Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 16590658
total bases: 2505189358
Q20 bases: 2368617584(94.5484%)
Q30 bases: 2123666478(84.7707%)
Read2 before filtering:
total reads: 16590658
total bases: 2505189358
Q20 bases: 2438235458(97.3274%)
Q30 bases: 2222052199(88.698%)
Read1 after filtering:
total reads: 9022667
total bases: 784604946
Q20 bases: 780488138(99.4753%)
Q30 bases: 763522355(97.313%)
Read2 after filtering:
total reads: 9022667
total bases: 788408681
Q20 bases: 782884461(99.2993%)
Q30 bases: 764160062(96.9244%)
Filtering result:
reads passed filter: 18045334
reads failed due to low quality: 363346
reads failed due to too many N: 3898
reads failed due to too short: 14768738
reads with adapter trimmed: 24927132
bases trimmed due to adapters: 1400828432
Duplication rate: 61.4366%
Insert size peak (evaluated by paired-end reads): 83
JSON report: BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.json
HTML report: BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.html
fastp --in1 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_1.fastq.gz --in2 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_2.fastq.gz --out1 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_1.fastp.fastq.gz --out2 BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2_2.fastp.fastq.gz --json BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.json --html BreastNP_FFPE_L02_RNA_01_B23LG7FLT4_2.fastp.html --thread 12 --detect_adapter_for_pe
fastp v0.23.4, time used: 22 seconds