Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44611825454(98.4809%)
Q30 bases: 43060275840(95.0558%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44390484215(97.9922%)
Q30 bases: 42511552498(93.8445%)

Read1 after filtering:
total reads: 295430973
total bases: 37961658222
Q20 bases: 37762768776(99.4761%)
Q30 bases: 36921332009(97.2595%)

Read2 after filtering:
total reads: 295430973
total bases: 38006126384
Q20 bases: 37701802909(99.1993%)
Q30 bases: 36671024017(96.4871%)

Filtering result:
reads passed filter: 590861946
reads failed due to low quality: 7841298
reads failed due to too many N: 194216
reads failed due to too short: 1102540
reads with adapter trimmed: 342592411
bases trimmed due to adapters: 13388669662

Duplication rate: 25.7084%

Insert size peak (evaluated by paired-end reads): 118

JSON report: KG1_FFPE_01_RNA_0003_B23LG7FLT4_1.fastp.json
HTML report: KG1_FFPE_01_RNA_0003_B23LG7FLT4_1.fastp.html

fastp --in1 KG1_FFPE_01_RNA_0003_B23LG7FLT4_1_1.fastq.gz --in2 KG1_FFPE_01_RNA_0003_B23LG7FLT4_1_2.fastq.gz --out1 KG1_FFPE_01_RNA_0003_B23LG7FLT4_1_1.fastp.fastq.gz --out2 KG1_FFPE_01_RNA_0003_B23LG7FLT4_1_2.fastp.fastq.gz --json KG1_FFPE_01_RNA_0003_B23LG7FLT4_1.fastp.json --html KG1_FFPE_01_RNA_0003_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 718 seconds