Detecting adapter sequence for read1... No adapter detected for read1 Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 1173175 total bases: 177149425 Q20 bases: 156688852(88.4501%) Q30 bases: 122129419(68.9415%) Read2 before filtering: total reads: 1173175 total bases: 177149425 Q20 bases: 173127543(97.7297%) Q30 bases: 150178104(84.7748%) Read1 after filtering: total reads: 1147200 total bases: 171561462 Q20 bases: 152970556(89.1637%) Q30 bases: 120230391(70.0801%) Read2 after filtering: total reads: 1147200 total bases: 170211313 Q20 bases: 167552817(98.4381%) Q30 bases: 146073328(85.8188%) Filtering result: reads passed filter: 2294400 reads failed due to low quality: 49254 reads failed due to too many N: 824 reads failed due to too short: 1872 reads with adapter trimmed: 52874 bases trimmed due to adapters: 4865046 Duplication rate: 78.2173% Insert size peak (evaluated by paired-end reads): 32 JSON report: NTC_0001_0001_B23LG7FLT4_2.fastp.json HTML report: NTC_0001_0001_B23LG7FLT4_2.fastp.html fastp --in1 NTC_0001_0001_B23LG7FLT4_2_1.fastq.gz --in2 NTC_0001_0001_B23LG7FLT4_2_2.fastq.gz --out1 NTC_0001_0001_B23LG7FLT4_2_1.fastp.fastq.gz --out2 NTC_0001_0001_B23LG7FLT4_2_2.fastp.fastq.gz --json NTC_0001_0001_B23LG7FLT4_2.fastp.json --html NTC_0001_0001_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe fastp v0.23.4, time used: 15 seconds