Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 19058536
total bases: 2877838936
Q20 bases: 2586315856(89.8701%)
Q30 bases: 2139978171(74.3606%)

Read2 before filtering:
total reads: 19058536
total bases: 2877838936
Q20 bases: 2781310076(96.6458%)
Q30 bases: 2459689087(85.47%)

Read1 after filtering:
total reads: 9095254
total bases: 746291045
Q20 bases: 741499546(99.358%)
Q30 bases: 723949517(97.0063%)

Read2 after filtering:
total reads: 9095254
total bases: 751275839
Q20 bases: 745420176(99.2206%)
Q30 bases: 726670149(96.7248%)

Filtering result:
reads passed filter: 18190508
reads failed due to low quality: 530148
reads failed due to too many N: 3820
reads failed due to too short: 19392596
reads with adapter trimmed: 27639661
bases trimmed due to adapters: 1576965694

Duplication rate: 52.908%

Insert size peak (evaluated by paired-end reads): 79

JSON report: ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.json
HTML report: ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.html

fastp --in1 ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_1.fastq.gz --in2 ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_2.fastq.gz --out1 ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_1.fastp.fastq.gz --out2 ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1_2.fastp.fastq.gz --json ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.json --html ColoN_FFPE_L03_RNA_01_B23LG7FLT4_1.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 22 seconds