Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44362226040(97.9299%)
Q30 bases: 42761422163(94.3961%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44363270235(97.9322%)
Q30 bases: 42409980513(93.6203%)

Read1 after filtering:
total reads: 295260444
total bases: 37480695317
Q20 bases: 37284567701(99.4767%)
Q30 bases: 36460987872(97.2794%)

Read2 after filtering:
total reads: 295260444
total bases: 37523067776
Q20 bases: 37225243302(99.2063%)
Q30 bases: 36215482973(96.5153%)

Filtering result:
reads passed filter: 590520888
reads failed due to low quality: 7856880
reads failed due to too many N: 202266
reads failed due to too short: 1419966
reads with adapter trimmed: 357898898
bases trimmed due to adapters: 14313428567

Duplication rate: 24.9729%

Insert size peak (evaluated by paired-end reads): 118

JSON report: A673_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json
HTML report: A673_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html

fastp --in1 A673_FFPE_RNA_0001_B23LG7FLT4_1_1.fastq.gz --in2 A673_FFPE_RNA_0001_B23LG7FLT4_1_2.fastq.gz --out1 A673_FFPE_RNA_0001_B23LG7FLT4_1_1.fastp.fastq.gz --out2 A673_FFPE_RNA_0001_B23LG7FLT4_1_2.fastp.fastq.gz --json A673_FFPE_RNA_0001_B23LG7FLT4_1.fastp.json --html A673_FFPE_RNA_0001_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 762 seconds