Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44350923576(97.9049%)
Q30 bases: 42711641721(94.2862%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44319945683(97.8365%)
Q30 bases: 42327826858(93.4389%)

Read1 after filtering:
total reads: 295209379
total bases: 37554177193
Q20 bases: 37358906506(99.48%)
Q30 bases: 36513671258(97.2293%)

Read2 after filtering:
total reads: 295209379
total bases: 37598548782
Q20 bases: 37283405204(99.1618%)
Q30 bases: 36218483800(96.3295%)

Filtering result:
reads passed filter: 590418758
reads failed due to low quality: 7960902
reads failed due to too many N: 188760
reads failed due to too short: 1431580
reads with adapter trimmed: 352425386
bases trimmed due to adapters: 14150840139

Duplication rate: 24.4902%

Insert size peak (evaluated by paired-end reads): 118

JSON report: MCF7_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json
HTML report: MCF7_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html

fastp --in1 MCF7_FFPE_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 MCF7_FFPE_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 MCF7_FFPE_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 MCF7_FFPE_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json MCF7_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json --html MCF7_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 751 seconds