Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44319711981(97.836%)
Q30 bases: 42619471199(94.0827%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44277614812(97.7431%)
Q30 bases: 42260162630(93.2895%)

Read1 after filtering:
total reads: 294893040
total bases: 37425087669
Q20 bases: 37207663328(99.419%)
Q30 bases: 36318576392(97.0434%)

Read2 after filtering:
total reads: 294893040
total bases: 37469142096
Q20 bases: 37157029825(99.167%)
Q30 bases: 36113551692(96.3821%)

Filtering result:
reads passed filter: 589786080
reads failed due to low quality: 8404944
reads failed due to too many N: 201184
reads failed due to too short: 1607792
reads with adapter trimmed: 357781866
bases trimmed due to adapters: 14325019652

Duplication rate: 24.3127%

Insert size peak (evaluated by paired-end reads): 119

JSON report: 786-O_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json
HTML report: 786-O_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html

fastp --in1 786-O_FFPE_RNA_0001_B23LG7FLT4_3_1.fastq.gz --in2 786-O_FFPE_RNA_0001_B23LG7FLT4_3_2.fastq.gz --out1 786-O_FFPE_RNA_0001_B23LG7FLT4_3_1.fastp.fastq.gz --out2 786-O_FFPE_RNA_0001_B23LG7FLT4_3_2.fastp.fastq.gz --json 786-O_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json --html 786-O_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 773 seconds