Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 300000000 total bases: 45300000000 Q20 bases: 44319917632(97.8365%) Q30 bases: 42646534606(94.1425%) Read2 before filtering: total reads: 300000000 total bases: 45300000000 Q20 bases: 44345960994(97.894%) Q30 bases: 42364714153(93.5203%) Read1 after filtering: total reads: 295213067 total bases: 37451384231 Q20 bases: 37253605578(99.4719%) Q30 bases: 36403759101(97.2027%) Read2 after filtering: total reads: 295213067 total bases: 37496310514 Q20 bases: 37183896985(99.1668%) Q30 bases: 36119498550(96.3281%) Filtering result: reads passed filter: 590426134 reads failed due to low quality: 8070230 reads failed due to too many N: 193376 reads failed due to too short: 1310260 reads with adapter trimmed: 354357829 bases trimmed due to adapters: 14359501173 Duplication rate: 24.5444% Insert size peak (evaluated by paired-end reads): 119 JSON report: MCF7_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json HTML report: MCF7_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html fastp --in1 MCF7_FFPE_RNA_0001_B23LG7FLT4_3_1.fastq.gz --in2 MCF7_FFPE_RNA_0001_B23LG7FLT4_3_2.fastq.gz --out1 MCF7_FFPE_RNA_0001_B23LG7FLT4_3_1.fastp.fastq.gz --out2 MCF7_FFPE_RNA_0001_B23LG7FLT4_3_2.fastp.fastq.gz --json MCF7_FFPE_RNA_0001_B23LG7FLT4_3.fastp.json --html MCF7_FFPE_RNA_0001_B23LG7FLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 fastp v0.23.4, time used: 764 seconds