Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44528466046(98.2968%)
Q30 bases: 43075289493(95.0889%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44369952015(97.9469%)
Q30 bases: 42450418767(93.7095%)

Read1 after filtering:
total reads: 294691911
total bases: 38744569674
Q20 bases: 38548726690(99.4945%)
Q30 bases: 37705491765(97.3181%)

Read2 after filtering:
total reads: 294691911
total bases: 38782800591
Q20 bases: 38457338619(99.1608%)
Q30 bases: 37348819745(96.3025%)

Filtering result:
reads passed filter: 589383822
reads failed due to low quality: 8841828
reads failed due to too many N: 200604
reads failed due to too short: 1573746
reads with adapter trimmed: 305155045
bases trimmed due to adapters: 11608597472

Duplication rate: 29.5284%

Insert size peak (evaluated by paired-end reads): 119

JSON report: FFPE_HD789_01_RNA_0002_B23LG7FLT4_1.fastp.json
HTML report: FFPE_HD789_01_RNA_0002_B23LG7FLT4_1.fastp.html

fastp --in1 FFPE_HD789_01_RNA_0002_B23LG7FLT4_1_1.fastq.gz --in2 FFPE_HD789_01_RNA_0002_B23LG7FLT4_1_2.fastq.gz --out1 FFPE_HD789_01_RNA_0002_B23LG7FLT4_1_1.fastp.fastq.gz --out2 FFPE_HD789_01_RNA_0002_B23LG7FLT4_1_2.fastp.fastq.gz --json FFPE_HD789_01_RNA_0002_B23LG7FLT4_1.fastp.json --html FFPE_HD789_01_RNA_0002_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 727 seconds