MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-16, 16:04 UTC based on data in: /tmp/nxf.B7wtXDS4GH

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	Total Reads	Expected Distinct	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	RNA contaminated	RNA contamination %	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1	9999000000	50089719	116.8bp	112.0bp	0.04%	1.23%	0.49%	0.00%	0.08%	3.37%	0.69%	0.00%	318244238	0.01%	0.83%	53577480	0.85%	0.91%	0.10%	0.09%	45625020	22830837	5431385	2364115	63.42	22.00	0.44%	0.17%	0.98	0.000	No	0.00%				117bp	161bp	83.8%	0.0%	96.6%	85.2%	94.3%	150.0M	52.9%	97.7%	35676.2Mb	318.2M	57.9%	98.0%	80.8%
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1_1																																	116.8bp	97.6%	155.2M																87.6%	55%	151bp	151bp	18%	162.4M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1_2																																																			85.9%	56%	151bp	151bp	18%	162.4M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1_trimmed_1																																																			87.7%	57%	115bp	117bp	9%	159.1M	87.7%	57%	115bp	117bp	9%	159.1M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1_trimmed_2																																																			87.3%	58%	115bp	117bp	9%	159.1M	87.3%	58%	115bp	117bp	9%	159.1M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2	9999000000	26354030	117.8bp	113.0bp	0.04%	1.17%	0.48%	0.00%	0.07%	3.23%	0.69%	0.00%	166770518	0.01%	0.84%	27393534	0.84%	0.90%	0.11%	0.10%	22937277	11468224	2995342	1298063	32.42	11.00	0.28%	0.07%	0.98	0.000	No	0.00%				119bp	164bp	84.3%	0.0%	96.3%	84.8%	94.1%	78.5M	57.2%	97.6%	18781.5Mb	166.8M	58.4%	96.9%	79.0%
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2_1																																	117.8bp	97.3%	81.2M																86.7%	56%	151bp	151bp	18%	86.0M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2_2																																																			84.4%	57%	151bp	151bp	36%	86.0M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2_trimmed_1																																																			86.6%	58%	115bp	117bp	9%	83.4M	86.6%	58%	115bp	117bp	9%	83.4M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2_trimmed_2																																																			86.2%	58%	116bp	117bp	9%	83.4M	86.2%	58%	116bp	117bp	9%	83.4M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3	9999000000	24665572	117.9bp	112.0bp	0.02%	1.21%	0.55%	0.00%	0.04%	3.37%	0.78%	0.00%	75765666	0.01%	0.80%	15439260	0.88%	0.93%	0.08%	0.07%	13568684	6802526	1248426	521540	21.26	7.00	0.19%	0.03%	0.98	0.000	Yes	1.91%				119bp	169bp	80.3%	0.0%	96.7%	85.0%	94.2%	35.7M	49.6%	97.6%	8551.7Mb	75.8M	58.4%	97.9%	79.0%
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_1																																	117.9bp	97.7%	37.0M																83.5%	56%	151bp	151bp	18%	38.7M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_2																																																			81.7%	57%	151bp	151bp	18%	38.7M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_trimmed_1																																																			83.4%	58%	115bp	117bp	9%	37.9M	83.4%	58%	115bp	117bp	9%	37.9M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_trimmed_2																																																			83.1%	58%	116bp	117bp	9%	37.9M	83.1%	58%	116bp	117bp	9%	37.9M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1	9999000000	196375350	121.7bp	114.0bp	0.01%	1.97%	0.62%	0.00%	0.03%	5.14%	0.86%	0.00%	591215380	0.01%	0.62%	224453032	0.93%	0.95%	0.06%	0.05%	208094815	104659559	13049303	5073517	334.02	132.00	0.66%	0.54%	0.98	0.000	No	0.00%				123bp	205bp	62.4%	0.0%	97.2%	88.0%	95.3%	281.8M	37.3%	97.8%	67850.5Mb	591.2M	54.1%	98.5%	75.1%
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1_1																																	121.7bp	98.1%	289.9M																84.7%	52%	151bp	151bp	18%	329.9M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1_2																																																			83.1%	53%	151bp	151bp	18%	329.9M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1_trimmed_1																																																			83.9%	53%	117bp	117bp	9%	295.6M	83.9%	53%	117bp	117bp	9%	295.6M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1_trimmed_2																																																			83.6%	54%	117bp	117bp	9%	295.6M	83.6%	54%	117bp	117bp	9%	295.6M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2	9999000000	163403224	129.2bp	121.0bp	0.01%	1.89%	0.62%	0.00%	0.02%	4.98%	0.87%	0.00%	582065066	0.01%	0.66%	198791869	0.92%	0.95%	0.06%	0.05%	183386277	92276884	12190094	4689548	303.40	119.00	0.65%	0.53%	0.98	0.000	No	0.00%				134bp	245bp	66.2%	0.0%	97.0%	88.4%	95.4%	277.6M	44.0%	97.8%	69445.0Mb	582.1M	53.6%	98.5%	70.3%
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2_1																																	129.2bp	98.0%	285.3M																84.7%	52%	151bp	151bp	18%	295.6M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2_2																																																			83.5%	53%	151bp	151bp	18%	295.6M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2_trimmed_1																																																			84.7%	53%	122bp	127bp	9%	291.0M	84.7%	53%	122bp	127bp	9%	291.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2_trimmed_2																																																			84.7%	53%	122bp	127bp	9%	291.0M	84.7%	53%	122bp	127bp	9%	291.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3	9999000000	101040571	128.1bp	120.0bp	0.01%	1.97%	0.68%	0.00%	0.01%	5.16%	0.95%	0.00%	517037680	0.01%	0.75%	131172417	0.91%	0.95%	0.07%	0.05%	119837393	60249590	8532687	3305079	191.49	71.00	0.61%	0.44%	0.98	0.000	No	0.00%				132bp	236bp	75.0%	0.0%	97.2%	88.3%	95.4%	246.6M	50.7%	97.9%	61202.0Mb	517.0M	54.2%	98.5%	71.4%
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3_1																																	128.1bp	98.2%	253.8M																87.1%	53%	151bp	151bp	18%	262.5M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3_2																																																			85.9%	54%	151bp	151bp	18%	262.5M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3_trimmed_1																																																			87.1%	53%	121bp	122bp	9%	258.5M	87.1%	53%	121bp	122bp	9%	258.5M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3_trimmed_2																																																			87.2%	54%	121bp	122bp	9%	258.5M	87.2%	54%	121bp	122bp	9%	258.5M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1	9999000000	116868432	121.8bp	116.0bp	0.00%	0.70%	0.40%	0.00%	0.01%	2.26%	0.63%	0.00%	577783726	0.01%	0.76%	138015166	0.89%	0.93%	0.08%	0.07%	123287855	61786010	10799242	4563821	190.47	79.00	0.65%	0.45%	0.98	0.000	No	0.00%				121bp	169bp	76.6%	0.0%	97.0%	87.5%	95.1%	274.8M	52.3%	97.7%	66805.3Mb	577.8M	57.2%	98.2%	75.7%
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1_1																																	121.8bp	98.0%	283.0M																87.1%	55%	151bp	151bp	18%	294.1M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1_2																																																			85.7%	56%	151bp	151bp	18%	294.1M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1_trimmed_1																																																			87.2%	57%	118bp	122bp	9%	288.9M	87.2%	57%	118bp	122bp	9%	288.9M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1_trimmed_2																																																			87.2%	57%	118bp	122bp	9%	288.9M	87.2%	57%	118bp	122bp	9%	288.9M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2	9999000000	64263826	122.5bp	115.0bp	0.00%	0.74%	0.42%	0.00%	0.00%	2.41%	0.68%	0.00%	448881600	0.01%	0.83%	75417787	0.87%	0.92%	0.09%	0.08%	65500998	32780179	6742906	2849341	99.37	39.00	0.55%	0.28%	0.98	0.000	No	0.00%				122bp	171bp	83.8%	0.0%	97.1%	87.1%	95.0%	213.3M	58.3%	97.7%	51878.1Mb	448.9M	57.6%	98.1%	75.1%
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2_1																																	122.5bp	98.0%	220.0M																89.0%	55%	151bp	151bp	18%	228.8M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2_2																																																			87.4%	56%	151bp	151bp	18%	228.8M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2_trimmed_1																																																			89.1%	57%	118bp	122bp	9%	224.4M	89.1%	57%	118bp	122bp	9%	224.4M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2_trimmed_2																																																			88.9%	57%	118bp	122bp	9%	224.4M	88.9%	57%	118bp	122bp	9%	224.4M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3	9999000000	43988393	131.1bp	125.0bp	0.00%	0.73%	0.41%	0.00%	0.00%	2.41%	0.67%	0.00%	327393420	0.01%	0.86%	44887523	0.84%	0.90%	0.11%	0.10%	37834228	18933686	4740699	2023469	59.24	23.00	0.45%	0.16%	0.98	0.000	No	0.00%				133bp	199bp	86.9%	0.0%	96.9%	87.7%	95.2%	155.8M	61.7%	97.6%	39612.4Mb	327.4M	57.0%	98.1%	68.7%
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3_1																																	131.1bp	97.9%	160.2M																89.8%	55%	151bp	151bp	18%	166.9M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3_2																																																			88.2%	56%	151bp	151bp	18%	166.9M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3_trimmed_1																																																			89.8%	56%	124bp	127bp	9%	163.7M	89.8%	56%	124bp	127bp	9%	163.7M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3_trimmed_2																																																			89.8%	57%	124bp	127bp	9%	163.7M	89.8%	57%	124bp	127bp	9%	163.7M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1	9999000000	143312002	116.6bp	111.0bp	0.01%	0.91%	0.46%	0.00%	0.02%	2.79%	0.70%	0.00%	537605858	0.01%	0.67%	178124434	0.92%	0.95%	0.06%	0.05%	163644220	82085248	10558912	4285612	249.58	113.00	0.67%	0.52%	0.98	0.000	No	0.00%				120bp	193bp	67.4%	0.0%	97.3%	87.1%	94.8%	254.8M	40.9%	97.8%	60342.1Mb	537.6M	53.8%	98.4%	79.3%
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1_1																																	116.6bp	98.2%	263.9M																84.1%	52%	151bp	151bp	18%	273.3M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1_2																																																			82.8%	53%	151bp	151bp	18%	273.3M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1_trimmed_1																																																			84.1%	53%	115bp	117bp	9%	268.8M	84.1%	53%	115bp	117bp	9%	268.8M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1_trimmed_2																																																			84.1%	53%	115bp	117bp	9%	268.8M	84.1%	53%	115bp	117bp	9%	268.8M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2	9999000000	104207433	121.1bp	115.0bp	0.01%	0.86%	0.46%	0.00%	0.02%	2.62%	0.70%	0.00%	405116938	0.01%	0.72%	114430048	0.91%	0.94%	0.07%	0.06%	103901639	52126726	7562857	3110039	159.37	69.00	0.62%	0.43%	0.98	0.000	No	0.00%				127bp	215bp	72.3%	0.0%	97.2%	87.5%	94.9%	192.2M	48.6%	97.8%	46917.1Mb	405.1M	53.9%	98.5%	76.4%
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2_1																																	121.1bp	98.1%	198.8M																84.6%	53%	151bp	151bp	18%	205.7M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2_2																																																			83.4%	54%	151bp	151bp	18%	205.7M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2_trimmed_1																																																			84.6%	53%	118bp	122bp	9%	202.6M	84.6%	53%	118bp	122bp	9%	202.6M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2_trimmed_2																																																			84.6%	54%	119bp	122bp	9%	202.6M	84.6%	54%	119bp	122bp	9%	202.6M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3	9999000000	66693587	118.8bp	113.0bp	0.00%	0.89%	0.50%	0.00%	0.01%	2.75%	0.77%	0.00%	547232326	0.01%	0.85%	79988027	0.87%	0.93%	0.08%	0.07%	69574509	34841301	6464519	2680159	103.78	43.00	0.56%	0.31%	0.98	0.000	No	0.00%				126bp	216bp	86.0%	0.0%	97.3%	87.3%	94.8%	259.5M	57.9%	97.8%	62771.6Mb	547.2M	54.2%	98.4%	76.9%
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3_1																																	118.8bp	98.3%	269.1M																90.1%	53%	151bp	151bp	18%	278.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3_2																																																			88.9%	53%	151bp	151bp	18%	278.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3_trimmed_1																																																			90.2%	53%	117bp	117bp	9%	273.6M	90.2%	53%	117bp	117bp	9%	273.6M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3_trimmed_2																																																			90.2%	54%	117bp	117bp	9%	273.6M	90.2%	54%	117bp	117bp	9%	273.6M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1	9999000000	138111929	115.8bp	110.0bp	0.01%	0.96%	0.44%	0.00%	0.02%	2.93%	0.68%	0.00%	425226198	0.01%	0.65%	149104516	0.92%	0.95%	0.06%	0.05%	137011363	68743778	8979127	3665007	208.06	94.00	0.66%	0.49%	0.98	0.000	Yes	0.00%				119bp	188bp	65.4%	0.0%	97.1%	86.8%	94.7%	201.4M	39.4%	97.8%	47719.8Mb	425.2M	53.9%	98.5%	79.6%
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1_1																																	115.8bp	98.1%	208.6M																82.8%	52%	151bp	151bp	18%	215.8M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1_2																																																			81.6%	54%	151bp	151bp	27%	215.8M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1_trimmed_1																																																			82.8%	53%	115bp	117bp	9%	212.6M	82.8%	53%	115bp	117bp	9%	212.6M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1_trimmed_2																																																			82.7%	54%	115bp	117bp	9%	212.6M	82.7%	54%	115bp	117bp	9%	212.6M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2	9999000000	98195837	115.0bp	109.0bp	0.01%	0.93%	0.45%	0.00%	0.01%	2.84%	0.70%	0.00%	436770622	0.01%	0.74%	113314143	0.90%	0.94%	0.07%	0.06%	102065664	51165862	8128723	3416388	150.37	66.00	0.62%	0.41%	0.98	0.000	No	0.00%				117bp	183bp	74.6%	0.0%	97.1%	86.8%	94.7%	206.9M	45.5%	97.8%	48417.2Mb	436.8M	54.2%	98.4%	80.4%
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2_1																																	115.0bp	98.1%	214.2M																85.4%	52%	151bp	151bp	18%	221.9M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2_2																																																			84.3%	54%	151bp	151bp	27%	221.9M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2_trimmed_1																																																			85.4%	53%	113bp	112bp	9%	218.4M	85.4%	53%	113bp	112bp	9%	218.4M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2_trimmed_2																																																			85.6%	54%	113bp	112bp	9%	218.4M	85.6%	54%	113bp	112bp	9%	218.4M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3	9999000000	52691793	118.5bp	113.0bp	0.00%	0.96%	0.47%	0.00%	0.01%	2.96%	0.74%	0.00%	300233978	0.01%	0.80%	60925119	0.89%	0.94%	0.07%	0.06%	54290370	27177340	4427614	1812294	80.14	33.00	0.52%	0.24%	0.98	0.000	No	0.00%				124bp	207bp	80.3%	0.0%	97.1%	86.9%	94.7%	142.1M	51.5%	97.8%	34302.1Mb	300.2M	53.8%	98.2%	77.5%
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3_1																																	118.5bp	98.3%	147.6M																86.7%	53%	151bp	151bp	18%	152.9M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3_2																																																			85.3%	53%	151bp	151bp	18%	152.9M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3_trimmed_1																																																			86.7%	53%	117bp	117bp	9%	150.1M	86.7%	53%	117bp	117bp	9%	150.1M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3_trimmed_2																																																			86.7%	54%	117bp	117bp	9%	150.1M	86.7%	54%	117bp	117bp	9%	150.1M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1	9999000000	122557228	113.6bp	108.0bp	0.01%	0.99%	0.44%	0.00%	0.02%	3.05%	0.67%	0.00%	532071846	0.01%	0.70%	159536016	0.91%	0.94%	0.07%	0.06%	145109483	72782205	10636663	4447344	215.18	99.00	0.66%	0.50%	0.98	0.000	No	0.00%				116bp	176bp	70.5%	0.0%	97.1%	87.0%	94.8%	252.3M	43.2%	97.8%	58795.8Mb	532.1M	53.4%	98.6%	81.3%
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1_1																																	113.6bp	98.0%	260.8M																85.0%	52%	151bp	151bp	18%	269.9M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1_2																																																			83.9%	53%	151bp	151bp	27%	269.9M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1_trimmed_1																																																			85.0%	53%	113bp	112bp	9%	266.0M	85.0%	53%	113bp	112bp	9%	266.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1_trimmed_2																																																			85.0%	53%	113bp	112bp	9%	266.0M	85.0%	53%	113bp	112bp	9%	266.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2	9999000000	110981851	121.0bp	115.0bp	0.01%	0.94%	0.42%	0.00%	0.02%	2.92%	0.65%	0.00%	513556276	0.01%	0.74%	131300320	0.90%	0.94%	0.07%	0.06%	117975315	59158867	9548437	3991973	178.18	81.00	0.64%	0.46%	0.98	0.000	No	0.00%				125bp	203bp	75.0%	0.0%	96.9%	87.2%	94.8%	243.4M	48.5%	97.7%	59207.9Mb	513.6M	53.2%	98.6%	77.1%
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2_1																																	121.0bp	98.0%	251.7M																85.9%	52%	151bp	151bp	18%	260.5M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2_2																																																			84.8%	53%	151bp	151bp	18%	260.5M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2_trimmed_1																																																			85.9%	52%	118bp	117bp	9%	256.8M	85.9%	52%	118bp	117bp	9%	256.8M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2_trimmed_2																																																			85.9%	53%	118bp	117bp	9%	256.8M	85.9%	53%	118bp	117bp	9%	256.8M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3	9999000000	71489024	116.7bp	110.0bp	0.01%	1.00%	0.47%	0.00%	0.01%	3.08%	0.72%	0.00%	394408598	0.01%	0.80%	79090653	0.89%	0.93%	0.07%	0.07%	70140990	35136486	5919157	2466023	102.50	44.00	0.57%	0.31%	0.98	0.000	No	0.00%				119bp	186bp	80.6%	0.0%	97.1%	86.5%	94.6%	186.5M	49.8%	97.6%	44061.5Mb	394.4M	54.1%	98.4%	79.8%
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3_1																																	116.7bp	98.2%	193.6M																87.4%	53%	151bp	151bp	18%	200.4M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3_2																																																			86.1%	54%	151bp	151bp	18%	200.4M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3_trimmed_1																																																			87.4%	53%	114bp	117bp	9%	197.2M	87.4%	53%	114bp	117bp	9%	197.2M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3_trimmed_2																																																			87.4%	54%	115bp	117bp	9%	197.2M	87.4%	54%	115bp	117bp	9%	197.2M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1	9999000000	302791399	133.8bp	126.0bp	0.01%	0.62%	0.45%	0.00%	0.01%	2.06%	0.72%	0.00%	591619654	0.01%	0.54%	273582727	0.94%	0.97%	0.05%	0.03%	257130589	129375600	12664085	4559480	462.04	212.00	0.73%	0.61%	0.98	0.000	No	0.00%				151bp	306bp	54.1%	0.0%	97.6%	89.6%	95.7%	283.1M	33.5%	97.7%	72405.3Mb	591.6M	54.7%	98.6%	65.4%
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1_1																																	133.8bp	98.3%	290.7M																83.9%	53%	151bp	151bp	18%	390.9M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1_2																																																			83.0%	54%	151bp	151bp	18%	390.9M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1_trimmed_1																																																			81.8%	54%	125bp	132bp	9%	295.8M	81.8%	54%	125bp	132bp	9%	295.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1_trimmed_2																																																			81.9%	54%	125bp	132bp	9%	295.8M	81.9%	54%	125bp	132bp	9%	295.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2	9999000000	170917862	131.9bp	124.0bp	0.00%	0.66%	0.48%	0.00%	0.01%	2.19%	0.79%	0.00%	589529662	0.01%	0.65%	206619644	0.93%	0.96%	0.05%	0.04%	192900065	97008677	9919935	3570841	338.94	151.00	0.70%	0.57%	0.98	0.000	No	0.00%				152bp	313bp	65.4%	0.0%	97.7%	89.7%	95.7%	282.2M	41.6%	97.8%	71956.0Mb	589.5M	55.0%	98.5%	66.0%
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2_1																																	131.9bp	98.4%	290.1M																84.8%	53%	151bp	151bp	18%	299.2M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2_2																																																			83.9%	54%	151bp	151bp	18%	299.2M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2_trimmed_1																																																			84.8%	54%	125bp	132bp	9%	294.8M	84.8%	54%	125bp	132bp	9%	294.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2_trimmed_2																																																			85.0%	55%	125bp	132bp	9%	294.8M	85.0%	55%	125bp	132bp	9%	294.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3	9999000000	133870717	140.4bp	132.0bp	0.00%	0.62%	0.47%	0.00%	0.01%	2.09%	0.77%	0.00%	589302448	0.01%	0.75%	145024416	0.92%	0.96%	0.06%	0.04%	132794715	66751588	8291352	3001807	235.00	100.00	0.66%	0.50%	0.98	0.000	No	0.00%				170bp	371bp	75.9%	0.0%	97.6%	90.0%	95.8%	282.2M	56.3%	97.6%	74086.0Mb	589.3M	55.0%	98.2%	60.7%
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3_1																																	140.4bp	98.4%	289.8M																90.0%	54%	151bp	151bp	18%	419.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3_2																																																			88.4%	54%	151bp	151bp	18%	419.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3_trimmed_1																																																			87.6%	54%	129bp	137bp	9%	294.7M	87.6%	54%	129bp	137bp	9%	294.7M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3_trimmed_2																																																			87.6%	55%	129bp	137bp	9%	294.7M	87.6%	55%	129bp	137bp	9%	294.7M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1	9999000000	138291319	130.0bp	123.0bp	0.01%	0.81%	0.48%	0.00%	0.01%	2.62%	0.74%	0.00%	534568738	0.01%	0.68%	168666560	0.91%	0.95%	0.06%	0.05%	154128940	77446727	10765544	4284569	259.77	120.00	0.70%	0.54%	0.98	0.000	No	0.00%				141bp	255bp	68.9%	0.0%	97.0%	88.6%	95.4%	255.0M	48.5%	97.7%	64762.1Mb	534.6M	54.5%	98.4%	68.3%
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1_1																																	130.0bp	97.9%	261.7M																84.7%	53%	151bp	151bp	18%	271.5M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1_2																																																			83.9%	54%	151bp	151bp	18%	271.5M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1_trimmed_1																																																			84.7%	54%	124bp	127bp	9%	267.3M	84.7%	54%	124bp	127bp	9%	267.3M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1_trimmed_2																																																			85.1%	54%	124bp	127bp	9%	267.3M	85.1%	54%	124bp	127bp	9%	267.3M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2	9999000000	79212668	129.4bp	121.0bp	0.00%	0.87%	0.51%	0.00%	0.01%	2.85%	0.79%	0.00%	533631774	0.01%	0.82%	96528725	0.88%	0.93%	0.08%	0.07%	85077774	42717624	7618196	3094059	139.58	61.00	0.62%	0.39%	0.98	0.000	No	0.00%				140bp	256bp	82.5%	0.0%	97.1%	88.3%	95.4%	254.4M	57.9%	97.8%	64244.0Mb	533.6M	54.6%	98.5%	68.8%
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2_1																																	129.4bp	98.0%	261.6M																89.1%	53%	151bp	151bp	18%	271.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2_2																																																			88.0%	54%	151bp	151bp	18%	271.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2_trimmed_1																																																			89.2%	54%	123bp	127bp	9%	266.8M	89.2%	54%	123bp	127bp	9%	266.8M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2_trimmed_2																																																			89.2%	54%	123bp	127bp	9%	266.8M	89.2%	54%	123bp	127bp	9%	266.8M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3	9999000000	45584589	131.1bp	124.0bp	0.00%	0.85%	0.50%	0.00%	0.01%	2.81%	0.79%	0.00%	378679812	0.01%	0.87%	48120985	0.85%	0.91%	0.10%	0.09%	40685508	20395623	4751944	1976948	66.05	27.00	0.48%	0.18%	0.98	0.000	No	0.00%				144bp	271bp	87.9%	0.0%	97.1%	88.5%	95.4%	180.7M	64.7%	97.8%	46130.0Mb	378.7M	54.7%	98.4%	67.3%
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3_1																																	131.1bp	98.0%	185.6M																90.5%	54%	151bp	151bp	18%	192.4M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3_2																																																			89.4%	54%	151bp	151bp	18%	192.4M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3_trimmed_1																																																			90.6%	54%	125bp	127bp	9%	189.3M	90.6%	54%	125bp	127bp	9%	189.3M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3_trimmed_2																																																			90.7%	54%	125bp	132bp	9%	189.3M	90.7%	54%	125bp	132bp	9%	189.3M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1	9999000000	253888182	139.7bp	130.0bp	0.01%	0.83%	0.52%	0.00%	0.03%	2.69%	0.80%	0.00%	543902716	0.01%	0.54%	248562602	0.93%	0.96%	0.05%	0.04%	231213990	116515445	13011641	4687402	419.69	207.00	0.74%	0.62%	0.98	0.000	No	0.00%				153bp	291bp	54.7%	0.0%	96.7%	87.1%	94.9%	258.1M	36.4%	97.7%	67792.3Mb	543.9M	55.6%	98.5%	61.3%
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1_1																																	139.7bp	97.7%	265.7M																81.8%	54%	151bp	151bp	18%	276.2M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1_2																																																			80.9%	55%	151bp	151bp	18%	276.2M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1_trimmed_1																																																			81.8%	55%	127bp	137bp	9%	272.0M	81.8%	55%	127bp	137bp	9%	272.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1_trimmed_2																																																			82.0%	55%	128bp	137bp	9%	272.0M	82.0%	55%	128bp	137bp	9%	272.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2	9999000000	160311046	140.8bp	131.0bp	0.01%	0.82%	0.52%	0.00%	0.03%	2.66%	0.81%	0.00%	590206640	0.01%	0.67%	195239096	0.92%	0.95%	0.06%	0.05%	178776422	90111387	11950341	4406084	321.07	157.00	0.72%	0.58%	0.98	0.000	No	0.00%				156bp	303bp	67.4%	0.0%	96.6%	87.2%	95.0%	280.3M	47.4%	97.7%	73712.2Mb	590.2M	55.5%	98.4%	60.3%
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2_1																																	140.8bp	97.7%	288.2M																85.8%	54%	151bp	151bp	18%	336.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2_2																																																			84.8%	55%	151bp	151bp	18%	336.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2_trimmed_1																																																			84.8%	55%	128bp	137bp	9%	295.1M	84.8%	55%	128bp	137bp	9%	295.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2_trimmed_2																																																			85.2%	55%	128bp	137bp	9%	295.1M	85.2%	55%	128bp	137bp	9%	295.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3	9999000000	81487709	138.0bp	127.0bp	0.01%	0.90%	0.57%	0.00%	0.01%	2.92%	0.89%	0.00%	462142250	0.01%	0.79%	96531806	0.89%	0.94%	0.07%	0.06%	86020493	43242410	6866283	2564569	145.82	67.00	0.63%	0.41%	0.98	0.000	No	0.00%				150bp	290bp	79.7%	0.0%	96.7%	86.6%	94.8%	219.0M	55.7%	97.7%	56515.4Mb	462.1M	55.5%	98.0%	63.0%
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3_1																																	138.0bp	97.8%	226.1M																88.0%	54%	151bp	151bp	18%	235.8M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3_2																																																			86.5%	55%	151bp	151bp	18%	235.8M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3_trimmed_1																																																			88.0%	55%	125bp	132bp	9%	231.1M	88.0%	55%	125bp	132bp	9%	231.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3_trimmed_2																																																			88.1%	55%	125bp	132bp	9%	231.1M	88.1%	55%	125bp	132bp	9%	231.1M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1	9999000000	418192799	144.9bp	135.0bp	0.01%	1.34%	0.48%	0.00%	0.01%	4.21%	0.75%	0.00%	591620418	0.01%	0.47%	313224846	0.94%	0.97%	0.05%	0.03%	294855753	148780114	14728658	4956354	570.78	243.00	0.73%	0.62%	0.98	0.000	No	0.00%				174bp	389bp	47.3%	0.0%	97.2%	88.3%	95.2%	281.5M	32.0%	97.8%	75233.8Mb	591.6M	54.4%	98.6%	56.0%
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1_1																																	144.9bp	98.2%	290.4M																86.4%	53%	151bp	151bp	18%	501.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1_2																																																			85.7%	54%	151bp	151bp	18%	501.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1_trimmed_1																																																			82.9%	54%	130bp	142bp	9%	295.8M	82.9%	54%	130bp	142bp	9%	295.8M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1_trimmed_2																																																			83.4%	54%	130bp	142bp	9%	295.8M	83.4%	54%	130bp	142bp	9%	295.8M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2	9999000000	264342226	146.6bp	136.0bp	0.00%	1.37%	0.52%	0.00%	0.01%	4.32%	0.81%	0.00%	590933752	0.01%	0.55%	264561359	0.94%	0.97%	0.05%	0.03%	248087867	125206019	12746049	4204944	479.00	198.00	0.71%	0.59%	0.98	0.000	No	0.00%				181bp	404bp	55.6%	0.0%	97.3%	88.4%	95.2%	281.3M	40.4%	97.8%	75648.3Mb	590.9M	54.8%	98.5%	54.5%
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2_1																																	146.6bp	98.3%	290.4M																87.5%	53%	151bp	151bp	18%	452.2M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2_2																																																			86.7%	55%	151bp	151bp	18%	452.2M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2_trimmed_1																																																			84.5%	54%	131bp	142bp	9%	295.5M	84.5%	54%	131bp	142bp	9%	295.5M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2_trimmed_2																																																			85.1%	55%	131bp	142bp	9%	295.5M	85.1%	55%	131bp	142bp	9%	295.5M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3	9999000000	162972240	146.1bp	135.0bp	0.00%	1.38%	0.52%	0.00%	0.00%	4.37%	0.81%	0.00%	589998118	0.01%	0.65%	203971161	0.93%	0.96%	0.05%	0.04%	189787930	95720071	10619484	3545741	359.21	145.00	0.68%	0.55%	0.98	0.000	No	0.00%				181bp	406bp	65.8%	0.0%	97.4%	88.4%	95.2%	280.9M	48.4%	97.7%	75191.2Mb	590.0M	54.8%	98.3%	55.4%
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3_1																																	146.1bp	98.4%	290.2M																90.0%	54%	151bp	151bp	18%	495.1M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3_2																																																			88.8%	54%	151bp	151bp	18%	495.1M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3_trimmed_1																																																			86.6%	54%	130bp	142bp	9%	295.0M	86.6%	54%	130bp	142bp	9%	295.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3_trimmed_2																																																			86.9%	55%	130bp	142bp	9%	295.0M	86.9%	55%	130bp	142bp	9%	295.0M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1	9999000000	285984258	159.1bp	146.0bp	0.01%	0.94%	0.32%	0.00%	0.01%	3.02%	0.51%	0.00%	166577588	0.01%	0.27%	122390696	0.94%	0.97%	0.05%	0.03%	115502776	58367211	5818503	1894708	233.55	103.00	0.66%	0.51%	0.98	0.000	No	0.00%				177bp	348bp	26.7%	0.0%	96.0%	88.5%	95.3%	79.4M	18.4%	97.7%	21770.5Mb	166.6M	55.5%	98.5%	48.2%
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1_1																																	159.1bp	97.6%	81.3M																69.4%	54%	151bp	151bp	18%	84.5M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1_2																																																			68.9%	55%	151bp	151bp	18%	84.5M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1_trimmed_1																																																			69.4%	55%	134bp	151bp	9%	83.3M	69.4%	55%	134bp	151bp	9%	83.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1_trimmed_2																																																			69.9%	55%	134bp	151bp	9%	83.3M	69.9%	55%	134bp	151bp	9%	83.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2	9999000000	280517018	159.7bp	146.0bp	0.00%	0.94%	0.33%	0.00%	0.01%	3.08%	0.53%	0.00%	590591728	0.01%	0.53%	279458052	0.93%	0.96%	0.06%	0.04%	260077988	131608515	15417172	4976927	517.91	248.00	0.74%	0.63%	0.98	0.000	No	0.00%				179bp	352bp	53.0%	0.0%	96.0%	88.4%	95.2%	281.3M	39.1%	97.7%	77489.8Mb	590.6M	56.0%	98.4%	47.6%
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2_1																																	159.7bp	97.7%	288.6M																87.7%	55%	151bp	151bp	18%	542.1M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2_2																																																			86.6%	55%	151bp	151bp	18%	542.1M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2_trimmed_1																																																			83.2%	55%	134bp	151bp	9%	295.3M	83.2%	55%	134bp	151bp	9%	295.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2_trimmed_2																																																			83.5%	56%	134bp	151bp	9%	295.3M	83.5%	56%	134bp	151bp	9%	295.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3	9999000000	197819170	158.9bp	146.0bp	0.00%	0.95%	0.34%	0.00%	0.00%	3.08%	0.55%	0.00%	590676356	0.01%	0.61%	230545829	0.92%	0.96%	0.06%	0.04%	212919852	107790783	13862418	4561531	418.02	201.00	0.72%	0.61%	0.98	0.000	No	0.00%				180bp	354bp	61.4%	0.0%	95.9%	88.5%	95.3%	281.5M	46.3%	97.7%	77221.5Mb	590.7M	55.8%	98.4%	47.9%
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3_1																																	158.9bp	97.7%	288.5M																87.2%	54%	151bp	151bp	18%	396.8M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3_2																																																			86.2%	55%	151bp	151bp	18%	396.8M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3_trimmed_1																																																			85.0%	55%	134bp	151bp	9%	295.3M	85.0%	55%	134bp	151bp	9%	295.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3_trimmed_2																																																			85.3%	56%	134bp	151bp	9%	295.3M	85.3%	56%	134bp	151bp	9%	295.3M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1	9999000000	12432299	99.9bp	96.0bp	0.03%	1.30%	0.51%	0.00%	0.07%	3.83%	0.78%	0.00%	56829786	0.02%	0.78%	12727209	0.83%	0.91%	0.09%	0.09%	10551196	5275439	1193772	537346	12.69	4.00	0.09%	0.01%	0.98	0.000	No	0.00%				98bp	119bp	79.0%	0.0%	97.0%	72.9%	89.1%	25.3M	41.0%	97.8%	5676.9Mb	56.8M	53.8%	97.7%	89.9%
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_1																																	99.9bp	97.4%	27.7M																82.1%	53%	151bp	151bp	18%	29.1M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_2																																																			80.4%	54%	151bp	151bp	36%	29.1M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_trimmed_1																																																			81.9%	53%	102bp	102bp	9%	28.4M	81.9%	53%	102bp	102bp	9%	28.4M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_trimmed_2																																																			81.2%	54%	102bp	102bp	9%	28.4M	81.2%	54%	102bp	102bp	9%	28.4M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2	9999000000	17300497	98.5bp	94.0bp	0.01%	1.46%	0.59%	0.00%	0.03%	4.23%	0.90%	0.00%	122552894	0.01%	0.85%	17882399	0.81%	0.90%	0.10%	0.10%	14425665	7201271	1755118	781258	17.41	6.00	0.14%	0.02%	0.98	0.000	No	0.00%				97bp	120bp	86.6%	0.0%	97.3%	76.0%	90.2%	55.3M	42.8%	97.8%	12105.8Mb	122.6M	53.9%	98.2%	90.7%
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2_1																																	98.5bp	97.8%	60.0M																88.0%	52%	151bp	151bp	27%	62.4M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2_2																																																			86.6%	54%	151bp	151bp	27%	62.4M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2_trimmed_1																																																			88.0%	53%	101bp	97bp	9%	61.3M	88.0%	53%	101bp	97bp	9%	61.3M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2_trimmed_2																																																			87.7%	54%	101bp	97bp	9%	61.3M	87.7%	54%	101bp	97bp	9%	61.3M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3	9999000000	12646746	101.7bp	98.0bp	0.01%	1.45%	0.58%	0.00%	0.03%	4.20%	0.89%	0.00%	86144414	0.01%	0.85%	12709778	0.82%	0.90%	0.10%	0.10%	10385599	5186554	1247277	557379	12.77	4.00	0.09%	0.01%	0.98	0.000	No	0.00%				100bp	127bp	86.3%	0.0%	97.2%	78.2%	91.1%	39.2M	45.3%	97.9%	8701.2Mb	86.1M	53.1%	98.1%	89.7%
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_1																																	101.7bp	97.9%	42.2M																87.5%	52%	151bp	151bp	18%	43.9M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_2																																																			86.2%	53%	151bp	151bp	36%	43.9M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_trimmed_1																																																			87.5%	52%	103bp	102bp	9%	43.1M	87.5%	52%	103bp	102bp	9%	43.1M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_trimmed_2																																																			87.2%	53%	103bp	102bp	9%	43.1M	87.2%	53%	103bp	102bp	9%	43.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1	9999000000	184931241	118.3bp	112.0bp	0.01%	1.71%	0.64%	0.00%	0.01%	4.65%	0.92%	0.00%	590523504	0.01%	0.63%	219196360	0.93%	0.96%	0.05%	0.04%	203846377	102301446	11516414	4517014	320.18	131.00	0.66%	0.54%	0.98	0.000	Yes	0.00%				120bp	192bp	63.3%	0.0%	97.4%	86.2%	94.5%	278.9M	37.5%	97.7%	66691.4Mb	590.5M	54.1%	98.4%	78.1%
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1_1																																	118.3bp	98.1%	289.8M																85.6%	52%	151bp	151bp	18%	367.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1_2																																																			84.6%	54%	151bp	151bp	27%	367.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1_trimmed_1																																																			84.0%	53%	115bp	117bp	9%	295.3M	84.0%	53%	115bp	117bp	9%	295.3M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1_trimmed_2																																																			84.2%	54%	116bp	117bp	9%	295.3M	84.2%	54%	116bp	117bp	9%	295.3M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2	9999000000	122303320	122.3bp	116.0bp	0.00%	1.74%	0.69%	0.00%	0.01%	4.78%	1.02%	0.00%	590392722	0.01%	0.73%	161540707	0.92%	0.95%	0.06%	0.05%	148278549	74402643	9268949	3631357	232.42	90.00	0.63%	0.48%	0.98	0.000	No	0.00%				127bp	212bp	73.1%	0.0%	97.4%	86.2%	94.5%	278.8M	46.9%	97.7%	68462.4Mb	590.4M	54.6%	98.4%	75.4%
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2_1																																	122.3bp	98.2%	289.9M																88.0%	53%	151bp	151bp	18%	363.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2_2																																																			86.9%	54%	151bp	151bp	18%	363.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2_trimmed_1																																																			86.7%	54%	119bp	122bp	9%	295.2M	86.7%	54%	119bp	122bp	9%	295.2M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2_trimmed_2																																																			86.9%	54%	119bp	122bp	9%	295.2M	86.9%	54%	119bp	122bp	9%	295.2M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3	9999000000	75729868	124.9bp	118.0bp	0.00%	1.75%	0.69%	0.00%	0.00%	4.82%	1.03%	0.00%	420206700	0.01%	0.78%	94400279	0.91%	0.95%	0.06%	0.05%	85865420	43042191	5835699	2294775	131.81	48.00	0.56%	0.36%	0.98	0.000	No	0.00%				130bp	222bp	78.0%	0.0%	97.4%	86.5%	94.6%	198.7M	52.3%	97.7%	49177.0Mb	420.2M	54.5%	98.3%	74.4%
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3_1																																	124.9bp	98.2%	206.4M																87.5%	53%	151bp	151bp	18%	213.8M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3_2																																																			86.3%	54%	151bp	151bp	18%	213.8M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3_trimmed_1																																																			87.6%	54%	120bp	122bp	9%	210.1M	87.6%	54%	120bp	122bp	9%	210.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3_trimmed_2																																																			87.7%	54%	120bp	122bp	9%	210.1M	87.7%	54%	120bp	122bp	9%	210.1M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1	9999000000	96531953	112.3bp	107.0bp	0.06%	0.96%	0.59%	0.00%	0.11%	2.59%	0.76%	0.00%	578660638	0.01%	0.79%	120501064	0.89%	0.94%	0.07%	0.06%	107146868	53699811	8479268	3517735	154.29	56.00	0.59%	0.39%	0.98	0.000	No	0.00%				111bp	162bp	79.8%	0.0%	98.1%	87.0%	94.9%	274.5M	46.4%	97.8%	63165.6Mb	578.7M	55.1%	98.5%	83.3%
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1_1																																	112.3bp	98.2%	284.0M																87.2%	53%	151bp	151bp	18%	293.8M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1_2																																																			85.6%	54%	151bp	151bp	27%	293.8M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1_trimmed_1																																																			87.2%	54%	111bp	112bp	9%	289.3M	87.2%	54%	111bp	112bp	9%	289.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1_trimmed_2																																																			86.8%	55%	112bp	112bp	9%	289.3M	86.8%	55%	112bp	112bp	9%	289.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2	9999000000	70417817	116.7bp	112.0bp	0.04%	0.85%	0.60%	0.00%	0.08%	2.31%	0.78%	0.00%	466458892	0.01%	0.81%	90110575	0.88%	0.93%	0.08%	0.07%	79049404	39603468	6849210	2804841	115.78	39.00	0.54%	0.31%	0.98	0.000	No	0.00%				117bp	175bp	81.4%	0.0%	98.0%	86.6%	94.6%	220.7M	49.7%	97.7%	52304.7Mb	466.5M	56.4%	98.2%	80.1%
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2_1																																	116.7bp	98.1%	228.8M																87.3%	55%	151bp	151bp	18%	237.4M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2_2																																																			85.6%	55%	151bp	151bp	27%	237.4M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2_trimmed_1																																																			87.3%	56%	115bp	117bp	9%	233.2M	87.3%	56%	115bp	117bp	9%	233.2M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2_trimmed_2																																																			87.0%	56%	115bp	117bp	9%	233.2M	87.0%	56%	115bp	117bp	9%	233.2M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3	9999000000	43060333	118.8bp	114.0bp	0.02%	0.88%	0.64%	0.00%	0.04%	2.37%	0.84%	0.00%	326564186	0.01%	0.84%	51478839	0.86%	0.93%	0.08%	0.07%	44307265	22197683	4085517	1662921	64.95	20.00	0.43%	0.18%	0.98	0.000	No	0.00%				121bp	187bp	85.0%	0.0%	98.0%	86.5%	94.6%	154.4M	49.8%	97.7%	37313.8Mb	326.6M	56.8%	98.2%	78.1%
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3_1																																	118.8bp	98.1%	160.2M																88.4%	55%	151bp	151bp	18%	166.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3_2																																																			86.6%	56%	151bp	151bp	18%	166.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3_trimmed_1																																																			88.4%	56%	117bp	117bp	9%	163.3M	88.4%	56%	117bp	117bp	9%	163.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3_trimmed_2																																																			88.0%	57%	117bp	117bp	9%	163.3M	88.0%	57%	117bp	117bp	9%	163.3M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1	9999000000	99933937	140.9bp	132.0bp	0.01%	0.54%	0.18%	0.00%	0.03%	1.66%	0.32%	0.00%	587662696	0.01%	0.79%	121539723	0.87%	0.94%	0.08%	0.06%	105695885	53190580	9569358	3696121	182.09	46.00	0.57%	0.36%	0.98	0.000	No	0.00%				145bp	212bp	80.2%	0.0%	96.1%	85.2%	94.3%	277.2M	59.5%	97.4%	73679.7Mb	587.7M	60.7%	97.9%	59.4%
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1_1																																	140.9bp	97.2%	285.7M																91.2%	59%	151bp	151bp	18%	416.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1_2																																																			89.3%	59%	151bp	151bp	18%	416.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1_trimmed_1																																																			89.3%	60%	129bp	137bp	9%	293.8M	89.3%	60%	129bp	137bp	9%	293.8M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1_trimmed_2																																																			89.1%	61%	129bp	137bp	9%	293.8M	89.1%	61%	129bp	137bp	9%	293.8M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2	9999000000	63374579	144.5bp	135.0bp	0.01%	0.52%	0.18%	0.00%	0.03%	1.60%	0.32%	0.00%	561823188	0.01%	0.87%	71759294	0.82%	0.91%	0.10%	0.09%	58532518	29370930	7465053	2952996	99.93	24.00	0.47%	0.24%	0.98	0.000	No	0.00%				150bp	226bp	88.1%	0.0%	95.9%	85.7%	94.4%	265.2M	66.7%	97.4%	71418.3Mb	561.8M	60.8%	97.5%	56.3%
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2_1																																	144.5bp	97.2%	273.2M																91.5%	59%	151bp	151bp	18%	288.2M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2_2																																																			89.3%	60%	151bp	151bp	18%	288.2M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2_trimmed_1																																																			91.6%	60%	130bp	142bp	9%	280.9M	91.6%	60%	130bp	142bp	9%	280.9M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2_trimmed_2																																																			91.2%	61%	131bp	142bp	9%	280.9M	91.2%	61%	131bp	142bp	9%	280.9M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3	9999000000	33959535	144.5bp	135.0bp	0.01%	0.57%	0.19%	0.00%	0.01%	1.75%	0.34%	0.00%	340580052	0.01%	0.90%	34875703	0.78%	0.90%	0.11%	0.10%	27084364	13565723	3926187	1564510	46.08	11.00	0.32%	0.11%	0.98	0.000	No	0.00%				150bp	228bp	90.8%	0.0%	96.0%	85.3%	94.3%	160.6M	68.4%	97.4%	43122.0Mb	340.6M	60.6%	97.8%	57.1%
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3_1																																	144.5bp	97.2%	165.5M																92.0%	59%	151bp	151bp	18%	174.1M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3_2																																																			90.0%	60%	151bp	151bp	18%	174.1M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3_trimmed_1																																																			92.2%	60%	130bp	142bp	9%	170.3M	92.2%	60%	130bp	142bp	9%	170.3M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3_trimmed_2																																																			91.7%	60%	130bp	142bp	9%	170.3M	91.7%	60%	130bp	142bp	9%	170.3M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1	9999000000	126880672	122.8bp	117.0bp	0.01%	1.59%	0.55%	0.00%	0.03%	4.50%	0.85%	0.00%	399047534	0.01%	0.64%	144520329	0.92%	0.94%	0.07%	0.06%	132429207	66490555	9538468	3941241	205.34	88.00	0.64%	0.48%	0.98	0.000	No	0.00%				124bp	190bp	64.2%	0.0%	96.6%	87.7%	95.2%	189.8M	41.2%	97.9%	46366.9Mb	399.0M	52.7%	98.5%	76.2%
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1_1																																	122.8bp	97.7%	195.0M																81.9%	52%	151bp	151bp	18%	202.6M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1_2																																																			80.9%	52%	151bp	151bp	27%	202.6M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1_trimmed_1																																																			81.9%	52%	119bp	122bp	9%	199.5M	81.9%	52%	119bp	122bp	9%	199.5M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1_trimmed_2																																																			82.0%	52%	119bp	122bp	9%	199.5M	82.0%	52%	119bp	122bp	9%	199.5M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2	9999000000	98746881	123.3bp	117.0bp	0.01%	1.69%	0.60%	0.00%	0.01%	4.78%	0.94%	0.00%	540220732	0.01%	0.79%	112388346	0.89%	0.93%	0.08%	0.07%	100095259	50211987	8890859	3710124	151.55	63.00	0.60%	0.41%	0.98	0.000	No	0.00%				125bp	197bp	79.7%	0.0%	96.8%	87.5%	95.1%	256.8M	53.2%	97.7%	62884.3Mb	540.2M	52.9%	98.5%	75.5%
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2_1																																	123.3bp	97.9%	264.5M																87.7%	52%	151bp	151bp	18%	274.1M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2_2																																																			86.6%	53%	151bp	151bp	18%	274.1M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2_trimmed_1																																																			87.8%	52%	119bp	122bp	9%	270.1M	87.8%	52%	119bp	122bp	9%	270.1M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2_trimmed_2																																																			87.8%	53%	119bp	122bp	9%	270.1M	87.8%	53%	119bp	122bp	9%	270.1M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3	9999000000	60179187	121.4bp	116.0bp	0.01%	1.69%	0.60%	0.00%	0.01%	4.75%	0.96%	0.00%	421877870	0.01%	0.87%	54549271	0.85%	0.90%	0.10%	0.10%	46240977	23154895	5669115	2432904	67.59	26.00	0.48%	0.20%	0.98	0.000	No	0.00%				122bp	189bp	87.6%	0.0%	96.9%	87.3%	95.0%	200.5M	59.0%	97.5%	48403.4Mb	421.9M	53.7%	98.4%	76.8%
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3_1																																	121.4bp	97.9%	206.6M																90.4%	52%	151bp	151bp	18%	214.4M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3_2																																																			89.2%	53%	151bp	151bp	18%	214.4M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3_trimmed_1																																																			90.5%	53%	118bp	117bp	9%	210.9M	90.5%	53%	118bp	117bp	9%	210.9M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3_trimmed_2																																																			90.5%	53%	118bp	117bp	9%	210.9M	90.5%	53%	118bp	117bp	9%	210.9M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1	9999000000	144930653	124.8bp	119.0bp	0.02%	1.52%	0.64%	0.00%	0.04%	4.35%	0.95%	0.00%	589687058	0.01%	0.69%	184189730	0.92%	0.95%	0.06%	0.05%	169346369	85067369	10678717	4164349	272.31	110.00	0.67%	0.52%	0.98	0.000	No	0.00%				133bp	229bp	69.3%	0.0%	97.3%	85.8%	94.3%	277.9M	47.8%	97.7%	69758.8Mb	589.7M	56.5%	98.3%	72.7%
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1_1																																	124.8bp	98.0%	289.1M																87.5%	55%	151bp	151bp	18%	394.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1_2																																																			86.1%	55%	151bp	151bp	18%	394.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1_trimmed_1																																																			85.3%	56%	121bp	122bp	9%	294.8M	85.3%	56%	121bp	122bp	9%	294.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1_trimmed_2																																																			85.4%	56%	121bp	122bp	9%	294.8M	85.4%	56%	121bp	122bp	9%	294.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2	9999000000	91760852	126.9bp	121.0bp	0.02%	1.44%	0.63%	0.00%	0.03%	4.17%	0.96%	0.00%	588526388	0.01%	0.81%	109034020	0.89%	0.93%	0.08%	0.07%	96509815	48409160	8388456	3375374	152.75	57.00	0.60%	0.39%	0.98	0.000	No	0.00%				138bp	244bp	82.0%	0.0%	97.2%	86.3%	94.4%	277.8M	60.3%	97.7%	70549.1Mb	588.5M	56.9%	98.1%	70.5%
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2_1																																	126.9bp	98.0%	288.5M																89.9%	55%	151bp	151bp	18%	342.6M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2_2																																																			88.2%	56%	151bp	151bp	18%	342.6M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2_trimmed_1																																																			89.0%	56%	123bp	127bp	9%	294.3M	89.0%	56%	123bp	127bp	9%	294.3M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2_trimmed_2																																																			88.9%	57%	123bp	127bp	9%	294.3M	88.9%	57%	123bp	127bp	9%	294.3M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3	9999000000	43213506	122.2bp	115.0bp	0.01%	1.60%	0.69%	0.00%	0.02%	4.61%	1.04%	0.00%	359862706	0.01%	0.86%	49899560	0.87%	0.93%	0.08%	0.07%	43169140	21597629	4202809	1692343	65.16	23.00	0.45%	0.18%	0.98	0.000	No	0.00%				131bp	227bp	86.7%	0.0%	97.4%	85.6%	94.2%	169.5M	58.3%	97.7%	41827.3Mb	359.9M	56.8%	97.9%	74.0%
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3_1																																	122.2bp	98.1%	176.6M																90.0%	55%	151bp	151bp	18%	183.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3_2																																																			88.3%	56%	151bp	151bp	27%	183.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3_trimmed_1																																																			90.1%	56%	119bp	122bp	9%	179.9M	90.1%	56%	119bp	122bp	9%	179.9M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3_trimmed_2																																																			90.0%	57%	119bp	122bp	9%	179.9M	90.0%	57%	119bp	122bp	9%	179.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1	9999000000	222964033	123.6bp	116.0bp	0.01%	0.90%	0.64%	0.00%	0.03%	2.99%	1.02%	0.00%	588956442	0.01%	0.60%	233083473	0.94%	0.97%	0.04%	0.03%	218988176	109921633	10179150	3708656	366.47	160.00	0.71%	0.58%	0.98	0.000	No	0.00%				140bp	288bp	60.8%	0.0%	97.9%	87.5%	94.9%	279.5M	36.1%	97.7%	68710.9Mb	589.0M	55.1%	98.2%	72.8%
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1_1																																	123.6bp	98.5%	290.2M																87.7%	54%	151bp	151bp	18%	516.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1_2																																																			86.3%	54%	151bp	151bp	18%	516.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1_trimmed_1																																																			83.7%	54%	119bp	122bp	9%	294.5M	83.7%	54%	119bp	122bp	9%	294.5M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1_trimmed_2																																																			83.8%	55%	119bp	122bp	9%	294.5M	83.8%	55%	119bp	122bp	9%	294.5M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2	9999000000	114666514	130.4bp	124.0bp	0.01%	0.83%	0.63%	0.00%	0.02%	2.78%	1.03%	0.00%	590798796	0.01%	0.75%	145309493	0.92%	0.96%	0.05%	0.04%	133387014	66974750	7953454	2974920	225.74	91.00	0.66%	0.48%	0.98	0.000	No	0.00%				160bp	351bp	75.9%	0.0%	97.9%	88.3%	95.2%	281.2M	52.8%	97.6%	72069.5Mb	590.8M	55.7%	98.5%	67.3%
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2_1																																	130.4bp	98.5%	291.0M																89.6%	54%	151bp	151bp	18%	402.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2_2																																																			88.3%	55%	151bp	151bp	18%	402.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2_trimmed_1																																																			87.6%	55%	125bp	132bp	9%	295.4M	87.6%	55%	125bp	132bp	9%	295.4M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2_trimmed_2																																																			87.5%	55%	125bp	132bp	9%	295.4M	87.5%	55%	125bp	132bp	9%	295.4M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3	9999000000	86042807	133.6bp	125.0bp	0.00%	0.85%	0.67%	0.00%	0.01%	2.91%	1.09%	0.00%	590335232	0.01%	0.82%	105463335	0.90%	0.95%	0.06%	0.05%	95393171	47871624	6118079	2275547	159.82	62.00	0.61%	0.40%	0.98	0.000	No	0.00%				171bp	382bp	82.7%	0.0%	98.0%	88.3%	95.2%	281.0M	59.9%	97.7%	72560.9Mb	590.3M	55.8%	98.4%	65.5%
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3_1																																	133.6bp	98.6%	290.9M																92.4%	54%	151bp	151bp	18%	491.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3_2																																																			91.2%	55%	151bp	151bp	18%	491.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3_trimmed_1																																																			89.7%	55%	126bp	132bp	18%	295.2M	89.7%	55%	126bp	132bp	18%	295.2M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3_trimmed_2																																																			89.8%	56%	126bp	132bp	18%	295.2M	89.8%	56%	126bp	132bp	18%	295.2M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1	9999000000	137297239	127.6bp	120.0bp	0.02%	1.23%	0.60%	0.00%	0.03%	3.59%	0.95%	0.00%	588078802	0.01%	0.76%	141868023	0.89%	0.94%	0.07%	0.06%	126498518	63508089	10083632	4001020	201.92	69.00	0.62%	0.43%	0.98	0.000	No	0.00%				132bp	201bp	76.6%	0.0%	96.9%	83.3%	93.3%	274.4M	51.7%	97.4%	69880.3Mb	588.1M	59.6%	98.0%	70.5%
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1_1																																	127.6bp	97.7%	287.3M																88.2%	57%	151bp	151bp	18%	344.6M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1_2																																																			86.7%	58%	151bp	151bp	27%	344.6M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1_trimmed_1																																																			87.2%	59%	122bp	127bp	9%	294.0M	87.2%	59%	122bp	127bp	9%	294.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1_trimmed_2																																																			87.1%	59%	122bp	127bp	9%	294.0M	87.1%	59%	122bp	127bp	9%	294.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2	9999000000	66467431	131.8bp	124.0bp	0.01%	1.17%	0.58%	0.00%	0.02%	3.43%	0.93%	0.00%	493372714	0.01%	0.85%	73979982	0.85%	0.92%	0.09%	0.08%	62742786	31448749	6984274	2849475	99.85	31.00	0.51%	0.26%	0.98	0.000	No	0.00%				139bp	220bp	85.7%	0.0%	96.8%	84.2%	93.7%	231.1M	63.1%	97.6%	60072.7Mb	493.4M	59.9%	97.9%	66.9%
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2_1																																	131.8bp	97.7%	240.9M																89.7%	58%	151bp	151bp	18%	252.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2_2																																																			87.9%	58%	151bp	151bp	18%	252.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2_trimmed_1																																																			89.8%	59%	125bp	132bp	9%	246.7M	89.8%	59%	125bp	132bp	9%	246.7M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2_trimmed_2																																																			89.6%	60%	125bp	132bp	9%	246.7M	89.6%	60%	125bp	132bp	9%	246.7M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3	9999000000	36420594	128.6bp	121.0bp	0.01%	1.26%	0.63%	0.00%	0.01%	3.69%	1.02%	0.00%	346909780	0.01%	0.89%	38718581	0.81%	0.90%	0.11%	0.10%	31487139	15749199	4082913	1671315	49.43	14.00	0.36%	0.12%	0.98	0.000	No	0.00%				135bp	212bp	89.7%	0.0%	96.9%	83.5%	93.5%	162.1M	62.3%	97.5%	41339.8Mb	346.9M	60.0%	97.8%	69.2%
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3_1																																	128.6bp	97.6%	169.4M																91.3%	57%	151bp	151bp	18%	177.4M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3_2																																																			89.2%	58%	151bp	151bp	27%	177.4M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3_trimmed_1																																																			91.3%	59%	122bp	127bp	9%	173.5M	91.3%	59%	122bp	127bp	9%	173.5M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3_trimmed_2																																																			91.0%	60%	122bp	127bp	9%	173.5M	91.0%	60%	122bp	127bp	9%	173.5M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1	9999000000	363416661	140.5bp	131.0bp	0.01%	0.96%	0.75%	0.00%	0.02%	3.01%	1.13%	0.00%	590853526	0.01%	0.50%	295228840	0.94%	0.97%	0.04%	0.03%	277507157	139819440	12828645	4332572	520.34	223.00	0.73%	0.62%	0.98	0.000	No	0.00%				160bp	337bp	50.5%	0.0%	97.6%	84.8%	93.8%	277.2M	32.3%	97.7%	73932.0Mb	590.9M	55.9%	98.5%	60.2%
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1_1																																	140.5bp	98.1%	289.8M																86.4%	54%	151bp	151bp	18%	576.3M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1_2																																																			85.7%	55%	151bp	151bp	18%	576.3M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1_trimmed_1																																																			81.6%	55%	128bp	137bp	9%	295.4M	81.6%	55%	128bp	137bp	9%	295.4M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1_trimmed_2																																																			82.3%	56%	128bp	137bp	9%	295.4M	82.3%	56%	128bp	137bp	9%	295.4M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2	9999000000	234829024	141.2bp	132.0bp	0.01%	0.94%	0.75%	0.00%	0.02%	2.94%	1.16%	0.00%	590773876	0.01%	0.58%	248189127	0.93%	0.97%	0.05%	0.03%	231720243	116765795	11791985	4038304	432.72	181.00	0.71%	0.59%	0.98	0.000	No	0.00%				163bp	347bp	58.5%	0.0%	97.6%	84.9%	93.9%	277.4M	39.8%	97.8%	74222.0Mb	590.8M	56.1%	98.5%	59.2%
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2_1																																	141.2bp	98.1%	289.7M																86.1%	55%	151bp	151bp	18%	428.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2_2																																																			85.3%	55%	151bp	151bp	18%	428.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2_trimmed_1																																																			83.2%	55%	128bp	137bp	9%	295.4M	83.2%	55%	128bp	137bp	9%	295.4M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2_trimmed_2																																																			83.8%	56%	129bp	137bp	9%	295.4M	83.8%	56%	129bp	137bp	9%	295.4M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3	9999000000	133397738	143.0bp	133.0bp	0.00%	0.99%	0.80%	0.00%	0.01%	3.12%	1.22%	0.00%	589625544	0.01%	0.70%	176814311	0.92%	0.96%	0.05%	0.04%	162734886	81992575	9088027	3088159	300.45	119.00	0.68%	0.53%	0.98	0.000	No	0.00%				169bp	365bp	70.6%	0.0%	97.7%	84.6%	93.8%	276.4M	51.2%	97.7%	74280.0Mb	589.6M	56.2%	98.3%	58.2%
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3_1																																	143.0bp	98.1%	289.3M																89.6%	54%	151bp	151bp	18%	458.1M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3_2																																																			88.2%	55%	151bp	151bp	18%	458.1M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3_trimmed_1																																																			86.7%	55%	129bp	137bp	9%	294.8M	86.7%	55%	129bp	137bp	9%	294.8M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3_trimmed_2																																																			86.8%	56%	129bp	137bp	9%	294.8M	86.8%	56%	129bp	137bp	9%	294.8M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1	9999000000	120098277	134.2bp	127.0bp	0.01%	0.74%	0.44%	0.00%	0.03%	2.43%	0.76%	0.00%	589456488	0.01%	0.75%	144539037	0.90%	0.94%	0.07%	0.06%	129688259	65167830	9794537	3813087	218.60	76.00	0.64%	0.45%	0.98	0.000	No	0.00%				145bp	241bp	76.1%	0.0%	97.1%	86.4%	94.6%	278.9M	53.8%	97.5%	72250.0Mb	589.5M	59.8%	98.2%	65.6%
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1_1																																	134.2bp	97.8%	288.3M																88.4%	58%	151bp	151bp	18%	363.4M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1_2																																																			87.0%	58%	151bp	151bp	18%	363.4M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1_trimmed_1																																																			87.0%	59%	126bp	132bp	9%	294.7M	87.0%	59%	126bp	132bp	9%	294.7M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1_trimmed_2																																																			87.1%	60%	126bp	132bp	9%	294.7M	87.1%	60%	126bp	132bp	9%	294.7M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2	9999000000	65894488	131.9bp	123.0bp	0.01%	0.72%	0.44%	0.00%	0.02%	2.37%	0.78%	0.00%	588509548	0.01%	0.88%	73241660	0.84%	0.91%	0.10%	0.09%	61160633	30646514	7215413	2951221	99.48	31.00	0.51%	0.26%	0.98	0.000	No	0.00%				143bp	237bp	88.3%	0.0%	97.1%	86.4%	94.7%	278.6M	62.3%	97.6%	71229.2Mb	588.5M	60.1%	98.1%	66.8%
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2_1																																	131.9bp	97.8%	287.9M																91.2%	58%	151bp	151bp	18%	313.3M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2_2																																																			89.6%	59%	151bp	151bp	18%	313.3M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2_trimmed_1																																																			91.1%	59%	124bp	127bp	9%	294.3M	91.1%	59%	124bp	127bp	9%	294.3M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2_trimmed_2																																																			91.0%	60%	124bp	127bp	9%	294.3M	91.0%	60%	124bp	127bp	9%	294.3M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3	9999000000	36589966	132.6bp	125.0bp	0.01%	0.77%	0.47%	0.00%	0.01%	2.56%	0.84%	0.00%	345862218	0.01%	0.88%	39925456	0.84%	0.92%	0.09%	0.08%	33355720	16702219	3676580	1471619	53.95	16.00	0.38%	0.14%	0.98	0.000	No	0.00%				146bp	248bp	89.2%	0.0%	97.2%	86.2%	94.6%	163.6M	64.6%	97.6%	42061.9Mb	345.9M	60.3%	98.2%	66.3%
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3_1																																	132.6bp	97.9%	169.3M																91.1%	58%	151bp	151bp	18%	176.2M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3_2																																																			89.4%	59%	151bp	151bp	18%	176.2M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3_trimmed_1																																																			91.1%	60%	125bp	132bp	9%	172.9M	91.1%	60%	125bp	132bp	9%	172.9M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3_trimmed_2																																																			90.9%	60%	125bp	132bp	9%	172.9M	90.9%	60%	125bp	132bp	9%	172.9M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1	9999000000	202134525	125.3bp	119.0bp	0.03%	1.52%	0.65%	0.00%	0.05%	4.22%	0.90%	0.00%	590192238	0.01%	0.61%	227613704	0.93%	0.96%	0.05%	0.04%	212681200	106881725	10995020	4075663	351.66	125.00	0.67%	0.53%	0.98	0.000	Yes	0.00%				130bp	230bp	61.8%	0.0%	97.9%	84.8%	94.0%	277.4M	38.4%	97.7%	69277.3Mb	590.2M	56.5%	98.4%	73.1%
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1_1																																	125.3bp	98.1%	289.5M																87.1%	55%	151bp	151bp	18%	487.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1_2																																																			86.0%	55%	151bp	151bp	18%	487.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1_trimmed_1																																																			83.3%	56%	120bp	122bp	9%	295.1M	83.3%	56%	120bp	122bp	9%	295.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1_trimmed_2																																																			83.6%	56%	120bp	122bp	9%	295.1M	83.6%	56%	120bp	122bp	9%	295.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2	9999000000	166850757	128.2bp	122.0bp	0.02%	1.46%	0.65%	0.00%	0.05%	4.12%	0.92%	0.00%	589541326	0.01%	0.74%	154576847	0.92%	0.95%	0.06%	0.05%	141791832	71194868	9039169	3432213	232.69	78.00	0.62%	0.46%	0.98	0.000	No	0.00%				138bp	260bp	74.3%	0.0%	97.8%	85.7%	94.3%	278.1M	48.9%	97.4%	70420.6Mb	589.5M	56.4%	98.3%	70.0%
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2_1																																	128.2bp	98.1%	289.2M																89.0%	55%	151bp	151bp	18%	412.8M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2_2																																																			87.8%	56%	151bp	151bp	18%	412.8M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2_trimmed_1																																																			86.7%	56%	123bp	127bp	9%	294.8M	86.7%	56%	123bp	127bp	9%	294.8M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2_trimmed_2																																																			87.0%	56%	123bp	127bp	9%	294.8M	87.0%	56%	123bp	127bp	9%	294.8M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3	9999000000	80026906	128.6bp	122.0bp	0.01%	1.57%	0.70%	0.00%	0.02%	4.40%	0.98%	0.00%	590167490	0.01%	0.83%	98267396	0.89%	0.94%	0.07%	0.06%	87763673	44019267	6703321	2580849	141.12	45.00	0.56%	0.35%	0.98	0.000	No	0.00%				139bp	265bp	83.9%	0.0%	97.9%	85.6%	94.3%	278.3M	58.6%	97.7%	70738.7Mb	590.2M	56.5%	98.4%	70.1%
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3_1																																	128.6bp	98.2%	289.6M																91.7%	54%	151bp	151bp	18%	400.6M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3_2																																																			90.2%	55%	151bp	151bp	18%	400.6M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3_trimmed_1																																																			90.1%	56%	123bp	127bp	9%	295.1M	90.1%	56%	123bp	127bp	9%	295.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3_trimmed_2																																																			90.0%	56%	123bp	127bp	9%	295.1M	90.0%	56%	123bp	127bp	9%	295.1M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1	9999000000	151416141	119.2bp	113.0bp	0.01%	1.54%	0.49%	0.00%	0.02%	4.52%	0.76%	0.00%	590804076	0.01%	0.67%	192340355	0.92%	0.95%	0.06%	0.05%	177705727	89199455	10982028	4390200	277.42	136.00	0.71%	0.56%	0.98	0.000	No	0.00%				118bp	188bp	67.9%	0.0%	97.3%	87.8%	95.0%	280.6M	40.7%	97.8%	66934.5Mb	590.8M	53.2%	98.5%	78.0%
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1_1																																	119.2bp	97.9%	289.2M																85.3%	51%	151bp	151bp	18%	334.2M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1_2																																																			84.0%	53%	151bp	151bp	18%	334.2M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1_trimmed_1																																																			84.4%	52%	116bp	117bp	9%	295.4M	84.4%	52%	116bp	117bp	9%	295.4M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1_trimmed_2																																																			84.3%	53%	116bp	117bp	9%	295.4M	84.3%	53%	116bp	117bp	9%	295.4M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2	9999000000	26467702	113.1bp	109.0bp	0.01%	1.29%	0.42%	0.00%	0.02%	3.66%	0.66%	0.00%	146067656	0.01%	0.83%	24831667	0.77%	0.84%	0.16%	0.16%	19116450	9564133	3901666	1784741	26.25	9.00	0.23%	0.04%	0.98	0.000	No	0.00%				112bp	148bp	84.0%	0.0%	95.5%	80.8%	93.2%	68.0M	50.2%	97.4%	16007.8Mb	146.1M	56.7%	97.7%	82.7%
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2_1																																	113.1bp	95.4%	69.7M																86.1%	54%	151bp	151bp	18%	74.8M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2_2																																																			84.4%	56%	151bp	151bp	27%	74.8M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2_trimmed_1																																																			86.2%	56%	112bp	112bp	9%	73.0M	86.2%	56%	112bp	112bp	9%	73.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2_trimmed_2																																																			85.9%	56%	113bp	112bp	9%	73.0M	85.9%	56%	113bp	112bp	9%	73.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3	9999000000	69763006	121.7bp	115.0bp	0.00%	1.55%	0.54%	0.00%	0.01%	4.54%	0.84%	0.00%	546506532	0.01%	0.84%	89898476	0.89%	0.94%	0.07%	0.06%	79782464	39992793	6686313	2730343	121.61	54.00	0.60%	0.36%	0.98	0.000	No	0.00%				122bp	201bp	84.1%	0.0%	97.4%	87.9%	95.0%	259.5M	54.9%	97.8%	62914.2Mb	546.5M	53.7%	98.6%	76.4%
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3_1																																	121.7bp	98.0%	267.8M																89.4%	52%	151bp	151bp	18%	277.2M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3_2																																																			88.3%	53%	151bp	151bp	18%	277.2M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3_trimmed_1																																																			89.4%	53%	118bp	117bp	9%	273.3M	89.4%	53%	118bp	117bp	9%	273.3M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3_trimmed_2																																																			89.5%	53%	118bp	117bp	9%	273.3M	89.5%	53%	118bp	117bp	9%	273.3M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1	9999000000	232204367	142.9bp	133.0bp	0.01%	0.98%	0.41%	0.00%	0.01%	3.02%	0.66%	0.00%	590304290	0.01%	0.58%	248810611	0.94%	0.97%	0.05%	0.03%	232922474	117409655	12236786	4224714	426.98	208.00	0.74%	0.62%	0.98	0.000	No	0.00%				153bp	317bp	58.2%	0.0%	97.3%	90.0%	95.6%	282.2M	39.9%	97.8%	74089.5Mb	590.3M	55.2%	98.4%	60.0%
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1_1																																	142.9bp	98.0%	289.2M																84.5%	54%	151bp	151bp	18%	372.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1_2																																																			83.6%	54%	151bp	151bp	18%	372.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1_trimmed_1																																																			82.7%	54%	128bp	137bp	9%	295.2M	82.7%	54%	128bp	137bp	9%	295.2M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1_trimmed_2																																																			83.1%	55%	128bp	137bp	9%	295.2M	83.1%	55%	128bp	137bp	9%	295.2M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2	9999000000	139876892	136.5bp	125.0bp	0.00%	1.10%	0.46%	0.00%	0.01%	3.32%	0.73%	0.00%	588228770	0.01%	0.70%	174800049	0.93%	0.96%	0.05%	0.04%	161693818	81348069	9451168	3325164	279.77	134.00	0.70%	0.55%	0.98	0.000	No	0.00%				143bp	288bp	70.7%	0.0%	97.3%	89.5%	95.5%	280.8M	48.1%	97.8%	71706.1Mb	588.2M	54.8%	98.0%	63.7%
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2_1																																	136.5bp	98.1%	288.6M																88.9%	53%	151bp	151bp	18%	434.5M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2_2																																																			87.6%	54%	151bp	151bp	18%	434.5M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2_trimmed_1																																																			86.0%	54%	125bp	132bp	9%	294.1M	86.0%	54%	125bp	132bp	9%	294.1M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2_trimmed_2																																																			86.5%	55%	125bp	132bp	9%	294.1M	86.5%	55%	125bp	132bp	9%	294.1M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3	9999000000	103507699	140.6bp	130.0bp	0.00%	1.05%	0.46%	0.00%	0.01%	3.19%	0.72%	0.00%	498079272	0.01%	0.76%	119504397	0.92%	0.96%	0.06%	0.04%	109419964	55069973	7088961	2508280	192.63	88.00	0.66%	0.47%	0.98	0.000	No	0.00%				152bp	314bp	76.5%	0.0%	97.3%	90.0%	95.6%	238.1M	55.4%	97.8%	62188.4Mb	498.1M	55.2%	98.2%	60.8%
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3_1																																	140.6bp	98.1%	244.3M																87.4%	53%	151bp	151bp	18%	253.5M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3_2																																																			86.1%	55%	151bp	151bp	18%	253.5M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3_trimmed_1																																																			87.4%	54%	128bp	137bp	9%	249.0M	87.4%	54%	128bp	137bp	9%	249.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3_trimmed_2																																																			87.5%	55%	128bp	137bp	9%	249.0M	87.5%	55%	128bp	137bp	9%	249.0M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1	9999000000	7293737	97.8bp	94.0bp	0.04%	1.60%	0.46%	0.00%	0.07%	4.31%	0.64%	0.00%	28219820	0.01%	0.78%	6232693	0.82%	0.87%	0.14%	0.13%	5118250	2558641	849643	393214	6.12	2.00	0.03%	0.00%	0.98	0.000	No	0.00%				95bp	117bp	78.7%	0.0%	96.0%	79.4%	92.7%	13.1M	36.9%	97.7%	2745.4Mb	28.2M	53.0%	95.9%	89.7%
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1_1																																	97.8bp	96.5%	13.6M																79.7%	52%	151bp	151bp	36%	14.7M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1_2																																																			78.2%	55%	151bp	151bp	36%	14.7M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1_trimmed_1																																																			79.1%	52%	99bp	97bp	9%	14.1M	79.1%	52%	99bp	97bp	9%	14.1M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1_trimmed_2																																																			78.8%	53%	100bp	97bp	9%	14.1M	78.8%	53%	100bp	97bp	9%	14.1M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2	9999000000	7648570	100.7bp	97.0bp	0.01%	1.64%	0.52%	0.00%	0.03%	4.45%	0.73%	0.00%	38636268	0.01%	0.82%	6802930	0.83%	0.89%	0.12%	0.11%	5672534	2835413	786902	356322	7.01	2.00	0.04%	0.01%	0.98	0.000	No	0.00%				99bp	126bp	83.1%	0.0%	96.7%	81.9%	93.1%	18.0M	39.9%	97.7%	3869.6Mb	38.6M	53.5%	97.5%	89.1%
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2_1																																	100.7bp	97.5%	18.8M																83.6%	52%	151bp	151bp	27%	19.8M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2_2																																																			82.2%	54%	151bp	151bp	36%	19.8M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2_trimmed_1																																																			83.5%	53%	102bp	102bp	9%	19.3M	83.5%	53%	102bp	102bp	9%	19.3M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2_trimmed_2																																																			83.1%	53%	103bp	102bp	9%	19.3M	83.1%	53%	103bp	102bp	9%	19.3M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3	9999000000	5187946	105.7bp	102.0bp	0.01%	1.62%	0.52%	0.00%	0.02%	4.42%	0.73%	0.00%	28608870	0.01%	0.83%	4798177	0.83%	0.89%	0.12%	0.11%	3993522	1995825	562670	254859	4.97	2.00	0.02%	0.00%	0.98	0.000	No	0.00%				103bp	135bp	83.9%	0.0%	96.6%	83.0%	93.5%	13.4M	45.2%	97.8%	2960.3Mb	28.6M	53.0%	97.0%	87.1%
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3_1																																	105.7bp	97.5%	14.0M																84.2%	52%	151bp	151bp	18%	14.8M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3_2																																																			82.9%	53%	151bp	151bp	36%	14.8M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3_trimmed_1																																																			84.0%	52%	106bp	107bp	9%	14.3M	84.0%	52%	106bp	107bp	9%	14.3M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3_trimmed_2																																																			83.8%	53%	106bp	107bp	9%	14.3M	83.8%	53%	106bp	107bp	9%	14.3M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1	9999000000	333574088	137.7bp	129.0bp	0.01%	0.96%	0.54%	0.00%	0.01%	2.95%	0.82%	0.00%	590642454	0.01%	0.51%	290524134	0.94%	0.97%	0.05%	0.03%	272516376	137265764	13240617	4618298	501.76	224.00	0.73%	0.62%	0.98	0.000	No	0.00%				147bp	288bp	51.2%	0.0%	97.6%	86.5%	94.3%	278.4M	32.4%	97.8%	73394.9Mb	590.6M	54.8%	98.4%	62.4%
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1_1																																	137.7bp	98.1%	289.6M																84.6%	54%	151bp	151bp	18%	482.1M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1_2																																																			83.5%	54%	151bp	151bp	18%	482.1M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1_trimmed_1																																																			80.8%	54%	127bp	132bp	9%	295.3M	80.8%	54%	127bp	132bp	9%	295.3M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1_trimmed_2																																																			81.1%	55%	127bp	137bp	9%	295.3M	81.1%	55%	127bp	137bp	9%	295.3M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2	9999000000	213068140	141.8bp	133.0bp	0.00%	1.00%	0.59%	0.00%	0.01%	3.05%	0.90%	0.00%	590132312	0.01%	0.59%	241254048	0.93%	0.97%	0.05%	0.03%	224896756	113304588	11501958	3926477	416.11	180.00	0.72%	0.60%	0.98	0.000	No	0.00%				155bp	319bp	59.6%	0.0%	97.6%	87.0%	94.5%	278.7M	40.9%	97.8%	74369.7Mb	590.1M	55.0%	98.4%	59.6%
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2_1																																	141.8bp	98.1%	289.5M																86.4%	54%	151bp	151bp	18%	467.6M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2_2																																																			85.4%	54%	151bp	151bp	18%	467.6M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2_trimmed_1																																																			82.7%	54%	129bp	137bp	9%	295.1M	82.7%	54%	129bp	137bp	9%	295.1M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2_trimmed_2																																																			83.1%	55%	129bp	137bp	9%	295.1M	83.1%	55%	129bp	137bp	9%	295.1M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3	9999000000	120217839	138.8bp	129.0bp	0.00%	1.01%	0.60%	0.00%	0.01%	3.06%	0.91%	0.00%	590330844	0.01%	0.72%	164238948	0.92%	0.96%	0.06%	0.04%	150506943	75765680	9206317	3302321	267.98	111.00	0.67%	0.52%	0.98	0.000	No	0.00%				150bp	304bp	72.7%	0.0%	97.7%	87.3%	94.7%	279.4M	51.4%	97.8%	73283.7Mb	590.3M	55.1%	98.4%	62.0%
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3_1																																	138.8bp	98.1%	289.7M																88.2%	54%	151bp	151bp	18%	372.2M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3_2																																																			87.1%	55%	151bp	151bp	18%	372.2M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3_trimmed_1																																																			86.5%	54%	127bp	132bp	9%	295.2M	86.5%	54%	127bp	132bp	9%	295.2M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3_trimmed_2																																																			86.8%	55%	127bp	137bp	9%	295.2M	86.8%	55%	127bp	137bp	9%	295.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1	9999000000	195429433	124.1bp	118.0bp	0.01%	1.52%	0.50%	0.00%	0.02%	4.48%	0.76%	0.00%	440473454	0.01%	0.55%	199099293	0.93%	0.96%	0.05%	0.04%	185307707	93087965	10790546	4247635	306.13	152.00	0.72%	0.58%	0.98	0.000	Yes	0.00%				126bp	199bp	55.2%	0.0%	97.0%	87.2%	94.7%	208.6M	33.6%	97.7%	51672.1Mb	440.5M	53.8%	98.5%	73.1%
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1_1																																	124.1bp	97.9%	215.7M																79.0%	52%	151bp	151bp	18%	223.7M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1_2																																																			78.2%	54%	151bp	151bp	27%	223.7M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1_trimmed_1																																																			79.0%	53%	120bp	122bp	9%	220.2M	79.0%	53%	120bp	122bp	9%	220.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1_trimmed_2																																																			79.2%	54%	120bp	122bp	9%	220.2M	79.2%	54%	120bp	122bp	9%	220.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2	9999000000	103997269	126.4bp	119.0bp	0.01%	1.48%	0.50%	0.00%	0.01%	4.40%	0.76%	0.00%	521279578	0.01%	0.75%	129557341	0.90%	0.94%	0.07%	0.06%	116811179	58646076	9323301	3836192	187.17	88.00	0.67%	0.47%	0.98	0.000	No	0.00%				128bp	206bp	75.6%	0.0%	97.1%	87.8%	94.9%	247.3M	50.5%	97.8%	61604.1Mb	521.3M	53.8%	98.5%	72.3%
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2_1																																	126.4bp	98.0%	255.5M																86.1%	52%	151bp	151bp	18%	264.6M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2_2																																																			85.2%	53%	151bp	151bp	27%	264.6M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2_trimmed_1																																																			86.1%	53%	121bp	122bp	9%	260.6M	86.1%	53%	121bp	122bp	9%	260.6M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2_trimmed_2																																																			86.3%	54%	121bp	122bp	9%	260.6M	86.3%	54%	121bp	122bp	9%	260.6M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3	9999000000	72005608	132.1bp	125.0bp	0.00%	1.57%	0.53%	0.00%	0.01%	4.69%	0.81%	0.00%	590751894	0.01%	0.85%	89785098	0.87%	0.93%	0.09%	0.07%	78214136	39243601	7638461	3121898	127.00	58.00	0.62%	0.37%	0.98	0.000	No	0.00%				137bp	240bp	85.4%	0.0%	97.1%	88.0%	95.0%	280.5M	61.6%	97.8%	71929.5Mb	590.8M	53.7%	98.5%	68.0%
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3_1																																	132.1bp	98.1%	289.7M																90.5%	52%	151bp	151bp	18%	322.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3_2																																																			89.2%	53%	151bp	151bp	18%	322.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3_trimmed_1																																																			90.1%	53%	124bp	127bp	9%	295.4M	90.1%	53%	124bp	127bp	9%	295.4M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3_trimmed_2																																																			90.0%	54%	125bp	127bp	9%	295.4M	90.0%	54%	125bp	127bp	9%	295.4M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1	9999000000	143618224	121.6bp	117.0bp	0.01%	2.94%	0.67%	0.00%	0.02%	8.18%	1.01%	0.00%	547985064	0.01%	0.69%	168385770	0.92%	0.94%	0.07%	0.06%	154099582	77345820	10964860	4516196	239.62	109.00	0.66%	0.52%	0.98	0.000	No	0.00%				127bp	216bp	69.7%	0.0%	97.1%	87.7%	95.1%	260.5M	45.9%	97.8%	63793.5Mb	548.0M	53.3%	98.6%	75.9%
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1_1																																	121.6bp	97.9%	268.3M																85.2%	52%	151bp	151bp	18%	277.9M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1_2																																																			84.3%	53%	151bp	151bp	27%	277.9M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1_trimmed_1																																																			85.3%	53%	119bp	122bp	9%	274.0M	85.3%	53%	119bp	122bp	9%	274.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1_trimmed_2																																																			85.4%	53%	119bp	122bp	9%	274.0M	85.4%	53%	119bp	122bp	9%	274.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2	9999000000	87881136	118.0bp	112.0bp	0.01%	3.17%	0.73%	0.00%	0.01%	8.80%	1.11%	0.00%	591263808	0.01%	0.81%	109591411	0.89%	0.93%	0.08%	0.07%	97749917	48991720	8252441	3429427	145.44	62.00	0.61%	0.40%	0.98	0.000	No	0.00%				121bp	200bp	82.0%	0.0%	97.4%	87.1%	94.9%	280.6M	51.0%	97.8%	66773.7Mb	591.3M	53.8%	98.5%	78.7%
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2_1																																	118.0bp	98.2%	290.2M																89.2%	52%	151bp	151bp	18%	300.3M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2_2																																																			88.2%	53%	151bp	151bp	18%	300.3M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2_trimmed_1																																																			89.3%	53%	115bp	117bp	9%	295.6M	89.3%	53%	115bp	117bp	9%	295.6M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2_trimmed_2																																																			89.4%	54%	116bp	117bp	9%	295.6M	89.4%	54%	116bp	117bp	9%	295.6M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3	9999000000	56148976	121.8bp	115.0bp	0.01%	3.06%	0.72%	0.00%	0.01%	8.59%	1.10%	0.00%	423041866	0.01%	0.86%	60224721	0.87%	0.92%	0.09%	0.08%	52114731	26091479	5392329	2242905	78.81	32.00	0.51%	0.23%	0.98	0.000	No	0.00%				129bp	225bp	86.3%	0.0%	97.2%	87.2%	94.9%	200.8M	57.0%	97.7%	49178.8Mb	423.0M	53.8%	98.1%	75.0%
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3_1																																	121.8bp	98.1%	207.5M																90.3%	53%	151bp	151bp	18%	215.5M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3_2																																																			88.8%	54%	151bp	151bp	18%	215.5M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3_trimmed_1																																																			90.4%	53%	119bp	122bp	9%	211.5M	90.4%	53%	119bp	122bp	9%	211.5M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3_trimmed_2																																																			90.3%	54%	119bp	122bp	9%	211.5M	90.3%	54%	119bp	122bp	9%	211.5M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1	9999000000	151706651	119.9bp	115.0bp	0.01%	1.20%	0.69%	0.00%	0.02%	3.41%	0.98%	0.00%	589386616	0.01%	0.70%	179212965	0.91%	0.95%	0.06%	0.05%	163656604	82079935	11122946	4491798	252.44	121.00	0.69%	0.54%	0.98	0.000	No	0.00%				123bp	199bp	70.1%	0.0%	97.3%	86.8%	94.6%	278.7M	43.7%	97.7%	67649.5Mb	589.4M	54.6%	98.2%	77.0%
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1_1																																	119.9bp	97.7%	288.0M																84.5%	53%	151bp	151bp	18%	316.2M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1_2																																																			83.3%	54%	151bp	151bp	18%	316.2M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1_trimmed_1																																																			84.1%	54%	117bp	117bp	9%	294.7M	84.1%	54%	117bp	117bp	9%	294.7M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1_trimmed_2																																																			84.1%	54%	118bp	117bp	9%	294.7M	84.1%	54%	118bp	117bp	9%	294.7M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2	9999000000	79095447	118.2bp	113.0bp	0.01%	1.29%	0.77%	0.00%	0.01%	3.66%	1.08%	0.00%	410404990	0.01%	0.77%	96033508	0.90%	0.94%	0.07%	0.06%	86762527	43496074	6284741	2557476	130.44	58.00	0.61%	0.38%	0.98	0.000	No	0.00%				120bp	191bp	77.2%	0.0%	97.5%	86.6%	94.6%	194.1M	48.4%	97.8%	46467.5Mb	410.4M	54.9%	98.3%	78.5%
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2_1																																	118.2bp	97.9%	200.9M																85.7%	53%	151bp	151bp	18%	208.7M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2_2																																																			84.7%	54%	151bp	151bp	18%	208.7M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2_trimmed_1																																																			85.8%	54%	116bp	117bp	9%	205.2M	85.8%	54%	116bp	117bp	9%	205.2M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2_trimmed_2																																																			86.0%	55%	116bp	117bp	9%	205.2M	86.0%	55%	116bp	117bp	9%	205.2M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3	9999000000	47803888	119.9bp	114.0bp	0.01%	1.26%	0.76%	0.00%	0.01%	3.60%	1.08%	0.00%	417000160	0.01%	0.87%	54443078	0.86%	0.92%	0.09%	0.08%	46642539	23330366	4798047	2000868	68.76	29.00	0.50%	0.20%	0.98	0.000	No	0.00%				123bp	200bp	87.6%	0.0%	97.5%	86.9%	94.7%	197.4M	57.4%	97.8%	47781.5Mb	417.0M	54.9%	98.2%	77.6%
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3_1																																	119.9bp	97.9%	204.2M																90.4%	53%	151bp	151bp	18%	212.4M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3_2																																																			88.8%	54%	151bp	151bp	18%	212.4M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3_trimmed_1																																																			90.4%	54%	117bp	117bp	9%	208.5M	90.4%	54%	117bp	117bp	9%	208.5M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3_trimmed_2																																																			90.3%	55%	117bp	117bp	9%	208.5M	90.3%	55%	117bp	117bp	9%	208.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1	9999000000	324789966	136.0bp	128.0bp	0.01%	1.08%	0.55%	0.00%	0.02%	3.29%	0.81%	0.00%	590873668	0.01%	0.50%	294485956	0.94%	0.97%	0.05%	0.03%	276785479	139318948	13904717	5007813	495.64	268.00	0.77%	0.66%	0.98	0.000	Yes	0.00%				144bp	262bp	50.5%	0.0%	97.1%	89.2%	95.5%	282.0M	31.8%	97.8%	72635.7Mb	590.9M	55.1%	98.5%	64.1%
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1_1																																	136.0bp	98.0%	289.6M																83.0%	54%	151bp	151bp	18%	417.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1_2																																																			82.0%	54%	151bp	151bp	18%	417.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1_trimmed_1																																																			80.0%	54%	126bp	132bp	9%	295.4M	80.0%	54%	126bp	132bp	9%	295.4M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1_trimmed_2																																																			80.3%	55%	126bp	132bp	9%	295.4M	80.3%	55%	126bp	132bp	9%	295.4M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2	9999000000	209642233	141.0bp	131.0bp	0.00%	1.10%	0.59%	0.00%	0.01%	3.36%	0.88%	0.00%	590723420	0.01%	0.59%	240169508	0.94%	0.97%	0.05%	0.03%	224699616	113153619	11631317	4099590	404.88	213.00	0.76%	0.63%	0.98	0.000	Yes	0.00%				151bp	286bp	59.7%	0.0%	97.1%	89.3%	95.5%	282.0M	41.3%	97.7%	73764.8Mb	590.7M	55.4%	98.5%	61.3%
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2_1																																	141.0bp	98.1%	289.8M																86.0%	54%	151bp	151bp	18%	458.2M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2_2																																																			85.0%	55%	151bp	151bp	18%	458.2M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2_trimmed_1																																																			82.3%	55%	128bp	137bp	9%	295.4M	82.3%	55%	128bp	137bp	9%	295.4M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2_trimmed_2																																																			82.7%	55%	128bp	137bp	9%	295.4M	82.7%	55%	128bp	137bp	9%	295.4M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3	9999000000	131220491	138.3bp	129.0bp	0.00%	1.09%	0.60%	0.00%	0.01%	3.31%	0.89%	0.00%	589792930	0.01%	0.72%	162419091	0.92%	0.96%	0.06%	0.04%	149440271	75175386	9307890	3387525	260.43	132.00	0.71%	0.56%	0.98	0.000	No	0.00%				149bp	278bp	72.9%	0.0%	97.2%	89.4%	95.5%	281.7M	52.7%	97.7%	73134.2Mb	589.8M	55.7%	98.3%	62.7%
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3_1																																	138.3bp	98.2%	289.5M																88.9%	54%	151bp	151bp	18%	419.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3_2																																																			87.6%	55%	151bp	151bp	18%	419.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3_trimmed_1																																																			86.2%	55%	127bp	132bp	9%	294.9M	86.2%	55%	127bp	132bp	9%	294.9M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3_trimmed_2																																																			86.5%	55%	127bp	132bp	9%	294.9M	86.5%	55%	127bp	132bp	9%	294.9M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1	9999000000	232718660	133.5bp	125.0bp	0.01%	1.28%	0.64%	0.00%	0.01%	3.76%	0.93%	0.00%	589784760	0.01%	0.57%	251882319	0.93%	0.96%	0.05%	0.04%	234560736	117984651	13193180	4918980	410.38	180.00	0.72%	0.59%	0.98	0.000	No	0.00%				141bp	251bp	57.7%	0.0%	97.2%	88.1%	95.2%	280.8M	37.1%	97.7%	71781.2Mb	589.8M	56.4%	98.3%	65.9%
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1_1																																	133.5bp	97.9%	288.8M																84.3%	55%	151bp	151bp	18%	397.8M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1_2																																																			83.6%	56%	151bp	151bp	18%	397.8M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1_trimmed_1																																																			81.9%	56%	125bp	132bp	9%	294.9M	81.9%	56%	125bp	132bp	9%	294.9M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1_trimmed_2																																																			82.5%	56%	125bp	132bp	9%	294.9M	82.5%	56%	125bp	132bp	9%	294.9M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2	9999000000	142102811	133.7bp	125.0bp	0.00%	1.38%	0.70%	0.00%	0.01%	4.04%	1.00%	0.00%	590176540	0.01%	0.71%	170768984	0.92%	0.95%	0.06%	0.05%	156786279	78823491	9982021	3772388	266.31	112.00	0.67%	0.52%	0.98	0.000	No	0.00%				141bp	252bp	71.5%	0.0%	97.4%	88.2%	95.3%	281.2M	49.1%	97.7%	71624.2Mb	590.2M	56.4%	98.4%	66.7%
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2_1																																	133.7bp	98.1%	289.4M																89.6%	55%	151bp	151bp	18%	498.1M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2_2																																																			88.5%	56%	151bp	151bp	18%	498.1M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2_trimmed_1																																																			85.9%	56%	124bp	127bp	9%	295.1M	85.9%	56%	124bp	127bp	9%	295.1M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2_trimmed_2																																																			86.3%	56%	124bp	132bp	9%	295.1M	86.3%	56%	124bp	132bp	9%	295.1M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3	9999000000	104674158	135.7bp	127.0bp	0.00%	1.33%	0.69%	0.00%	0.00%	3.91%	1.01%	0.00%	588437122	0.01%	0.82%	106650624	0.89%	0.94%	0.07%	0.06%	94962977	47657850	7651508	2917886	158.74	63.00	0.61%	0.40%	0.98	0.000	No	0.00%				146bp	268bp	82.4%	0.0%	97.3%	88.4%	95.3%	280.4M	59.2%	97.5%	72190.3Mb	588.4M	56.6%	98.1%	64.4%
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3_1																																	135.7bp	98.1%	288.7M																91.0%	55%	151bp	151bp	18%	391.5M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3_2																																																			89.3%	56%	151bp	151bp	18%	391.5M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3_trimmed_1																																																			89.5%	56%	126bp	132bp	9%	294.2M	89.5%	56%	126bp	132bp	9%	294.2M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3_trimmed_2																																																			89.4%	56%	126bp	132bp	9%	294.2M	89.4%	56%	126bp	132bp	9%	294.2M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1	9999000000	599780006	191.2bp	173.0bp	0.01%	1.96%	0.84%	0.00%	0.02%	5.75%	1.19%	0.00%	590547446	0.01%	0.40%	353627217	0.94%	0.98%	0.05%	0.02%	334021284	169842305	16498024	3895257	776.13	307.00	0.72%	0.63%	0.98	0.000	Yes	62.41%				398bp	1140bp	40.3%	0.0%	97.5%	90.6%	96.1%	283.8M	31.0%	97.6%	80924.6Mb	590.5M	54.4%	98.4%	31.6%
FFPE_HD789_01_RNA_13_A23WKFTLT4_1_1																																	191.2bp	98.0%	289.2M																89.6%	53%	151bp	151bp	18%	770.1M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1_2																																																			88.8%	54%	151bp	151bp	18%	770.1M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1_trimmed_1																																																			84.3%	53%	140bp	151bp	18%	295.3M	84.3%	53%	140bp	151bp	18%	295.3M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1_trimmed_2																																																			85.1%	54%	140bp	151bp	9%	295.3M	85.1%	54%	140bp	151bp	9%	295.3M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1	9999000000	251822763	169.8bp	155.0bp	0.00%	2.13%	1.44%	0.00%	0.01%	5.79%	1.98%	0.00%	590471534	0.01%	0.56%	261140768	0.93%	0.97%	0.06%	0.03%	242083689	123069715	14583268	4102682	516.78	124.00	0.59%	0.52%	0.98	0.000	No	0.00%				249bp	646bp	56.2%	0.0%	96.5%	88.7%	95.3%	281.5M	43.1%	97.6%	78997.6Mb	590.5M	54.9%	98.4%	39.8%
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1_1																																	169.8bp	96.7%	285.5M																89.6%	53%	151bp	151bp	18%	489.4M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1_2																																																			88.8%	55%	151bp	151bp	18%	489.4M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1_trimmed_1																																																			86.6%	54%	137bp	151bp	9%	295.2M	86.6%	54%	137bp	151bp	9%	295.2M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1_trimmed_2																																																			87.3%	55%	137bp	151bp	9%	295.2M	87.3%	55%	137bp	151bp	9%	295.2M
NTC_0001_0001_A23WKFTLT4_1	9999000000	1202	141.0bp	133.0bp	0.49%	0.31%	0.00%	0.00%	0.35%	1.19%	0.00%	0.00%	2660	0.50%	0.28%	1920	0.09%	0.30%	0.22%	0.70%	164	86	421	197	0.00	0.00	0.00%	0.00%	0.95	0.000	Skipped	N/A%				80bp	122bp	55.8%	0.0%	57.8%	8.3%	24.4%	0.0M	41.3%	87.9%	0.3Mb	0.0M	69.5%	3.1%	50.0%
NTC_0001_0001_A23WKFTLT4_1_1																																	141.0bp	25.3%	0.0M																97.1%	74%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23WKFTLT4_1_2																																																			93.1%	97%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23WKFTLT4_1_trimmed_1																																																			47.8%	65%	112bp	142bp	36%	0.0M	47.8%	65%	112bp	142bp	36%	0.0M
NTC_0001_0001_A23WKFTLT4_1_trimmed_2																																																			53.3%	73%	113bp	151bp	55%	0.0M	53.3%	73%	113bp	151bp	55%	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1	355.4M	0.0M	0.0M	35.2M	2.5M	304.5M	152.4M	152.1M	152.3M	152.2M	188.1M	116.4M	302.9M	0.0M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2	186.9M	0.0M	0.0M	19.0M	1.5M	159.3M	79.7M	79.6M	79.7M	79.6M	98.3M	61.0M	158.4M	0.0M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3	84.7M	0.0M	0.0M	8.5M	0.6M	72.4M	36.2M	36.2M	36.2M	36.2M	44.1M	28.2M	72.0M	0.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1	644.8M	0.0M	0.0M	50.8M	3.3M	569.9M	285.1M	284.8M	285.0M	284.9M	322.3M	247.6M	567.7M	0.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2	633.2M	0.0M	0.0M	48.1M	3.2M	562.2M	281.2M	281.0M	281.2M	281.0M	306.1M	256.1M	559.7M	0.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3	562.9M	0.0M	0.0M	43.3M	2.8M	499.0M	249.6M	249.4M	249.6M	249.5M	273.7M	225.4M	496.9M	0.0M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1	632.9M	0.0M	0.0M	52.4M	3.9M	556.1M	278.3M	277.8M	278.1M	278.0M	342.2M	213.8M	553.8M	0.0M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2	493.4M	0.0M	0.0M	42.5M	3.2M	431.3M	215.8M	215.5M	215.7M	215.6M	266.2M	165.1M	429.6M	0.0M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3	357.7M	0.0M	0.0M	28.8M	2.3M	315.0M	157.6M	157.4M	157.5M	157.5M	186.8M	128.3M	313.8M	0.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1	590.0M	0.0M	0.0M	49.5M	3.9M	516.4M	258.4M	258.0M	258.3M	258.1M	292.7M	223.7M	514.0M	0.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2	443.2M	0.0M	0.0M	35.8M	3.0M	389.8M	195.0M	194.8M	195.0M	194.8M	215.4M	174.4M	387.9M	0.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3	599.7M	0.0M	0.0M	49.3M	3.9M	526.2M	263.2M	262.9M	263.2M	263.0M	290.4M	235.7M	523.7M	0.0M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1	468.0M	0.0M	0.0M	40.4M	3.1M	408.2M	204.2M	203.9M	204.2M	204.0M	234.0M	174.1M	406.3M	0.0M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2	480.6M	0.0M	0.0M	41.4M	3.1M	419.3M	209.8M	209.5M	209.7M	209.6M	243.2M	176.1M	417.3M	0.0M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3	330.3M	0.0M	0.0M	28.3M	2.2M	288.3M	144.2M	144.1M	144.2M	144.1M	161.4M	126.9M	286.9M	0.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1	584.3M	0.0M	0.0M	49.5M	3.8M	510.8M	255.6M	255.2M	255.5M	255.3M	298.2M	212.5M	508.6M	0.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2	563.3M	0.0M	0.0M	46.8M	3.8M	493.7M	247.0M	246.7M	247.0M	246.7M	278.0M	215.7M	491.3M	0.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3	435.2M	0.0M	0.0M	38.6M	3.0M	378.2M	189.2M	189.0M	189.2M	189.0M	217.8M	160.4M	376.4M	0.0M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1	636.5M	0.0M	0.0M	42.1M	3.8M	572.6M	286.5M	286.1M	286.4M	286.2M	296.9M	275.7M	570.3M	0.0M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2	633.3M	0.0M	0.0M	41.2M	3.8M	570.6M	285.5M	285.1M	285.4M	285.2M	292.7M	277.8M	568.4M	0.0M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3	631.4M	0.0M	0.0M	39.5M	3.9M	570.8M	285.6M	285.2M	285.5M	285.3M	282.5M	288.3M	568.4M	0.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1	580.2M	0.0M	0.0M	43.1M	3.8M	515.9M	258.2M	257.7M	258.0M	257.8M	278.9M	236.9M	513.8M	0.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2	580.5M	0.0M	0.0M	44.5M	3.8M	514.5M	257.5M	257.0M	257.3M	257.1M	277.8M	236.6M	512.5M	0.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3	411.0M	0.0M	0.0M	30.7M	2.7M	365.2M	182.7M	182.4M	182.6M	182.5M	194.5M	170.6M	363.8M	0.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1	597.4M	0.0M	0.0M	50.9M	4.3M	522.3M	261.3M	260.9M	261.2M	261.1M	281.2M	241.0M	520.1M	0.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2	647.2M	0.0M	0.0M	54.3M	4.5M	566.9M	283.6M	283.3M	283.5M	283.4M	303.5M	263.3M	564.7M	0.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3	509.1M	0.0M	0.0M	44.9M	3.6M	442.8M	221.5M	221.3M	221.5M	221.3M	239.0M	203.8M	441.1M	0.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1	641.9M	0.0M	0.0M	47.7M	3.6M	569.1M	284.8M	284.3M	284.6M	284.5M	287.0M	282.1M	566.9M	0.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2	640.5M	0.0M	0.0M	47.1M	3.7M	568.4M	284.4M	284.0M	284.3M	284.1M	284.3M	284.2M	566.3M	0.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3	639.7M	0.0M	0.0M	47.4M	3.6M	567.4M	283.9M	283.5M	283.8M	283.6M	282.4M	285.0M	565.4M	0.0M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1	180.6M	0.0M	0.0M	13.4M	1.1M	160.5M	80.3M	80.2M	80.2M	80.2M	88.3M	72.2M	159.8M	0.0M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2	640.2M	0.0M	0.0M	47.3M	4.0M	568.4M	284.3M	284.0M	284.2M	284.1M	312.1M	256.3M	566.2M	0.0M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3	640.0M	0.0M	0.0M	47.1M	3.8M	568.4M	284.4M	284.1M	284.3M	284.2M	312.8M	255.6M	566.4M	0.0M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1	70.0M	0.0M	0.0M	12.8M	1.0M	51.3M	25.7M	25.7M	25.7M	25.7M	34.4M	16.9M	51.1M	0.0M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2	146.9M	0.0M	0.0M	23.5M	1.7M	112.2M	56.2M	56.1M	56.1M	56.1M	74.1M	38.1M	111.6M	0.0M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3	101.3M	0.0M	0.0M	14.6M	1.1M	79.6M	39.8M	39.8M	39.8M	39.8M	51.4M	28.3M	79.2M	0.0M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1	652.8M	0.0M	0.0M	58.9M	3.8M	565.5M	282.9M	282.6M	282.9M	282.6M	322.9M	242.6M	562.8M	0.0M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2	652.8M	0.0M	0.0M	58.8M	4.0M	565.7M	283.0M	282.7M	283.0M	282.7M	314.8M	250.9M	562.9M	0.0M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3	463.4M	0.0M	0.0M	40.8M	2.7M	402.8M	201.5M	201.3M	201.5M	201.3M	221.0M	181.9M	400.9M	0.0M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1	634.7M	0.0M	0.0M	53.8M	4.9M	553.7M	277.0M	276.8M	276.9M	276.8M	324.7M	229.0M	552.0M	0.0M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2	513.1M	0.0M	0.0M	44.4M	4.2M	446.4M	223.3M	223.1M	223.2M	223.1M	259.4M	187.0M	444.6M	0.0M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3	359.8M	0.0M	0.0M	31.6M	3.1M	312.5M	156.3M	156.2M	156.3M	156.2M	178.7M	133.8M	311.2M	0.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1	654.8M	0.0M	0.0M	64.6M	6.3M	560.1M	280.3M	279.8M	280.1M	280.0M	348.8M	211.4M	558.0M	0.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2	623.2M	0.0M	0.0M	59.0M	5.8M	535.8M	268.1M	267.7M	268.0M	267.9M	329.7M	206.2M	533.8M	0.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3	378.9M	0.0M	0.0M	36.9M	3.9M	324.2M	162.2M	162.0M	162.1M	162.1M	198.4M	125.8M	323.1M	0.0M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1	436.4M	0.0M	0.0M	35.3M	2.6M	384.2M	192.3M	192.0M	192.2M	192.0M	221.8M	162.4M	382.6M	0.0M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2	592.1M	0.0M	0.0M	49.0M	3.4M	520.0M	260.2M	259.8M	260.1M	259.9M	298.0M	222.0M	517.8M	0.0M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3	462.9M	0.0M	0.0M	38.9M	2.6M	405.7M	203.0M	202.7M	202.9M	202.8M	235.5M	170.2M	404.0M	0.0M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1	653.3M	0.0M	0.0M	60.3M	4.2M	563.4M	281.9M	281.4M	281.8M	281.6M	306.8M	256.6M	560.7M	0.0M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2	649.4M	0.0M	0.0M	57.6M	4.1M	563.1M	281.8M	281.4M	281.6M	281.5M	303.6M	259.6M	560.5M	0.0M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3	399.3M	0.0M	0.0M	37.6M	2.5M	343.2M	171.7M	171.5M	171.7M	171.5M	187.3M	155.9M	341.7M	0.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1	644.4M	0.0M	0.0M	52.4M	3.9M	566.2M	283.4M	282.9M	283.3M	283.0M	286.4M	279.8M	563.7M	0.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2	642.0M	0.0M	0.0M	48.2M	4.0M	569.5M	285.0M	284.5M	284.9M	284.6M	273.9M	295.6M	567.0M	0.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3	641.6M	0.0M	0.0M	48.3M	4.0M	569.0M	284.7M	284.3M	284.6M	284.4M	266.8M	302.2M	566.6M	0.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1	664.1M	0.0M	0.0M	73.0M	5.3M	555.5M	278.0M	277.6M	277.8M	277.7M	327.6M	228.0M	553.1M	0.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2	552.9M	0.0M	0.0M	57.0M	4.3M	467.8M	234.0M	233.8M	233.9M	233.9M	270.2M	197.6M	465.8M	0.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3	391.0M	0.0M	0.0M	42.4M	3.1M	327.9M	164.0M	163.9M	164.0M	163.9M	191.0M	136.9M	326.6M	0.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1	658.5M	0.0M	0.0M	65.0M	4.9M	560.4M	280.4M	280.0M	280.3M	280.1M	285.4M	275.0M	558.3M	0.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2	657.5M	0.0M	0.0M	64.3M	4.7M	560.7M	280.5M	280.1M	280.4M	280.3M	284.9M	275.8M	558.6M	0.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3	657.5M	0.0M	0.0M	65.5M	5.0M	558.5M	279.4M	279.1M	279.3M	279.2M	280.3M	278.3M	556.5M	0.0M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1	650.1M	0.0M	0.0M	57.9M	5.1M	564.3M	282.4M	281.9M	282.2M	282.1M	316.1M	248.2M	562.0M	0.0M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2	649.3M	0.0M	0.0M	58.1M	4.9M	563.2M	281.8M	281.4M	281.7M	281.5M	318.2M	245.0M	561.0M	0.0M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3	382.3M	0.0M	0.0M	34.9M	2.9M	330.7M	165.5M	165.2M	165.4M	165.3M	183.5M	147.2M	329.5M	0.0M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1	659.4M	0.0M	0.0M	66.3M	3.9M	561.3M	280.9M	280.5M	280.7M	280.6M	302.4M	258.9M	559.0M	0.0M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2	653.5M	0.0M	0.0M	61.2M	3.7M	562.4M	281.4M	281.1M	281.3M	281.2M	295.8M	266.7M	560.2M	0.0M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3	654.9M	0.0M	0.0M	62.0M	3.8M	562.5M	281.4M	281.1M	281.3M	281.2M	293.5M	269.0M	560.4M	0.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1	644.6M	0.0M	0.0M	50.6M	3.7M	568.3M	284.3M	284.0M	284.2M	284.1M	324.4M	244.0M	565.8M	0.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2	169.8M	0.0M	0.0M	22.8M	1.8M	137.9M	69.0M	68.9M	68.9M	68.9M	86.2M	51.7M	137.2M	0.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3	595.9M	0.0M	0.0M	46.3M	3.4M	526.1M	263.1M	262.9M	263.1M	263.0M	296.0M	230.1M	523.6M	0.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1	631.9M	0.0M	0.0M	38.9M	3.7M	571.0M	285.7M	285.4M	285.6M	285.5M	303.1M	267.9M	568.7M	0.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2	631.7M	0.0M	0.0M	40.8M	3.7M	567.7M	284.0M	283.7M	283.9M	283.8M	307.4M	260.4M	565.5M	0.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3	533.0M	0.0M	0.0M	32.8M	3.0M	481.3M	240.7M	240.6M	240.7M	240.6M	255.7M	225.7M	479.5M	0.0M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1	33.2M	0.0M	0.0M	4.8M	0.3M	26.5M	13.3M	13.3M	13.3M	13.3M	17.6M	8.9M	26.4M	0.0M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2	44.4M	0.0M	0.0M	5.5M	0.3M	36.5M	18.3M	18.2M	18.3M	18.3M	23.7M	12.9M	36.3M	0.0M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3	32.5M	0.0M	0.0M	3.7M	0.2M	27.1M	13.6M	13.6M	13.6M	13.6M	17.2M	10.0M	27.0M	0.0M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1	648.7M	0.0M	0.0M	55.2M	4.8M	563.1M	281.8M	281.4M	281.6M	281.5M	299.9M	263.3M	560.9M	0.0M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2	645.4M	0.0M	0.0M	52.5M	4.9M	563.6M	282.0M	281.7M	281.9M	281.8M	294.8M	268.8M	561.4M	0.0M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3	644.1M	0.0M	0.0M	51.2M	4.5M	564.5M	282.4M	282.1M	282.3M	282.2M	297.9M	266.5M	562.4M	0.0M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1	482.7M	0.0M	0.0M	39.7M	3.0M	422.8M	211.6M	211.2M	211.4M	211.3M	242.8M	180.0M	420.8M	0.0M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2	568.3M	0.0M	0.0M	44.3M	3.4M	501.0M	250.7M	250.3M	250.5M	250.4M	286.4M	214.6M	498.7M	0.0M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3	643.2M	0.0M	0.0M	49.3M	3.9M	568.4M	284.4M	284.0M	284.3M	284.1M	313.1M	255.2M	565.8M	0.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1	599.0M	0.0M	0.0M	48.1M	3.3M	527.8M	264.1M	263.7M	264.0M	263.8M	290.2M	237.6M	525.4M	0.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2	649.3M	0.0M	0.0M	54.9M	3.6M	568.2M	284.3M	283.9M	284.2M	284.0M	318.4M	249.8M	565.7M	0.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3	464.2M	0.0M	0.0M	38.9M	2.7M	406.7M	203.5M	203.2M	203.4M	203.3M	222.1M	184.5M	404.9M	0.0M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1	648.5M	0.0M	0.0M	55.5M	4.4M	565.4M	282.9M	282.5M	282.8M	282.6M	318.9M	246.5M	562.5M	0.0M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2	452.3M	0.0M	0.0M	39.5M	3.0M	393.4M	196.8M	196.6M	196.8M	196.6M	223.6M	169.8M	391.5M	0.0M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3	458.1M	0.0M	0.0M	38.8M	3.0M	399.9M	200.1M	199.9M	200.0M	199.9M	224.3M	175.6M	398.1M	0.0M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1	637.1M	0.0M	0.0M	43.3M	3.8M	570.9M	285.6M	285.3M	285.5M	285.4M	314.8M	256.1M	568.4M	0.0M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2	636.5M	0.0M	0.0M	42.9M	3.8M	570.9M	285.6M	285.3M	285.5M	285.4M	308.9M	262.0M	568.4M	0.0M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3	635.1M	0.0M	0.0M	42.6M	3.7M	569.8M	285.1M	284.8M	285.0M	284.8M	309.8M	260.0M	567.5M	0.0M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1	641.7M	0.0M	0.0M	49.2M	4.1M	567.8M	284.1M	283.7M	284.0M	283.9M	314.1M	253.8M	565.6M	0.0M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2	641.9M	0.0M	0.0M	49.2M	4.0M	568.0M	284.2M	283.8M	284.1M	283.9M	312.1M	255.9M	566.0M	0.0M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3	638.7M	0.0M	0.0M	47.8M	4.0M	566.5M	283.4M	283.1M	283.3M	283.2M	307.5M	259.0M	564.4M	0.0M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1	629.4M	0.0M	0.0M	37.0M	3.1M	572.1M	286.2M	286.0M	286.1M	286.0M	252.7M	319.4M	570.3M	0.0M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1	638.1M	0.0M	0.0M	45.4M	4.5M	568.1M	284.2M	283.9M	284.1M	284.0M	274.3M	293.8M	566.2M	0.0M
NTC_0001_0001_A23WKFTLT4_1	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	328053922	0.3199%
GATCGGAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGGGG	2	120	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	12	0.0000%
CTGAAATTGTCAGGTATGTTGCCATCTCTGTCTTGTTTTTCTTCATGCTG	2	13	0.0000%
GGCCCACTCAGGGTCCGGGACAGGCATACTCATCGGACCAGTCGGAGCAG	2	12	0.0000%
CCGACCACCCTCTCCCCACAGACCCCGGTGCTGCTGACACCCAGCTCGCT	2	11	0.0000%
GAAACAGTCAGAGAGACAATCTCTTGCAGCCAGATGCCAGCTTTCTCAGA	2	12	0.0000%
CGCACTTCACCTCCCAGCCTCCGTACTGCTTGGCTTCCCCATCCCGGATG	2	8	0.0000%
CTGATACTTAACATCCTAACACCTCTAGTGGGTCACTGGGTCATACCGCG	2	9	0.0000%
AGGAGCTCCAGGAGATCACTGGGTAGAGACCACACATGGGGAGAGTTCGA	2	7	0.0000%
CCTGGGTGGTGGCGCTGTCCTTCAACCTTCTTCAAGTACTGCGACTGTAT	2	13	0.0000%
GGCAGCGCCATGTCCTCATGGAATCTACAGGGCCTGCAGGGCATTGCCCT	2	9	0.0000%
GGAAGGAGAGCTTGGCCGGGCTACGGGGCGCAATGGGACTCAGGGTGCTC	2	11	0.0000%
AGCGACTCAAGCTCTGGGTCTGCTGCCTGTGCCTCGGGCCTGCCCACGGA	2	5	0.0000%
CCCGGGCCTGCAAGATGAGGGTCCCGCAGAAGAGTGTGTGACGCCTATGA	2	5	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	6	0.0000%
CTTACTTCTGTGCGGCCAGGCGGCTTTGCTGCTGGGGAATTTACTTCTGC	2	5	0.0000%
GTTTTCTAGAAAATGATTCAGGAAGTAATGCACTCCCTGGTGAAGCTTAC	2	8	0.0000%
GGGTCCCGCAGAAGAGTGTGTGACGCCTATGAGTTTCAGCACAATACGGC	2	4	0.0000%
GGAGAGAGCATTCCAGTGCTGAAGACGGCACTGCCGGAGGGGCTGGGGCC	2	4	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	137184020	0.3008%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	12	0.0000%
CTGAAATTGTCAGGTATGTTGCCATCTCTGTCTTGTTTTTCTTCATGCTG	2	13	0.0000%
GGCCCACTCAGGGTCCGGGACAGGCATACTCATCGGACCAGTCGGAGCAG	2	12	0.0000%
CCGACCACCCTCTCCCCACAGACCCCGGTGCTGCTGACACCCAGCTCGCT	2	11	0.0000%
GAAACAGTCAGAGAGACAATCTCTTGCAGCCAGATGCCAGCTTTCTCAGA	2	12	0.0000%
CGCACTTCACCTCCCAGCCTCCGTACTGCTTGGCTTCCCCATCCCGGATG	2	8	0.0000%
CTGATACTTAACATCCTAACACCTCTAGTGGGTCACTGGGTCATACCGCG	2	9	0.0000%
AGGAGCTCCAGGAGATCACTGGGTAGAGACCACACATGGGGAGAGTTCGA	2	7	0.0000%
CCTGGGTGGTGGCGCTGTCCTTCAACCTTCTTCAAGTACTGCGACTGTAT	2	13	0.0000%
GGCAGCGCCATGTCCTCATGGAATCTACAGGGCCTGCAGGGCATTGCCCT	2	9	0.0000%
GGAAGGAGAGCTTGGCCGGGCTACGGGGCGCAATGGGACTCAGGGTGCTC	2	11	0.0000%
AGCGACTCAAGCTCTGGGTCTGCTGCCTGTGCCTCGGGCCTGCCCACGGA	2	5	0.0000%
CCCGGGCCTGCAAGATGAGGGTCCCGCAGAAGAGTGTGTGACGCCTATGA	2	5	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	6	0.0000%
CTTACTTCTGTGCGGCCAGGCGGCTTTGCTGCTGGGGAATTTACTTCTGC	2	5	0.0000%
GTTTTCTAGAAAATGATTCAGGAAGTAATGCACTCCCTGGTGAAGCTTAC	2	8	0.0000%
GGGTCCCGCAGAAGAGTGTGTGACGCCTATGAGTTTCAGCACAATACGGC	2	4	0.0000%
GGAGAGAGCATTCCAGTGCTGAAGACGGCACTGCCGGAGGGGCTGGGGCC	2	4	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	4	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__2cae617--20260515-145204' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0012_exp0013-2cae617 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0033_A23WKFTLT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0033_A23WKFTLT4/bclconvert_samplesheet_8bpIndex_correctSampleIDs.csv' --flowcell_id 20260428_LH00995_0033_A23WKFTLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__2cae617--20260515-145204'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0012_exp0013-2cae617
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__2cae617--20260515-145204
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0033_A23WKFTLT4/
flowcell_id: 20260428_LH00995_0033_A23WKFTLT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0033_A23WKFTLT4/bclconvert_samplesheet_8bpIndex_correctSampleIDs.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks