File Info

Filename
BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0011/B23LG7FLT4/nfcore_rnafusion_100M__5f1fa793--20260303-130000/fastp/BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.log
Size
1.6 KB
Published
Mar 03, 2026 2:07 PM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 16590658
total bases: 2505189358
Q20 bases: 2368617584(94.5484%)
Q30 bases: 2123666478(84.7707%)

Read2 before filtering:
total reads: 16590658
total bases: 2505189358
Q20 bases: 2438235458(97.3274%)
Q30 bases: 2222052199(88.698%)

Read1 after filtering:
total reads: 9022667
total bases: 784604946
Q20 bases: 780488138(99.4753%)
Q30 bases: 763522355(97.313%)

Read2 after filtering:
total reads: 9022667
total bases: 788408681
Q20 bases: 782884461(99.2993%)
Q30 bases: 764160062(96.9244%)

Filtering result:
reads passed filter: 18045334
reads failed due to low quality: 363346
reads failed due to too many N: 3898
reads failed due to too short: 14768738
reads with adapter trimmed: 24927132
bases trimmed due to adapters: 1400828432

Duplication rate: 61.4366%

Insert size peak (evaluated by paired-end reads): 83

JSON report: BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.json
HTML report: BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.html

fastp --in1 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_1.fastq.gz --in2 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_2.fastq.gz --out1 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_1.fastp.fastq.gz --out2 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_2.fastp.fastq.gz --json BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.json --html BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 22 seconds