.01%	0.91%	24521116	0.50%	0.59%	0.36%	0.41%	12244409	6085230	8756809	4226576	15.35	4.00	0.11%	0.02%	0.97	0.000	253594218	0.8679	104.6bp	100.0bp	0.05%	0.77%	0.63%	0.00%	0.10%	2.55%	1.16%	0.00%	5.34				92.3%	72.9%	90.6%	125.3M	49.8%	97.2%	28119.7Mb	276.6M	60.2%	93.3%	85.9%
HeadNeckN_FFPE_L09_RNA_01_B23LG7FLT4_1_1																																				104.6bp	93.1%	128.8M												90.9%	57%	151bp	151bp	36%	148.2M
HeadNeckN_FFPE_L09_RNA_01_B23LG7FLT4_1_2																																																		89.5%	60%	151bp	151bp	45%	148.2M
HeadNeckN_FFPE_L09_RNA_01_B23LG7FLT4_1_trimmed_1																																																		90.5%	59%	104bp	102bp	9%	138.3M	90.5%	59%	104bp	102bp	9%	138.3M
HeadNeckN_FFPE_L09_RNA_01_B23LG7FLT4_1_trimmed_2																																																		90.1%	60%	105bp	102bp	9%	138.3M	90.1%	60%	105bp	102bp	9%	138.3M
Hs746T_FFPE_RNA_0001_23LG7FLT4_1	9999000000	552308352	Yes	0.00%	589137944	0.01%	0.40%	350767788	0.88%	0.92%	0.10%	0.08%	309959692	156585340	33365710	14032798	607.11	203.00	0.65%	0.57%	0.97	0.000	567168836	0.9031	142.4bp	132.0bp	0.06%	0.78%	0.46%	0.00%	0.11%	2.31%	0.63%	0.00%	4.41				41.0%	88.9%	95.3%	280.8M	23.3%	96.7%	73318.4Mb	589.1M	55.0%	98.2%	56.6%
Hs746T_FFPE_RNA_0001_23LG7FLT4_1_1																																				142.4bp	94.4%	277.9M												82.0%	54%	151bp	151bp	27%	614.3M
Hs746T_FFPE_RNA_0001_23LG7FLT4_1_2																																																		81.7%	55%	151bp	151bp	27%	614.3M
Hs746T_FFPE_RNA_0001_23LG7FLT4_1_trimmed_1																																																		77.1%	54%	129bp	142bp	27%	294.6M	77.1%	54%	129bp	142bp	27%	294.6M
Hs746T_FFPE_RNA_0001_23LG7FLT4_1_trimmed_2																																																		78.0%	55%	129bp	142bp	18%	294.6M	78.0%	55%	129bp	142bp	18%	294.6M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	558789033	No	0.00%	589531542	0.01%	0.40%	351121311	0.88%	0.92%	0.10%	0.08%	309884280	156494824	33687800	14273598	604.51	208.00	0.65%	0.57%	0.97	0.000	568228061	0.9053	141.0bp	131.0bp	0.06%	0.78%	0.46%	0.00%	0.12%	2.33%	0.63%	0.00%	4.44				41.0%	89.6%	95.5%	281.4M	22.7%	96.8%	73187.8Mb	589.5M	54.5%	98.3%	57.3%
Hs746T_FFPE_RNA_0001_B23LG7FLT4_1_1																																				141.0bp	94.4%	278.2M												81.4%	54%	151bp	151bp	27%	551.5M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		81.2%	54%	151bp	151bp	27%	551.5M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		77.2%	54%	128bp	137bp	27%	294.8M	77.2%	54%	128bp	137bp	27%	294.8M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		78.2%	54%	128bp	142bp	18%	294.8M	78.2%	54%	128bp	142bp	18%	294.8M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	530258000	No	0.00%	589666170	0.01%	0.41%	346124580	0.88%	0.91%	0.10%	0.09%	305043892	153994132	33786256	14414776	586.68	203.00	0.65%	0.57%	0.97	0.000	568147637	0.9093	139.1bp	128.0bp	0.06%	0.80%	0.46%	0.00%	0.12%	2.38%	0.63%	0.00%	4.43				41.8%	89.2%	95.5%	281.4M	23.9%	96.9%	72392.7Mb	589.7M	54.3%	98.3%	59.4%
Hs746T_FFPE_RNA_0001_B23LG7FLT4_2_1																																				139.1bp	94.3%	278.1M												80.7%	53%	151bp	151bp	27%	481.5M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		80.7%	54%	151bp	151bp	27%	481.5M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		77.4%	54%	127bp	137bp	27%	294.8M	77.4%	54%	127bp	137bp	27%	294.8M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		78.4%	54%	127bp	137bp	18%	294.8M	78.4%	54%	127bp	137bp	18%	294.8M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_1	9999000000	532377996	No	0.00%	590374128	0.01%	0.41%	346226428	0.88%	0.90%	0.11%	0.10%	303724171	153395752	38676620	16771122	593.48	154.00	0.61%	0.53%	0.97	0.000	569540388	0.8315	142.4bp	132.0bp	0.15%	1.18%	0.47%	0.00%	0.32%	3.41%	0.68%	0.00%	6.97				41.6%	88.0%	95.5%	282.0M	23.8%	96.9%	73552.9Mb	590.4M	54.0%	98.4%	57.0%
KG1_FFPE_01_RNA_0003_B23LG7FLT4_1_1																																				142.4bp	93.9%	277.1M												79.3%	53%	151bp	151bp	27%	387.7M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_1_2																																																		78.8%	54%	151bp	151bp	27%	387.7M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_1_trimmed_1																																																		77.5%	53%	129bp	142bp	27%	295.2M	77.5%	53%	129bp	142bp	27%	295.2M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_1_trimmed_2																																																		78.0%	54%	129bp	142bp	18%	295.2M	78.0%	54%	129bp	142bp	18%	295.2M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_2	9999000000	546475315	No	0.00%	590205694	0.01%	0.41%	348859819	0.87%	0.90%	0.11%	0.10%	305063940	154132894	40049528	17397710	596.50	156.00	0.61%	0.53%	0.97	0.000	569492805	0.8474	142.7bp	131.0bp	0.15%	1.18%	0.47%	0.00%	0.32%	3.42%	0.68%	0.00%	7.00				41.2%	88.2%	95.6%	282.1M	23.2%	96.9%	73326.4Mb	590.2M	53.6%	98.4%	57.0%
KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_1																																				142.7bp	93.7%	276.4M												80.1%	53%	151bp	151bp	27%	446.0M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_2																																																		79.3%	53%	151bp	151bp	27%	446.0M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_trimmed_1																																																		77.4%	53%	128bp	142bp	27%	295.1M	77.4%	53%	128bp	142bp	27%	295.1M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_2_trimmed_2																																																		77.6%	53%	128bp	142bp	18%	295.1M	77.6%	53%	128bp	142bp	18%	295.1M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_3	9999000000	591169146	No	0.00%	590402464	0.01%	0.41%	345721960	0.86%	0.89%	0.12%	0.11%	298782142	150833831	43167626	19097081	571.03	151.00	0.60%	0.53%	0.97	0.000	569331538	0.8370	137.2bp	126.0bp	0.19%	1.19%	0.48%	0.00%	0.40%	3.44%	0.68%	0.00%	7.00				41.7%	88.4%	95.6%	282.3M	23.8%	96.9%	71987.0Mb	590.4M	53.2%	98.4%	60.3%
KG1_FFPE_01_RNA_0003_B23LG7FLT4_3_1																																				137.2bp	93.3%	275.5M												81.4%	52%	151bp	151bp	27%	512.2M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_3_2																																																		80.7%	53%	151bp	151bp	36%	512.2M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_3_trimmed_1																																																		78.0%	52%	126bp	137bp	27%	295.2M	78.0%	52%	126bp	137bp	27%	295.2M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_3_trimmed_2																																																		78.2%	53%	126bp	137bp	18%	295.2M	78.2%	53%	126bp	137bp	18%	295.2M
LungN_FFPE_L01_RNA_01_B23LG7FLT4_1	9999000000	122049373	No	0.00%	589528246	0.01%	0.78%	132336052	0.81%	0.86%	0.14%	0.14%	107648509	53977346	19151278	8838690	157.69	62.00	0.62%	0.39%	0.98	0.000	562262987	0.8620	114.3bp	108.0bp	0.02%	0.74%	0.46%	0.00%	0.04%	2.25%	0.74%	0.00%	5.17				78.3%	85.3%	94.4%	278.3M	43.8%	97.4%	64486.2Mb	589.5M	59.0%	98.3%	80.4%
LungN_FFPE_L01_RNA_01_B23LG7FLT4_1_1																																				114.3bp	95.5%	281.6M												90.5%	56%	151bp	151bp	18%	831.2M
LungN_FFPE_L01_RNA_01_B23LG7FLT4_1_2																																																		88.7%	57%	151bp	151bp	36%	831.2M
LungN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_1																																																		83.4%	58%	112bp	112bp	9%	294.8M	83.4%	58%	112bp	112bp	9%	294.8M
LungN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_2																																																		82.8%	59%	112bp	112bp	9%	294.8M	82.8%	59%	112bp	112bp	9%	294.8M
LungN_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	28602882	No	0.00%	341894236	0.01%	0.91%	31174917	0.50%	0.60%	0.34%	0.40%	15600277	7773149	10600197	5085535	19.78	5.00	0.17%	0.04%	0.97	0.000	315719795	0.8529	108.3bp	103.0bp	0.02%	0.38%	0.25%	0.00%	0.04%	1.13%	0.44%	0.00%	4.80				92.2%	75.3%	91.3%	156.1M	52.4%	97.0%	35394.0Mb	341.9M	63.3%	93.9%	84.0%
LungN_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				108.3bp	93.0%	159.0M												90.4%	60%	151bp	151bp	27%	182.0M
LungN_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		88.6%	62%	151bp	151bp	45%	182.0M
LungN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		90.2%	63%	107bp	107bp	9%	170.9M	90.2%	63%	107bp	107bp	9%	170.9M
LungN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		89.5%	63%	107bp	107bp	9%	170.9M	89.5%	63%	107bp	107bp	9%	170.9M
LungN_FFPE_L03_RNA_01_B23LG7FLT4_1	9999000000	94928651	No	0.00%	585289316	0.01%	0.84%	94901349	0.72%	0.78%	0.21%	0.22%	68121116	34179225	20155257	9444233	102.56	36.00	0.54%	0.28%	0.97	0.000	552230313	0.8694	120.3bp	113.0bp	0.02%	0.42%	0.27%	0.00%	0.05%	1.40%	0.48%	0.00%	5.18				84.7%	81.8%	93.5%	273.7M	52.9%	97.2%	65951.2Mb	585.3M	61.4%	97.5%	75.2%
LungN_FFPE_L03_RNA_01_B23LG7FLT4_1_1																																				120.3bp	94.4%	276.4M												91.0%	58%	151bp	151bp	18%	621.3M
LungN_FFPE_L03_RNA_01_B23LG7FLT4_1_2																																																		89.4%	59%	151bp	151bp	36%	621.3M
LungN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_1																																																		87.2%	61%	116bp	117bp	9%	292.6M	87.2%	61%	116bp	117bp	9%	292.6M
LungN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_2																																																		86.7%	61%	116bp	117bp	9%	292.6M	86.7%	61%	116bp	117bp	9%	292.6M
MCF7_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	561641644	No	0.00%	589549338	0.01%	0.40%	350932411	0.88%	0.90%	0.11%	0.10%	307631940	155328351	39550525	17211867	601.44	228.00	0.67%	0.58%	0.97	0.000	565797487	0.8470	142.1bp	131.0bp	0.23%	1.07%	0.41%	0.00%	0.47%	3.16%	0.60%	0.00%	0.03				40.7%	86.6%	95.0%	280.2M	23.0%	96.7%	73220.8Mb	589.5M	54.4%	98.3%	56.9%
MCF7_FFPE_RNA_0001_B23LG7FLT4_1_1																																				142.1bp	93.9%	276.9M												79.7%	53%	151bp	151bp	27%	441.1M
MCF7_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		79.3%	54%	151bp	151bp	27%	441.1M
MCF7_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		77.1%	54%	128bp	142bp	27%	294.8M	77.1%	54%	128bp	142bp	27%	294.8M
MCF7_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		77.6%	54%	128bp	142bp	18%	294.8M	77.6%	54%	128bp	142bp	18%	294.8M
MCF7_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	543453813	No	0.00%	589927266	0.01%	0.41%	346425549	0.88%	0.90%	0.11%	0.10%	303654314	153275503	38987588	16980333	587.16	219.00	0.66%	0.58%	0.97	0.000	565787723	0.8496	139.6bp	130.0bp	0.24%	1.07%	0.42%	0.00%	0.48%	3.15%	0.60%	0.00%	0.05				41.5%	86.4%	95.0%	280.2M	22.7%	96.8%	72691.0Mb	589.9M	54.8%	98.3%	58.7%
MCF7_FFPE_RNA_0001_B23LG7FLT4_2_1																																				139.6bp	94.1%	277.5M												79.4%	54%	151bp	151bp	27%	387.6M
MCF7_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		78.8%	55%	151bp	151bp	27%	387.6M
MCF7_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		77.6%	54%	127bp	137bp	27%	295.0M	77.6%	54%	127bp	137bp	27%	295.0M
MCF7_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		77.9%	55%	127bp	137bp	18%	295.0M	77.9%	55%	127bp	137bp	18%	295.0M
MCF7_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	551308462	No	0.00%	589900010	0.01%	0.41%	346756304	0.87%	0.90%	0.12%	0.10%	302348251	152616069	40604321	17780523	583.83	219.00	0.66%	0.58%	0.97	0.000	565408410	0.8554	139.9bp	129.0bp	0.25%	1.08%	0.42%	0.00%	0.50%	3.17%	0.61%	0.00%	0.05				41.5%	86.3%	94.9%	280.0M	23.0%	96.8%	72503.5Mb	589.9M	54.6%	98.3%	58.9%
MCF7_FFPE_RNA_0001_B23LG7FLT4_3_1																																				139.9bp	93.8%	276.5M												80.2%	53%	151bp	151bp	27%	446.5M
MCF7_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		80.0%	54%	151bp	151bp	27%	446.5M
MCF7_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		77.3%	54%	127bp	137bp	27%	295.0M	77.3%	54%	127bp	137bp	27%	295.0M
MCF7_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		78.2%	54%	127bp	137bp	18%	295.0M	78.2%	54%	127bp	137bp	18%	295.0M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	589373495	No	0.00%	590386242	0.01%	0.40%	354652029	0.90%	0.92%	0.09%	0.08%	318772096	160872825	32368870	13641513	632.99	251.00	0.69%	0.60%	0.97	0.000	568857148	0.8992	142.8bp	131.0bp	0.15%	0.68%	0.48%	0.00%	0.32%	2.08%	0.69%	0.00%	0.03				40.2%	88.7%	95.5%	282.0M	23.6%	96.9%	73888.0Mb	590.4M	54.0%	98.4%	55.8%
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_1_1																																				142.8bp	95.4%	281.7M												82.6%	53%	151bp	151bp	27%	615.8M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		82.5%	54%	151bp	151bp	27%	615.8M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		77.9%	53%	129bp	142bp	27%	295.2M	77.9%	53%	129bp	142bp	27%	295.2M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		79.0%	54%	129bp	142bp	18%	295.2M	79.0%	54%	129bp	142bp	18%	295.2M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	561269730	No	0.00%	590345296	0.01%	0.41%	349020731	0.90%	0.92%	0.09%	0.08%	313465364	158116071	32086901	13617304	610.83	241.00	0.68%	0.60%	0.97	0.000	568591697	0.9088	139.1bp	129.0bp	0.15%	0.69%	0.49%	0.00%	0.32%	2.10%	0.69%	0.00%	0.04				41.1%	88.7%	95.5%	282.0M	23.0%	96.9%	72825.2Mb	590.3M	54.1%	98.4%	58.7%
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_2_1																																				139.1bp	95.5%	282.0M												81.7%	53%	151bp	151bp	27%	499.8M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		81.7%	54%	151bp	151bp	27%	499.8M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		78.4%	53%	127bp	137bp	27%	295.2M	78.4%	53%	127bp	137bp	27%	295.2M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		79.4%	54%	127bp	137bp	18%	295.2M	79.4%	54%	127bp	137bp	18%	295.2M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	486390606	No	0.00%	589981746	0.01%	0.45%	324061762	0.89%	0.91%	0.10%	0.09%	287523911	144907736	33097232	14376292	542.15	213.00	0.68%	0.58%	0.97	0.000	567465580	0.9044	133.5bp	123.0bp	0.20%	0.70%	0.50%	0.00%	0.42%	2.11%	0.69%	0.00%	0.03				45.3%	88.7%	95.5%	281.8M	24.2%	96.8%	70934.0Mb	590.0M	53.5%	98.3%	63.4%
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3_1																																				133.5bp	95.4%	281.3M												82.6%	52%	151bp	151bp	27%	466.4M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		81.6%	54%	151bp	151bp	18%	466.4M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		79.9%	53%	124bp	132bp	27%	295.0M	79.9%	53%	124bp	132bp	27%	295.0M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		79.8%	53%	124bp	132bp	18%	295.0M	79.8%	53%	124bp	132bp	18%	295.0M
NTC_0001_0001_B23LG7FLT4_1	9999000000	50663	Skipped	N/A%	91966	0.31%	0.46%	50069	0.02%	0.03%	0.41%	0.97%	780	351	20349	9836	0.00	0.00	0.00%	0.00%	0.94	0.000	12425	0.4343	43.8bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00				66.5%	2.1%	11.2%	0.0M	53.4%	88.7%	4.8Mb	0.1M	71.1%	5.3%	51.8%
NTC_0001_0001_B23LG7FLT4_1_1																																				43.8bp	2.1%	0.0M												96.7%	74%	151bp	151bp	64%	0.9M
NTC_0001_0001_B23LG7FLT4_1_2																																																		91.3%	92%	151bp	151bp	64%	0.9M
NTC_0001_0001_B23LG7FLT4_1_trimmed_1																																																		53.9%	67%	58bp	32bp	55%	0.0M	53.9%	67%	58bp	32bp	55%	0.0M
NTC_0001_0001_B23LG7FLT4_1_trimmed_2																																																		55.1%	75%	60bp	32bp	45%	0.0M	55.1%	75%	60bp	32bp	45%	0.0M
NTC_0001_0001_B23LG7FLT4_2	9999000000	44662	Skipped	N/A%	2294400	0.99%	0.01%	2275468	0.00%	0.04%	0.00%	0.96%	399	199	9630	4724	0.00	0.00	0.00%	0.00%	0.90	0.000	6099	0.5533	55.1bp	31.0bp	0.00%	0.08%	0.00%	0.00%	0.00%	0.39%	0.00%	0.00%	0.00				65.4%	0.2%	0.2%	0.0M	78.2%	77.9%	266.3Mb	2.3M	86.1%	97.8%	2.3%
NTC_0001_0001_B23LG7FLT4_2_1																																				55.1bp	0.3%	0.0M												97.7%	72%	151bp	151bp	55%	1.2M
NTC_0001_0001_B23LG7FLT4_2_2																																																		97.6%	98%	151bp	151bp	55%	1.2M
NTC_0001_0001_B23LG7FLT4_2_trimmed_1																																																		98.1%	72%	150bp	151bp	55%	1.1M	98.1%	72%	150bp	151bp	55%	1.1M
NTC_0001_0001_B23LG7FLT4_2_trimmed_2																																																		98.5%	99%	148bp	151bp	55%	1.1M	98.5%	99%	148bp	151bp	55%	1.1M
OvarianND_FFPE_L01_RNA_01_B23LG7FLT4_1	9999000000	221100909	No	0.00%	592079068	0.01%	0.64%	215722496	0.88%	0.90%	0.11%	0.10%	189145495	95178696	23050535	10235265	316.78	142.00	0.69%	0.56%	0.98	0.000	566597006	0.9544	122.2bp	113.0bp	0.03%	2.62%	0.56%	0.00%	0.07%	7.68%	0.90%	0.00%	0.02				63.9%	87.1%	94.9%	280.8M	38.7%	97.5%	68053.4Mb	592.1M	54.5%	98.7%	71.4%
OvarianND_FFPE_L01_RNA_01_B23LG7FLT4_1_1																																				122.2bp	96.1%	284.6M												90.6%	53%	151bp	151bp	18%	958.4M
OvarianND_FFPE_L01_RNA_01_B23LG7FLT4_1_2																																																		89.2%	54%	151bp	151bp	18%	958.4M
OvarianND_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_1																																																		83.6%	54%	118bp	122bp	9%	296.0M	83.6%	54%	118bp	122bp	9%	296.0M
OvarianND_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_2																																																		82.8%	54%	118bp	122bp	9%	296.0M	82.8%	54%	118bp	122bp	9%	296.0M
OvarianND_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	269598805	No	0.00%	592297752	0.01%	0.59%	241610118	0.88%	0.90%	0.11%	0.10%	212100138	106711375	25980885	11606823	354.20	153.00	0.69%	0.56%	0.98	0.000	569982626	0.9532	120.0bp	111.0bp	0.04%	2.72%	0.55%	0.00%	0.09%	7.99%	0.85%	0.00%	0.04				59.6%	88.5%	95.5%	282.7M	34.6%	97.5%	67803.0Mb	592.3M	53.4%	98.7%	72.2%
OvarianND_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				120.0bp	95.9%	284.0M												89.2%	52%	151bp	151bp	18%	825.4M
OvarianND_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		87.8%	53%	151bp	151bp	18%	825.4M
OvarianND_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		82.9%	53%	117bp	117bp	9%	296.1M	82.9%	53%	117bp	117bp	9%	296.1M
OvarianND_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		82.0%	53%	118bp	117bp	9%	296.1M	82.0%	53%	118bp	117bp	9%	296.1M
OvarianND_FFPE_L03_RNA_01_B23LG7FLT4_1	9999000000	205007252	No	0.00%	591451582	0.01%	0.64%	212194705	0.87%	0.90%	0.11%	0.10%	184583641	92841134	24179537	10854029	303.55	125.00	0.67%	0.54%	0.98	0.000	565922952	0.9541	121.7bp	113.0bp	0.05%	3.47%	0.59%	0.00%	0.10%	9.84%	0.97%	0.00%	0.03				64.5%	87.3%	94.9%	280.6M	42.8%	97.5%	67697.3Mb	591.5M	53.7%	98.6%	72.6%
OvarianND_FFPE_L03_RNA_01_B23LG7FLT4_1_1																																				121.7bp	96.0%	284.0M												91.1%	52%	151bp	151bp	18%	991.5M
OvarianND_FFPE_L03_RNA_01_B23LG7FLT4_1_2																																																		89.3%	53%	151bp	151bp	18%	991.5M
OvarianND_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_1																																																		84.3%	53%	117bp	117bp	9%	295.7M	84.3%	53%	117bp	117bp	9%	295.7M
OvarianND_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_2																																																		83.2%	53%	117bp	117bp	9%	295.7M	83.2%	53%	117bp	117bp	9%	295.7M
OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1	9999000000	3987889	No	0.00%	21720066	0.03%	0.83%	3623709	0.33%	0.39%	0.52%	0.61%	1180137	589101	1873025	920908	1.24	0.00	0.00%	0.00%	0.97	0.000	19371247	0.8639	89.3bp	86.0bp	0.02%	2.12%	0.34%	0.00%	0.05%	6.21%	0.57%	0.00%	0.20				85.6%	63.0%	87.8%	9.5M	46.1%	97.2%	1882.8Mb	21.7M	57.3%	65.0%	79.7%
OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1_1																																				89.3bp	84.1%	9.1M												88.6%	62%	151bp	151bp	45%	16.7M
OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1_2																																																		87.6%	70%	151bp	151bp	55%	16.7M
OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_1																																																		82.7%	57%	89bp	87bp	9%	10.9M	82.7%	57%	89bp	87bp	9%	10.9M
OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_2																																																		82.4%	57%	89bp	87bp	9%	10.9M	82.4%	57%	89bp	87bp	9%	10.9M
OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	3825339	No	0.00%	24366786	0.02%	0.85%	3656644	0.31%	0.38%	0.53%	0.62%	1151801	574055	1932206	949390	1.23	0.00	0.00%	0.00%	0.97	0.000	21783082	0.8553	90.5bp	87.0bp	0.02%	1.82%	0.28%	0.00%	0.05%	5.33%	0.50%	0.00%	0.14				87.0%	62.8%	88.0%	10.7M	47.9%	97.1%	2134.7Mb	24.4M	58.5%	68.3%	81.2%
OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				90.5bp	85.0%	10.4M												88.8%	60%	151bp	151bp	45%	17.8M
OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		88.0%	70%	151bp	151bp	55%	17.8M
OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		84.0%	58%	90bp	87bp	9%	12.2M	84.0%	58%	90bp	87bp	9%	12.2M
OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		83.7%	58%	90bp	87bp	18%	12.2M	83.7%	58%	90bp	87bp	18%	12.2M
OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1	9999000000	10029711	No	0.00%	80330628	0.02%	0.88%	10024722	0.32%	0.37%	0.54%	0.63%	3166518	1577224	5410291	2660174	3.51	1.00	0.02%	0.00%	0.98	0.000	73643695	0.8437	93.3bp	90.0bp	0.03%	1.58%	0.30%	0.00%	0.07%	4.74%	0.50%	0.00%	0.15				89.1%	71.1%	90.6%	36.4M	45.4%	97.3%	7327.2Mb	80.3M	58.4%	82.9%	86.9%
OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1_1																																				93.3bp	87.4%	35.1M												88.7%	58%	151bp	151bp	45%	48.5M
OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1_2																																																		87.8%	64%	151bp	151bp	55%	48.5M
OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1_trimmed_1																																																		86.6%	58%	94bp	92bp	9%	40.2M	86.6%	58%	94bp	92bp	9%	40.2M
OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1_trimmed_2																																																		86.3%	58%	94bp	92bp	9%	40.2M	86.3%	58%	94bp	92bp	9%	40.2M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1	9999000000	2464933	Skipped	N/A%	2867098	0.08%	0.54%	1327796	0.27%	0.33%	0.56%	0.67%	352889	176649	745657	366846	0.35	0.00	0.00%	0.00%	0.97	0.000	2023704	0.8516	80.2bp	77.0bp	0.18%	1.15%	0.19%	0.00%	0.33%	3.15%	0.30%	0.00%	0.09				58.4%	28.2%	69.1%	1.0M	56.9%	95.3%	205.1Mb	2.9M	58.8%	22.1%	60.0%
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1_1																																				80.2bp	52.6%	0.8M												89.2%	70%	151bp	151bp	55%	6.5M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1_2																																																		87.8%	90%	151bp	151bp	55%	6.5M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_1																																																		53.7%	57%	75bp	72bp	27%	1.4M	53.7%	57%	75bp	72bp	27%	1.4M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1_trimmed_2																																																		53.9%	59%	76bp	72bp	36%	1.4M	53.9%	59%	76bp	72bp	36%	1.4M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2	9999000000	19378564	No	0.00%	367681812	0.03%	0.92%	28615488	0.37%	0.56%	0.31%	0.44%	10528622	5229963	8739169	4187836	13.07	3.00	0.09%	0.02%	0.97	0.000	244252907	0.8487	99.8bp	97.0bp	0.03%	1.12%	0.22%	0.00%	0.07%	3.85%	0.45%	0.00%	0.32				94.6%	22.4%	65.3%	120.1M	40.7%	96.2%	34032.9Mb	367.7M	65.3%	93.9%	89.7%
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2_1																																				99.8bp	72.1%	132.5M												91.7%	60%	151bp	151bp	36%	195.8M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2_2																																																		89.8%	63%	151bp	151bp	45%	195.8M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2_trimmed_1																																																		91.8%	65%	96bp	97bp	18%	183.8M	91.8%	65%	96bp	97bp	18%	183.8M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2_trimmed_2																																																		91.1%	65%	97bp	97bp	18%	183.8M	91.1%	65%	97bp	97bp	18%	183.8M
OvarianN_FFPE_L04_RNA_01_B23LG7FLT4_1	9999000000	53523191	No	0.00%	584977868	0.01%	0.90%	56913296	0.59%	0.70%	0.27%	0.30%	33611303	16777850	15344155	7319681	46.61	13.00	0.33%	0.11%	0.97	0.000	534202542	0.8227	110.7bp	105.0bp	0.03%	1.24%	0.39%	0.00%	0.06%	4.03%	0.71%	0.00%	0.02				91.5%	69.7%	90.2%	263.8M	54.2%	97.1%	62634.1Mb	585.0M	59.6%	97.5%	82.6%
OvarianN_FFPE_L04_RNA_01_B23LG7FLT4_1_1																																				110.7bp	93.5%	273.6M												92.7%	57%	151bp	151bp	27%	503.1M
OvarianN_FFPE_L04_RNA_01_B23LG7FLT4_1_2																																																		90.5%	58%	151bp	151bp	45%	503.1M
OvarianN_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_1																																																		90.8%	59%	110bp	107bp	9%	292.5M	90.8%	59%	110bp	107bp	9%	292.5M
OvarianN_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_2																																																		89.6%	59%	110bp	112bp	9%	292.5M	89.6%	59%	110bp	112bp	9%	292.5M
RT4_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	491916343	No	0.00%	589194810	0.01%	0.42%	343322186	0.88%	0.90%	0.11%	0.10%	301048252	151913695	38699612	16953118	583.70	230.00	0.66%	0.58%	0.97	0.000	566887077	0.9138	141.2bp	132.0bp	0.10%	0.99%	0.34%	0.00%	0.20%	2.96%	0.54%	0.00%	6.34				42.0%	87.3%	95.3%	280.8M	23.9%	96.8%	73272.3Mb	589.2M	55.1%	98.2%	57.5%
RT4_FFPE_RNA_0001_B23LG7FLT4_1_1																																				141.2bp	93.9%	276.5M												78.5%	54%	151bp	151bp	27%	386.4M
RT4_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		78.6%	55%	151bp	151bp	27%	386.4M
RT4_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		76.6%	54%	128bp	142bp	27%	294.6M	76.6%	54%	128bp	142bp	27%	294.6M
RT4_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		77.7%	55%	129bp	142bp	18%	294.6M	77.7%	55%	129bp	142bp	18%	294.6M
RT4_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	509590259	No	0.00%	589322988	0.01%	0.41%	347135262	0.87%	0.90%	0.12%	0.10%	303533080	153122149	40149683	17684254	589.23	237.00	0.66%	0.59%	0.97	0.000	567512492	0.9298	140.9bp	131.0bp	0.11%	0.99%	0.34%	0.00%	0.23%	2.98%	0.54%	0.00%	6.37				41.3%	87.7%	95.4%	281.2M	23.6%	96.8%	73372.5Mb	589.3M	54.5%	98.2%	57.4%
RT4_FFPE_RNA_0001_B23LG7FLT4_2_1																																				140.9bp	93.7%	276.1M												78.5%	53%	151bp	151bp	27%	374.4M
RT4_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		78.6%	54%	151bp	151bp	27%	374.4M
RT4_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		76.8%	54%	128bp	142bp	27%	294.7M	76.8%	54%	128bp	142bp	27%	294.7M
RT4_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		77.9%	54%	129bp	142bp	18%	294.7M	77.9%	54%	129bp	142bp	18%	294.7M
RT4_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	508994612	No	0.00%	588993362	0.01%	0.41%	345622471	0.87%	0.89%	0.12%	0.11%	301547717	152049223	40510182	17886496	576.43	230.00	0.66%	0.58%	0.97	0.000	566206227	0.9274	138.2bp	128.0bp	0.12%	1.01%	0.34%	0.00%	0.24%	3.01%	0.54%	0.00%	6.34				41.6%	87.0%	95.3%	280.6M	24.3%	96.8%	72173.2Mb	589.0M	54.7%	98.2%	59.7%
RT4_FFPE_RNA_0001_B23LG7FLT4_3_1																																				138.2bp	93.6%	275.8M												77.1%	54%	151bp	151bp	27%	315.1M
RT4_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		76.7%	55%	151bp	151bp	27%	315.1M
RT4_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		76.8%	54%	127bp	137bp	18%	294.5M	76.8%	54%	127bp	137bp	18%	294.5M
RT4_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		77.4%	54%	127bp	137bp	18%	294.5M	77.4%	54%	127bp	137bp	18%	294.5M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_1	9999000000	611337841	No	0.00%	590310308	0.01%	0.41%	346666015	0.90%	0.92%	0.09%	0.08%	310830691	156898477	32421017	13687417	606.43	181.00	0.63%	0.55%	0.97	0.000	568300801	0.8730	139.8bp	129.0bp	0.19%	1.07%	0.42%	0.00%	0.39%	3.07%	0.62%	0.00%	0.03				41.5%	86.7%	95.3%	281.3M	23.9%	96.9%	72877.9Mb	590.3M	55.5%	98.4%	57.9%
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_1_1																																				139.8bp	95.2%	281.0M												83.0%	54%	151bp	151bp	27%	654.9M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_1_2																																																		82.6%	55%	151bp	151bp	27%	654.9M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		78.1%	55%	127bp	137bp	27%	295.2M	78.1%	55%	127bp	137bp	27%	295.2M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		78.8%	55%	128bp	137bp	18%	295.2M	78.8%	55%	128bp	137bp	18%	295.2M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_2	9999000000	601347574	No	0.00%	590158780	0.01%	0.42%	344329812	0.90%	0.92%	0.09%	0.08%	308523189	155791885	32347626	13602952	610.62	184.00	0.63%	0.55%	0.97	0.000	568930339	0.8770	143.2bp	133.0bp	0.19%	1.06%	0.42%	0.00%	0.41%	3.06%	0.61%	0.00%	0.03				41.9%	87.5%	95.5%	281.8M	23.8%	96.7%	73615.0Mb	590.2M	55.3%	98.4%	56.0%
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_2_1																																				143.2bp	95.3%	281.1M												82.4%	54%	151bp	151bp	27%	591.1M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_2_2																																																		81.7%	55%	151bp	151bp	27%	591.1M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		78.2%	55%	129bp	142bp	27%	295.1M	78.2%	55%	129bp	142bp	27%	295.1M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		78.5%	55%	129bp	142bp	18%	295.1M	78.5%	55%	129bp	142bp	18%	295.1M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_3	9999000000	578180176	No	0.00%	590477960	0.01%	0.42%	343078317	0.90%	0.92%	0.09%	0.08%	307995638	155536052	31705988	13336725	615.77	186.00	0.63%	0.55%	0.97	0.000	569921522	0.8815	144.2bp	134.0bp	0.21%	1.06%	0.41%	0.00%	0.44%	3.05%	0.61%	0.00%	0.03				42.1%	88.0%	95.6%	282.4M	24.2%	96.8%	74309.0Mb	590.5M	55.1%	98.4%	54.8%
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_3_1																																				144.2bp	95.4%	281.5M												82.8%	54%	151bp	151bp	27%	562.7M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_3_2																																																		82.3%	55%	151bp	151bp	18%	562.7M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		78.9%	54%	130bp	142bp	27%	295.2M	78.9%	54%	130bp	142bp	27%	295.2M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		79.5%	55%	130bp	142bp	18%	295.2M	79.5%	55%	130bp	142bp	18%	295.2M
SW780_FFPE_RNA_0001_B23LG7FLT4_1	9990000000	491508974	No	0.00%	589302086	0.01%	0.43%	337340412	0.87%	0.90%	0.12%	0.10%	294494617	148551136	39153815	17263469	559.81	215.00	0.68%	0.59%	0.97	0.000	567164951	0.8780	138.3bp	129.0bp	0.19%	0.71%	0.38%	0.00%	0.42%	2.14%	0.55%	0.00%	0.03				43.0%	87.7%	95.4%	281.2M	23.8%	96.8%	72257.8Mb	589.3M	54.0%	98.2%	60.4%
SW780_FFPE_RNA_0001_B23LG7FLT4_1_1																																				138.3bp	94.1%	277.2M												79.0%	53%	151bp	151bp	27%	366.9M
SW780_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		78.3%	54%	151bp	151bp	27%	366.9M
SW780_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		77.6%	53%	127bp	137bp	27%	294.7M	77.6%	53%	127bp	137bp	27%	294.7M
SW780_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		77.8%	54%	127bp	137bp	18%	294.7M	77.8%	54%	127bp	137bp	18%	294.7M
SW780_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	501198790	No	0.00%	589867396	0.01%	0.42%	341588938	0.87%	0.90%	0.12%	0.10%	297879001	150289362	39915455	17595381	573.00	221.00	0.68%	0.59%	0.97	0.000	567872485	0.8812	140.6bp	130.0bp	0.21%	0.70%	0.38%	0.00%	0.47%	2.11%	0.55%	0.00%	0.04				42.4%	88.0%	95.4%	281.5M	24.0%	96.9%	72935.1Mb	589.9M	53.9%	98.3%	59.0%
SW780_FFPE_RNA_0001_B23LG7FLT4_2_1																																				140.6bp	93.9%	277.0M												79.0%	53%	151bp	151bp	27%	380.5M
SW780_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		79.1%	54%	151bp	151bp	27%	380.5M
SW780_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		77.3%	53%	128bp	137bp	27%	294.9M	77.3%	53%	128bp	137bp	27%	294.9M
SW780_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		78.3%	54%	128bp	137bp	18%	294.9M	78.3%	54%	128bp	137bp	18%	294.9M
SW780_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	458541816	No	0.00%	590195550	0.01%	0.46%	317625790	0.86%	0.88%	0.13%	0.12%	271786870	137018298	42097513	18913991	503.35	193.00	0.67%	0.57%	0.97	0.000	567644552	0.8686	133.3bp	123.0bp	0.24%	0.72%	0.38%	0.00%	0.54%	2.17%	0.55%	0.00%	0.04				46.5%	88.1%	95.5%	281.8M	24.3%	96.7%	70526.4Mb	590.2M	53.5%	98.4%	64.7%
SW780_FFPE_RNA_0001_B23LG7FLT4_3_1																																				133.3bp	93.6%	276.3M												79.7%	53%	151bp	151bp	27%	363.0M
SW780_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		79.0%	53%	151bp	151bp	27%	363.0M
SW780_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		78.4%	53%	124bp	132bp	27%	295.1M	78.4%	53%	124bp	132bp	27%	295.1M
SW780_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		78.6%	53%	124bp	132bp	18%	295.1M	78.6%	53%	124bp	132bp	18%	295.1M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1	9999000000	5501710	Skipped	N/A%	13730586	0.03%	0.73%	3672916	0.48%	0.54%	0.41%	0.46%	1769611	884837	1513089	738777	2.28	0.00	0.01%	0.00%	0.97	0.000	11421383	0.8164	100.9bp	97.0bp	0.06%	0.45%	0.10%	0.00%	0.16%	1.69%	0.21%	0.00%	5.23				75.4%	48.7%	81.9%	5.6M	37.3%	96.1%	1308.2Mb	13.7M	60.2%	67.9%	76.9%
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1_1																																				100.9bp	80.9%	5.6M												80.8%	62%	151bp	151bp	45%	10.1M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1_2																																																		79.0%	71%	151bp	151bp	55%	10.1M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_1																																																		72.8%	59%	99bp	97bp	18%	6.9M	72.8%	59%	99bp	97bp	18%	6.9M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1_trimmed_2																																																		71.9%	60%	100bp	97bp	9%	6.9M	71.9%	60%	100bp	97bp	9%	6.9M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_2	9999000000	15853658	No	0.00%	213720310	0.02%	0.91%	18386255	0.47%	0.57%	0.36%	0.43%	8584988	4268304	6576100	3169714	10.63	2.00	0.08%	0.01%	0.97	0.000	186495659	0.9027	104.8bp	100.0bp	0.03%	0.72%	0.42%	0.00%	0.06%	2.44%	0.83%	0.00%	4.77				92.8%	64.4%	86.2%	92.1M	49.6%	97.0%	21597.7Mb	213.7M	62.7%	92.6%	85.6%
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_2_1																																				104.8bp	92.7%	99.1M												91.1%	59%	151bp	151bp	36%	115.4M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_2_2																																																		89.4%	61%	151bp	151bp	55%	115.4M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_2_trimmed_1																																																		90.7%	62%	104bp	102bp	9%	106.9M	90.7%	62%	104bp	102bp	9%	106.9M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_2_trimmed_2																																																		90.0%	62%	104bp	102bp	9%	106.9M	90.0%	62%	104bp	102bp	9%	106.9M
SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1	9999000000	9054374	No	0.00%	147254276	0.02%	0.92%	11662901	0.44%	0.58%	0.33%	0.42%	5095375	2533665	3838871	1858668	6.23	1.00	0.03%	0.01%	0.97	0.000	127602593	0.7413	95.8bp	92.0bp	0.02%	0.50%	0.48%	0.00%	0.04%	1.60%	0.78%	0.00%	0.05				93.8%	64.8%	85.5%	62.9M	63.9%	97.2%	14497.6Mb	147.3M	59.6%	88.6%	86.3%
SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1_1																																				95.8bp	93.8%	69.1M												92.6%	58%	151bp	151bp	36%	83.1M
SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1_2																																																		91.3%	61%	151bp	151bp	55%	83.1M
SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_1																																																		91.9%	59%	101bp	97bp	9%	73.6M	91.9%	59%	101bp	97bp	9%	73.6M
SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1_trimmed_2																																																		91.4%	59%	101bp	102bp	9%	73.6M	91.4%	59%	101bp	102bp	9%	73.6M
SkinN_FFPE_L04_RNA_01_B23LG7FLT4_1	9999000000	47754896	No	0.00%	584588826	0.01%	0.91%	50388902	0.60%	0.70%	0.27%	0.30%	30065655	15007317	13517999	6421033	43.08	12.00	0.31%	0.10%	0.97	0.000	546516972	0.8729	112.6bp	107.0bp	0.02%	1.00%	0.38%	0.00%	0.05%	3.43%	0.71%	0.00%	0.03				92.5%	76.7%	92.5%	270.3M	56.6%	97.3%	63796.5Mb	584.6M	60.1%	97.4%	80.2%
SkinN_FFPE_L04_RNA_01_B23LG7FLT4_1_1																																				112.6bp	94.9%	277.5M												92.5%	57%	151bp	151bp	18%	371.4M
SkinN_FFPE_L04_RNA_01_B23LG7FLT4_1_2																																																		90.8%	58%	151bp	151bp	45%	371.4M
SkinN_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_1																																																		91.9%	59%	112bp	112bp	9%	292.3M	91.9%	59%	112bp	112bp	9%	292.3M
SkinN_FFPE_L04_RNA_01_B23LG7FLT4_1_trimmed_2																																																		91.0%	60%	112bp	112bp	9%	292.3M	91.0%	60%	112bp	112bp	9%	292.3M
SkinN_FFPE_L07_RNA_01_B23LG7FLT4_1	9999000000	35582658	No	0.00%	424849360	0.01%	0.91%	38421133	0.49%	0.57%	0.37%	0.43%	18741880	9336447	14279783	6928064	24.69	8.00	0.20%	0.04%	0.97	0.000	374494316	0.8923	107.8bp	103.0bp	0.08%	0.85%	0.46%	0.00%	0.18%	2.96%	0.82%	0.00%	5.22				92.1%	69.0%	87.2%	185.3M	53.1%	97.3%	44626.0Mb	424.8M	58.8%	95.8%	84.5%
SkinN_FFPE_L07_RNA_01_B23LG7FLT4_1_1																																				107.8bp	94.3%	200.4M												91.2%	56%	151bp	151bp	36%	221.7M
SkinN_FFPE_L07_RNA_01_B23LG7FLT4_1_2																																																		89.7%	58%	151bp	151bp	45%	221.7M
SkinN_FFPE_L07_RNA_01_B23LG7FLT4_1_trimmed_1																																																		91.0%	58%	108bp	107bp	9%	212.4M	91.0%	58%	108bp	107bp	9%	212.4M
SkinN_FFPE_L07_RNA_01_B23LG7FLT4_1_trimmed_2																																																		90.4%	58%	108bp	107bp	9%	212.4M	90.4%	58%	108bp	107bp	9%	212.4M
SkinN_FFPE_L08_RNA_01_B23LG7FLT4_1	9999000000	13256632	No	0.00%	135148228	0.02%	0.90%	13872897	0.37%	0.44%	0.47%	0.56%	5108995	2542491	6523228	3184624	6.20	2.00	0.04%	0.01%	0.97	0.000	122013739	0.8747	101.7bp	98.0bp	0.02%	1.28%	0.34%	0.00%	0.04%	3.93%	0.59%	0.00%	0.07				91.2%	65.5%	89.1%	60.2M	47.4%	97.1%	13283.9Mb	135.1M	60.9%	90.7%	86.3%
SkinN_FFPE_L08_RNA_01_B23LG7FLT4_1_1																																				101.7bp	89.4%	60.4M												89.7%	58%	151bp	151bp	36%	74.5M
SkinN_FFPE_L08_RNA_01_B23LG7FLT4_1_2																																																		88.2%	61%	151bp	151bp	55%	74.5M
SkinN_FFPE_L08_RNA_01_B23LG7FLT4_1_trimmed_1																																																		89.1%	60%	101bp	97bp	9%	67.6M	89.1%	60%	101bp	97bp	9%	67.6M
SkinN_FFPE_L08_RNA_01_B23LG7FLT4_1_trimmed_2																																																		88.4%	61%	101bp	97bp	9%	67.6M	88.4%	61%	101bp	97bp	9%	67.6M
SkinN_FFPE_L09_RNA_01_B23LG7FLT4_1	9990000000	78347163	No	0.00%	586431082	0.02%	0.86%	79275239	0.62%	0.71%	0.26%	0.29%	49395215	24694352	20592906	9896416	65.53	23.00	0.44%	0.17%	0.97	0.000	492749814	0.8512	103.9bp	99.0bp	0.06%	1.44%	0.37%	0.00%	0.14%	4.43%	0.62%	0.00%	0.04				87.9%	46.8%	83.1%	243.7M	44.1%	96.8%	58444.7Mb	586.4M	58.5%	97.7%	88.0%
SkinN_FFPE_L09_RNA_01_B23LG7FLT4_1_1																																				103.9bp	86.5%	253.5M												90.5%	56%	151bp	151bp	27%	487.6M
SkinN_FFPE_L09_RNA_01_B23LG7FLT4_1_2																																																		88.9%	57%	151bp	151bp	45%	487.6M
SkinN_FFPE_L09_RNA_01_B23LG7FLT4_1_trimmed_1																																																		88.2%	58%	103bp	102bp	9%	293.2M	88.2%	58%	103bp	102bp	9%	293.2M
SkinN_FFPE_L09_RNA_01_B23LG7FLT4_1_trimmed_2																																																		87.5%	58%	103bp	102bp	9%	293.2M	87.5%	58%	103bp	102bp	9%	293.2M
U118MG_FFPE_RNA_0001_B23LG7FLT4_1	9999000000	534015176	No	0.00%	589408386	0.01%	0.43%	334279097	0.90%	0.92%	0.09%	0.08%	301125305	151993343	29571343	12330332	598.90	213.00	0.66%	0.57%	0.97	0.000	571823786	0.8922	144.0bp	133.0bp	0.09%	0.50%	0.48%	0.00%	0.20%	1.65%	0.73%	0.00%	4.11				43.6%	89.3%	96.0%	282.9M	25.3%	96.8%	73841.0Mb	589.4M	55.4%	98.2%	55.6%
U118MG_FFPE_RNA_0001_B23LG7FLT4_1_1																																				144.0bp	95.5%	281.6M												81.9%	54%	151bp	151bp	27%	547.8M
U118MG_FFPE_RNA_0001_B23LG7FLT4_1_2																																																		81.3%	55%	151bp	151bp	27%	547.8M
U118MG_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_1																																																		77.9%	55%	129bp	142bp	27%	294.7M	77.9%	55%	129bp	142bp	27%	294.7M
U118MG_FFPE_RNA_0001_B23LG7FLT4_1_trimmed_2																																																		78.5%	55%	130bp	142bp	18%	294.7M	78.5%	55%	130bp	142bp	18%	294.7M
U118MG_FFPE_RNA_0001_B23LG7FLT4_2	9999000000	544986088	No	0.00%	589673696	0.01%	0.43%	337027818	0.90%	0.93%	0.09%	0.07%	303712181	153282044	29730979	12415724	601.65	214.00	0.66%	0.57%	0.97	0.000	571962086	0.8933	142.6bp	132.0bp	0.09%	0.50%	0.48%	0.00%	0.20%	1.66%	0.73%	0.00%	4.08				43.1%	89.3%	96.0%	283.1M	23.4%	96.7%	73584.3Mb	589.7M	55.5%	98.3%	56.1%
U118MG_FFPE_RNA_0001_B23LG7FLT4_2_1																																				142.6bp	95.5%	281.7M												82.0%	54%	151bp	151bp	27%	576.4M
U118MG_FFPE_RNA_0001_B23LG7FLT4_2_2																																																		81.5%	55%	151bp	151bp	27%	576.4M
U118MG_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_1																																																		77.6%	55%	129bp	142bp	27%	294.8M	77.6%	55%	129bp	142bp	27%	294.8M
U118MG_FFPE_RNA_0001_B23LG7FLT4_2_trimmed_2																																																		78.3%	55%	129bp	142bp	18%	294.8M	78.3%	55%	129bp	142bp	18%	294.8M
U118MG_FFPE_RNA_0001_B23LG7FLT4_3	9999000000	527535555	No	0.00%	589689266	0.01%	0.44%	332928122	0.90%	0.92%	0.09%	0.08%	299259422	151018366	30250090	12718611	591.08	214.00	0.66%	0.57%	0.97	0.000	572199687	0.9161	142.1bp	131.0bp	0.10%	0.51%	0.49%	0.00%	0.22%	1.67%	0.73%	0.00%	4.15				43.8%	89.5%	96.1%	283.4M	24.6%	96.9%	73476.9Mb	589.7M	55.0%	98.3%	56.5%
U118MG_FFPE_RNA_0001_B23LG7FLT4_3_1																																				142.1bp	95.5%	281.5M												82.8%	54%	151bp	151bp	27%	574.0M
U118MG_FFPE_RNA_0001_B23LG7FLT4_3_2																																																		82.2%	55%	151bp	151bp	27%	574.0M
U118MG_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_1																																																		78.6%	54%	129bp	142bp	27%	294.8M	78.6%	54%	129bp	142bp	27%	294.8M
U118MG_FFPE_RNA_0001_B23LG7FLT4_3_trimmed_2																																																		79.1%	55%	129bp	142bp	18%	294.8M	79.1%	55%	129bp	142bp	18%	294.8M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: RSeQC	Unique Reads	Reads with mapq >= mapq_cut (uniquely mapped)	`unique_reads_rseqc`	None
\|\|	Custom content: RSeQC	Frac Antisense	Fraction of reads explained by antisense orientation (1+-,1-+,2++,2--)	`frac_antisense`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Expression QC	ChrY Signature Score	Mean log2(TPM+1) score for chrY signature genes; used for sex verification.	`score_log2tpm1_mean_chry_signature`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
22Rv1_FFPE_RNA_0001_B23LG7FLT4_1	43.7M	0.0M	0.0M	14.6M	0.9M	25.2M	12.6M	12.6M	12.6M	12.6M	19.1M	6.1M	25.1M	0.0M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_2	36.5M	0.0M	0.0M	10.1M	0.8M	23.4M	11.7M	11.7M	11.7M	11.7M	17.6M	5.8M	23.2M	0.0M
22Rv1_FFPE_RNA_0001_B23LG7FLT4_3	39.6M	0.0M	0.0M	11.6M	0.8M	24.7M	12.3M	12.3M	12.3M	12.3M	18.6M	6.1M	24.5M	0.0M
786-O_FFPE_RNA_0001_B23LG7FLT4_1	636.6M	0.0M	0.0M	45.4M	3.4M	570.2M	285.2M	285.0M	285.1M	285.1M	301.6M	268.6M	568.3M	0.0M
786-O_FFPE_RNA_0001_B23LG7FLT4_2	636.7M	0.0M	0.0M	44.7M	3.3M	571.3M	285.8M	285.5M	285.7M	285.6M	303.1M	268.2M	569.5M	0.0M
786-O_FFPE_RNA_0001_B23LG7FLT4_3	637.3M	0.0M	0.0M	45.9M	3.3M	570.5M	285.4M	285.1M	285.3M	285.2M	304.3M	266.2M	568.7M	0.0M
A549_FFPE_01_RNA_0001_B23LG7FLT4_1	3.8M	0.0M	0.0M	3.1M	0.2M	0.1M	0.0M	0.0M	0.0M	0.0M	0.1M	0.0M	0.1M	0.0M
A549_FFPE_01_RNA_0001_B23LG7FLT4_2	1.6M	0.0M	0.0M	1.3M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
A549_FFPE_01_RNA_0001_B23LG7FLT4_3	4.8M	0.0M	0.0M	3.9M	0.2M	0.1M	0.1M	0.0M	0.1M	0.0M	0.1M	0.0M	0.1M	0.0M
A673_FFPE_RNA_0001_B23LG7FLT4_1	638.3M	0.0M	0.0M	46.1M	3.1M	570.7M	285.5M	285.2M	285.4M	285.3M	304.8M	265.8M	568.8M	0.0M
A673_FFPE_RNA_0001_B23LG7FLT4_2	639.9M	0.0M	0.0M	48.2M	3.3M	569.3M	284.8M	284.5M	284.7M	284.6M	309.8M	259.5M	567.6M	0.0M
A673_FFPE_RNA_0001_B23LG7FLT4_3	639.2M	0.0M	0.0M	46.8M	3.1M	570.5M	285.4M	285.1M	285.3M	285.2M	312.0M	258.4M	568.8M	0.0M
BT-20_FFPE_RNA_0001_B23LG7FLT4_1	216.8M	0.0M	0.0M	44.0M	3.0M	158.9M	79.6M	79.4M	79.5M	79.5M	126.2M	32.7M	158.1M	0.0M
BT-20_FFPE_RNA_0001_B23LG7FLT4_2	218.0M	0.0M	0.0M	45.6M	3.1M	158.2M	79.2M	79.0M	79.1M	79.1M	125.3M	32.9M	157.4M	0.0M
BT-20_FFPE_RNA_0001_B23LG7FLT4_3	201.3M	0.0M	0.0M	37.8M	2.8M	151.1M	75.7M	75.5M	75.6M	75.6M	119.1M	32.0M	150.4M	0.0M
BreastNB_FFPE_L01_RNA_01_B23LG7FLT4_1	118.3M	0.0M	0.0M	27.5M	1.4M	82.3M	41.2M	41.1M	41.2M	41.2M	62.1M	20.3M	82.0M	0.0M
BreastNB_FFPE_L02_RNA_01_B23LG7FLT4_1	126.5M	0.0M	0.0M	26.6M	1.5M	91.4M	45.8M	45.6M	45.7M	45.7M	66.8M	24.7M	91.0M	0.0M
BreastNB_FFPE_L03_RNA_01_B23LG7FLT4_1	182.2M	0.0M	0.0M	33.3M	2.1M	137.9M	69.0M	68.8M	69.0M	68.9M	100.5M	37.4M	137.2M	0.0M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_1	29.5M	0.0M	0.0M	10.3M	0.7M	16.5M	8.3M	8.3M	8.3M	8.3M	12.8M	3.7M	16.4M	0.0M
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2	27.0M	0.0M	0.0M	8.9M	0.4M	15.0M	7.5M	7.5M	7.5M	7.5M	12.3M	2.7M	14.9M	0.0M
BreastNP_FFPE_L03_RNA_01_B23LG7FLT4_1	91.4M	0.0M	0.0M	24.8M	1.0M	57.9M	29.0M	28.9M	29.0M	29.0M	42.8M	15.2M	57.7M	0.0M
BreastNP_FFPE_L04_RNA_01_B23LG7FLT4_1	89.1M	0.0M	0.0M	22.4M	1.1M	60.4M	30.2M	30.1M	30.2M	30.2M	45.6M	14.8M	60.1M	0.0M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_1	44.1M	0.0M	0.0M	14.6M	0.6M	24.0M	12.0M	12.0M	12.0M	12.0M	18.7M	5.3M	23.8M	0.0M
ColoN_FFPE_L01_RNA_01_B23LG7FLT4_2	735.6M	0.0M	0.0M	215.4M	8.4M	428.5M	214.4M	214.1M	214.3M	214.2M	289.2M	139.3M	427.0M	0.0M
ColoN_FFPE_L02_RNA_01_B23LG7FLT4_1	79.6M	0.0M	0.0M	17.8M	1.1M	56.5M	28.3M	28.2M	28.3M	28.2M	43.8M	12.7M	56.2M	0.0M
ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1	29.4M	0.0M	0.0M	11.1M	0.5M	14.9M	7.5M	7.4M	7.5M	7.5M	12.2M	2.7M	14.8M	0.0M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_1	34.7M	0.0M	0.0M	14.9M	0.6M	15.7M	7.8M	7.8M	7.8M	7.8M	12.5M	3.2M	15.6M	0.0M
ColoN_FFPE_L06_RNA_01_B23LG7FLT4_2	315.5M	0.0M	0.0M	71.8M	3.7M	213.9M	107.1M	106.8M	107.0M	106.9M	160.9M	53.0M	213.0M	0.0M
ColoN_FFPE_L07_RNA_01_B23LG7FLT4_1	92.9M	0.0M	0.0M	20.1M	1.4M	66.0M	33.0M	33.0M	33.0M	33.0M	52.9M	13.1M	65.7M	0.0M
ColoN_FFPE_L08_RNA_01_B23LG7FLT4_1	259.2M	0.0M	0.0M	41.3M	3.9M	201.3M	100.8M	100.5M	100.7M	100.7M	153.9M	47.4M	200.5M	0.0M
EndoN_FFPE_L01_RNA_01_B23LG7FLT4_1	665.5M	0.0M	0.0M	76.3M	5.6M	558.4M	279.5M	278.9M	279.3M	279.1M	377.6M	180.9M	556.3M	0.0M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_1	37.6M	0.0M	0.0M	10.0M	0.7M	24.7M	12.4M	12.3M	12.3M	12.3M	19.9M	4.8M	24.6M	0.0M
EndoN_FFPE_L02_RNA_01_B23LG7FLT4_2	206.7M	0.0M	0.0M	42.8M	3.4M	149.0M	74.6M	74.4M	74.5M	74.5M	113.4M	35.6M	148.2M	0.0M
EndoN_FFPE_L03_RNA_01_B23LG7FLT4_1	273.6M	0.0M	0.0M	62.8M	2.8M	187.3M	93.8M	93.5M	93.7M	93.7M	138.2M	49.2M	186.5M	0.0M
EndoN_FFPE_L04_RNA_01_B23LG7FLT4_1	667.1M	0.0M	0.0M	78.6M	6.4M	556.2M	278.4M	277.8M	278.1M	278.0M	381.5M	174.7M	554.1M	0.0M
EndoN_FFPE_L05_RNA_01_B23LG7FLT4_1	63.2M	0.0M	0.0M	11.8M	0.7M	47.6M	23.8M	23.7M	23.8M	23.8M	36.5M	11.1M	47.3M	0.0M
EndoN_FFPE_L06_RNA_01_B23LG7FLT4_1	507.6M	0.0M	0.0M	82.3M	5.1M	397.1M	198.8M	198.3M	198.6M	198.5M	281.3M	115.8M	395.7M	0.0M
EndoN_FFPE_L08_RNA_01_B23LG7FLT4_1	97.7M	0.0M	0.0M	21.2M	1.7M	69.2M	34.7M	34.6M	34.6M	34.6M	52.9M	16.3M	68.8M	0.0M
EndoN_FFPE_L09_RNA_01_B23LG7FLT4_1	661.1M	0.0M	0.0M	70.5M	4.9M	562.0M	281.3M	280.7M	281.0M	280.9M	377.6M	184.4M	560.0M	0.0M
FFPE_HD789_01_RNA_0002_B23LG7FLT4_1	642.6M	0.0M	0.0M	51.7M	3.6M	567.6M	283.9M	283.7M	283.8M	283.8M	292.3M	275.3M	566.0M	0.0M
FFPE_HD789_01_RNA_0004_B23LG7FLT4_1	632.0M	0.0M	0.0M	38.3M	3.2M	572.4M	286.3M	286.1M	286.2M	286.2M	272.7M	299.7M	571.0M	0.0M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_1	599.0M	0.0M	0.0M	46.0M	4.1M	529.5M	264.9M	264.6M	264.8M	264.7M	277.3M	252.2M	527.8M	0.0M
FFPE_V4_0001_RNA_0001_B23LG7FLT4_2	637.2M	0.0M	0.0M	43.0M	3.9M	569.5M	284.8M	284.6M	284.8M	284.7M	283.7M	285.8M	567.8M	0.0M
HeadNeckN_FFPE_L01_RNA_01_B23LG7FLT4_1	341.2M	0.0M	0.0M	92.3M	3.3M	214.2M	107.2M	107.0M	107.1M	107.1M	146.8M	67.4M	213.4M	0.0M
HeadNeckN_FFPE_L02_RNA_01_B23LG7FLT4_1	253.2M	0.0M	0.0M	57.0M	2.9M	172.8M	86.5M	86.3M	86.4M	86.4M	122.7M	50.0M	172.1M	0.0M
HeadNeckN_FFPE_L03_RNA_01_B23LG7FLT4_1	162.1M	0.0M	0.0M	26.0M	1.8M	126.3M	63.2M	63.1M	63.2M	63.1M	91.5M	34.8M	125.7M	0.0M
HeadNeckN_FFPE_L04_RNA_01_B23LG7FLT4_1	138.2M	0.0M	0.0M	33.5M	1.4M	94.5M	47.3M	47.2M	47.3M	47.2M	69.3M	25.3M	94.1M	0.0M
HeadNeckN_FFPE_L05_RNA_01_B23LG7FLT4_1	48.8M	0.0M	0.0M	15.7M	0.8M	28.5M	14.3M	14.2M	14.2M	14.2M	22.6M	5.9M	28.3M	0.0M
HeadNeckN_FFPE_L06_RNA_01_B23LG7FLT4_1	167.1M	0.0M	0.0M	29.5M	2.3M	125.8M	63.0M	62.8M	62.9M	62.9M	92.2M	33.6M	125.3M	0.0M
HeadNeckN_FFPE_L08_RNA_01_B23LG7FLT4_1	679.9M	0.0M	0.0M	90.9M	6.7M	554.2M	277.4M	276.8M	277.1M	277.1M	384.1M	170.1M	552.1M	0.0M
HeadNeckN_FFPE_L09_RNA_01_B23LG7FLT4_1	346.3M	0.0M	0.0M	68.2M	3.5M	253.6M	127.0M	126.6M	126.8M	126.8M	182.0M	71.6M	252.6M	0.0M
Hs746T_FFPE_RNA_0001_23LG7FLT4_1	635.7M	0.0M	0.0M	44.2M	7.4M	567.2M	283.7M	283.4M	283.6M	283.5M	300.1M	267.1M	565.2M	0.0M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_1	632.3M	0.0M	0.0M	40.4M	7.5M	568.2M	284.3M	284.0M	284.2M	284.1M	300.1M	268.1M	566.3M	0.0M
Hs746T_FFPE_RNA_0001_B23LG7FLT4_2	634.6M	0.0M	0.0M	42.6M	7.3M	568.1M	284.2M	283.9M	284.1M	284.0M	303.0M	265.2M	566.3M	0.0M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_1	644.7M	0.0M	0.0M	51.9M	3.8M	569.5M	284.9M	284.6M	284.8M	284.7M	302.0M	267.6M	567.6M	0.0M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_2	643.7M	0.0M	0.0M	51.2M	3.7M	569.5M	284.9M	284.6M	284.8M	284.7M	302.7M	266.8M	567.6M	0.0M
KG1_FFPE_01_RNA_0003_B23LG7FLT4_3	642.4M	0.0M	0.0M	49.9M	3.8M	569.3M	284.8M	284.5M	284.7M	284.6M	308.9M	260.5M	567.6M	0.0M
LungN_FFPE_L01_RNA_01_B23LG7FLT4_1	657.1M	0.0M	0.0M	64.9M	5.5M	562.3M	281.3M	280.9M	281.2M	281.1M	370.9M	191.3M	560.3M	0.0M
LungN_FFPE_L02_RNA_01_B23LG7FLT4_1	417.9M	0.0M	0.0M	74.0M	5.0M	315.7M	158.0M	157.7M	157.9M	157.8M	235.3M	80.5M	314.4M	0.0M
LungN_FFPE_L03_RNA_01_B23LG7FLT4_1	672.6M	0.0M	0.0M	85.0M	6.6M	552.2M	276.3M	275.9M	276.2M	276.1M	381.0M	171.2M	550.5M	0.0M
MCF7_FFPE_RNA_0001_B23LG7FLT4_1	650.8M	0.0M	0.0M	58.9M	3.7M	565.8M	283.0M	282.8M	282.9M	282.9M	308.6M	257.2M	563.8M	0.0M
MCF7_FFPE_RNA_0001_B23LG7FLT4_2	652.8M	0.0M	0.0M	60.5M	3.8M	565.8M	283.0M	282.8M	282.9M	282.9M	311.7M	254.1M	563.8M	0.0M
MCF7_FFPE_RNA_0001_B23LG7FLT4_3	653.3M	0.0M	0.0M	61.0M	3.8M	565.4M	282.8M	282.6M	282.7M	282.7M	312.5M	252.9M	563.4M	0.0M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_1	639.0M	0.0M	0.0M	46.5M	3.5M	568.9M	284.6M	284.3M	284.5M	284.4M	290.6M	278.3M	567.1M	0.0M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_2	639.2M	0.0M	0.0M	46.8M	3.5M	568.6M	284.4M	284.2M	284.3M	284.3M	294.4M	274.2M	566.9M	0.0M
NCI-H2228_FFPE_RNA_0001_B23LG7FLT4_3	638.1M	0.0M	0.0M	46.5M	3.4M	567.5M	283.9M	283.6M	283.8M	283.7M	300.9M	266.6M	566.1M	0.0M
NTC_0001_0001_B23LG7FLT4_1	0.5M	0.0M	0.0M	0.4M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
NTC_0001_0001_B23LG7FLT4_2	2.6M	0.0M	0.0M	0.3M	2.3M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
OvarianND_FFPE_L01_RNA_01_B23LG7FLT4_1	648.7M	0.0M	0.0M	54.4M	3.5M	566.6M	283.4M	283.2M	283.3M	283.3M	334.6M	232.0M	564.9M	0.0M
OvarianND_FFPE_L02_RNA_01_B23LG7FLT4_1	642.5M	0.0M	0.0M	48.2M	3.5M	570.0M	285.1M	284.9M	285.0M	285.0M	343.2M	226.8M	568.3M	0.0M
OvarianND_FFPE_L03_RNA_01_B23LG7FLT4_1	646.6M	0.0M	0.0M	53.2M	3.4M	565.9M	283.1M	282.8M	283.0M	282.9M	332.6M	233.4M	564.3M	0.0M
OvarianNP_FFPE_L01_RNA_01_B23LG7FLT4_1	30.6M	0.0M	0.0M	8.6M	0.6M	19.4M	9.7M	9.7M	9.7M	9.7M	15.5M	3.9M	19.3M	0.0M
OvarianNP_FFPE_L02_RNA_01_B23LG7FLT4_1	34.5M	0.0M	0.0M	9.9M	0.6M	21.8M	10.9M	10.9M	10.9M	10.9M	17.5M	4.3M	21.7M	0.0M
OvarianNP_FFPE_L05_RNA_01_B23LG7FLT4_1	103.1M	0.0M	0.0M	22.2M	1.4M	73.6M	36.9M	36.8M	36.8M	36.8M	59.5M	14.1M	73.3M	0.0M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_1	7.1M	0.0M	0.0M	4.2M	0.2M	2.0M	1.0M	1.0M	1.0M	1.0M	1.8M	0.3M	2.0M	0.0M
OvarianN_FFPE_L03_RNA_01_B23LG7FLT4_2	1082.5M	0.0M	0.0M	709.7M	9.3M	244.3M	122.4M	121.9M	122.1M	122.1M	184.4M	59.8M	242.8M	0.0M
OvarianN_FFPE_L04_RNA_01_B23LG7FLT4_1	762.6M	0.0M	0.0M	174.0M	8.0M	534.2M	267.4M	266.8M	267.2M	267.0M	368.9M	165.3M	531.9M	0.0M
RT4_FFPE_RNA_0001_B23LG7FLT4_1	647.3M	0.0M	0.0M	55.7M	3.6M	566.9M	283.6M	283.3M	283.5M	283.4M	313.7M	253.2M	565.0M	0.0M
RT4_FFPE_RNA_0001_B23LG7FLT4_2	644.8M	0.0M	0.0M	53.2M	3.5M	567.5M	283.9M	283.6M	283.8M	283.7M	312.6M	254.9M	565.7M	0.0M
RT4_FFPE_RNA_0001_B23LG7FLT4_3	648.9M	0.0M	0.0M	57.6M	3.6M	566.2M	283.3M	282.9M	283.1M	283.1M	316.9M	249.3M	564.4M	0.0M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_1	652.8M	0.0M	0.0M	60.0M	3.4M	568.3M	284.3M	284.0M	284.2M	284.1M	293.5M	274.8M	566.2M	0.0M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_2	647.8M	0.0M	0.0M	55.4M	3.5M	568.9M	284.6M	284.4M	284.5M	284.4M	289.6M	279.3M	567.0M	0.0M
SK-BR-3_FFPE_01_RNA_0001_B23LG7FLT4_3	645.6M	0.0M	0.0M	52.9M	3.4M	569.9M	285.1M	284.8M	285.0M	284.9M	286.8M	283.2M	568.0M	0.0M
SW780_FFPE_RNA_0001_B23LG7FLT4_1	644.4M	0.0M	0.0M	52.9M	3.7M	567.2M	283.7M	283.4M	283.6M	283.6M	314.6M	252.6M	565.4M	0.0M
SW780_FFPE_RNA_0001_B23LG7FLT4_2	643.5M	0.0M	0.0M	51.4M	3.8M	567.9M	284.1M	283.8M	284.0M	283.9M	313.6M	254.2M	566.1M	0.0M
SW780_FFPE_RNA_0001_B23LG7FLT4_3	642.9M	0.0M	0.0M	50.9M	3.7M	567.6M	284.0M	283.7M	283.8M	283.8M	322.0M	245.7M	566.2M	0.0M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_1	23.3M	0.0M	0.0M	9.4M	0.4M	11.4M	5.7M	5.7M	5.7M	5.7M	8.9M	2.5M	11.4M	0.0M
SkinN_FFPE_L01_RNA_01_B23LG7FLT4_2	288.4M	0.0M	0.0M	73.4M	3.2M	186.5M	93.4M	93.1M	93.3M	93.2M	138.4M	48.1M	185.7M	0.0M
SkinN_FFPE_L02_RNA_01_B23LG7FLT4_1	196.1M	0.0M	0.0M	47.8M	2.7M	127.6M	63.9M	63.7M	63.8M	63.8M	98.2M	29.4M	127.0M	0.0M
SkinN_FFPE_L04_RNA_01_B23LG7FLT4_1	709.5M	0.0M	0.0M	121.8M	6.8M	546.5M	273.5M	273.0M	273.3M	273.2M	356.7M	189.8M	544.4M	0.0M
SkinN_FFPE_L07_RNA_01_B23LG7FLT4_1	540.5M	0.0M	0.0M	113.6M	5.4M	374.5M	187.5M	187.0M	187.3M	187.2M	267.8M	106.7M	373.2M	0.0M
SkinN_FFPE_L08_RNA_01_B23LG7FLT4_1	185.5M	0.0M	0.0M	49.3M	2.2M	122.0M	61.1M	60.9M	61.0M	61.0M	93.8M	28.2M	121.4M	0.0M
SkinN_FFPE_L09_RNA_01_B23LG7FLT4_1	1049.9M	0.0M	0.0M	457.9M	9.3M	492.7M	246.7M	246.1M	246.4M	246.4M	348.9M	143.8M	490.9M	0.0M
U118MG_FFPE_RNA_0001_B23LG7FLT4_1	637.6M	0.0M	0.0M	45.6M	3.6M	571.8M	286.0M	285.8M	286.0M	285.9M	289.7M	282.1M	569.7M	0.0M
U118MG_FFPE_RNA_0001_B23LG7FLT4_2	638.3M	0.0M	0.0M	46.1M	3.6M	572.0M	286.1M	285.9M	286.0M	285.9M	290.7M	281.2M	569.9M	0.0M
U118MG_FFPE_RNA_0001_B23LG7FLT4_3	637.2M	0.0M	0.0M	45.2M	3.4M	572.2M	286.2M	286.0M	286.2M	286.0M	291.0M	281.2M	570.2M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	607245118	0.6431%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	22	94951	0.0001%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	22	113280	0.0001%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	11	13002	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	8	4776	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	8	3687	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	8	3737	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	8	4702	0.0000%
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGG	5	620649	0.0007%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	5	9780	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	5	7479	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	5	5949	0.0000%
GGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	5	63004	0.0001%
GGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	5	58720	0.0001%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	5	7468	0.0000%
GGGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	5	5813	0.0000%
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGGG	5	568259	0.0006%
GGGGGAGAGAGAGAGAGAGAGGGCGCGAAGA	4	7109	0.0000%
GCCCCGGGGGCGGACCCGAAAGATGGA	4	4242	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	4	3508	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	84734780	0.2553%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	16	73241	0.0002%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	16	91444	0.0003%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	10	11640	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	8	4776	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	8	3687	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	8	3737	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	8	4702	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	5	9780	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	5	7479	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCCC	5	5949	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	5	7468	0.0000%
GGGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	5	5813	0.0000%
GGGGGAGAGAGAGAGAGAGAGGGCGCGAAGA	4	7109	0.0000%
GCCCCGGGGGCGGACCCGAAAGATGGA	4	4242	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	4	3508	0.0000%
ACGGGAAGGCCCGGTGGGGAAA	4	2455	0.0000%
GCCCCCCCGGCAGCAGCACA	4	2309	0.0000%
GGGGAGAGAGAGAGAGAGAGGGCGCGAAGA	4	2428	0.0000%
GGGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGCAC	4	1840	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
RSEQC_TO_MULTIQC	python	`3.11.14`
	rseqc_to_multiqc	`1.0.0`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.14`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__73d51683--20260607-225254' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0008_exp0011_73d51683 --rundir 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260204_LH00166_0238_B23LG7FLT4/' --bclconvert_samplesheet 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260204_LH00166_0238_B23LG7FLT4/bclconvert_samplesheet.csv' --flowcell_id 20260204_LH00166_0238_B23LG7FLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__73d51683--20260607-225254'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0008_exp0011_73d51683
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Skip steps

skip_picard_qc: true

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0008_exp0011/B23LG7FLT4/nfcore_rnafusion__73d51683--20260607-225254
rundir: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260204_LH00166_0238_B23LG7FLT4/
flowcell_id: 20260204_LH00166_0238_B23LG7FLT4
strand: reverse
bclconvert_samplesheet: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260204_LH00166_0238_B23LG7FLT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Mark Duplicates Help

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks