Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44557731106(98.3614%)
Q30 bases: 42938095518(94.7861%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44332718238(97.8647%)
Q30 bases: 42350577653(93.4891%)

Read1 after filtering:
total reads: 295085579
total bases: 37352538726
Q20 bases: 37155681219(99.473%)
Q30 bases: 36317787741(97.2298%)

Read2 after filtering:
total reads: 295085579
total bases: 37395042657
Q20 bases: 37099313811(99.2092%)
Q30 bases: 36096049145(96.5263%)

Filtering result:
reads passed filter: 590171158
reads failed due to low quality: 8106402
reads failed due to too many N: 202038
reads failed due to too short: 1520402
reads with adapter trimmed: 357375835
bases trimmed due to adapters: 14521954449

Duplication rate: 25.1689%

Insert size peak (evaluated by paired-end reads): 119

JSON report: Hs746T_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json
HTML report: Hs746T_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html

fastp --in1 Hs746T_FFPE_RNA_0001_B23LG7FLT4_2_1.fastq.gz --in2 Hs746T_FFPE_RNA_0001_B23LG7FLT4_2_2.fastq.gz --out1 Hs746T_FFPE_RNA_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 Hs746T_FFPE_RNA_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json Hs746T_FFPE_RNA_0001_B23LG7FLT4_2.fastp.json --html Hs746T_FFPE_RNA_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 760 seconds