Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 42654
total bases: 6440754
Q20 bases: 5503848(85.4535%)
Q30 bases: 4067124(63.1467%)

Read2 before filtering:
total reads: 42654
total bases: 6440754
Q20 bases: 6012367(93.3488%)
Q30 bases: 4702832(73.0168%)

Read1 after filtering:
total reads: 1330
total bases: 148558
Q20 bases: 140438(94.5341%)
Q30 bases: 126436(85.1088%)

Read2 after filtering:
total reads: 1330
total bases: 150283
Q20 bases: 147301(98.0157%)
Q30 bases: 136209(90.635%)

Filtering result:
reads passed filter: 2660
reads failed due to low quality: 4588
reads failed due to too many N: 0
reads failed due to too short: 78060
reads with adapter trimmed: 42678
bases trimmed due to adapters: 6168192

Duplication rate: 41.3068%

Insert size peak (evaluated by paired-end reads): 36

JSON report: NTC_0001_0001_A23WKFTLT4_1.fastp.json
HTML report: NTC_0001_0001_A23WKFTLT4_1.fastp.html

fastp --in1 NTC_0001_0001_A23WKFTLT4_1_1.fastq.gz --in2 NTC_0001_0001_A23WKFTLT4_1_2.fastq.gz --out1 NTC_0001_0001_A23WKFTLT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_A23WKFTLT4_1_2.fastp.fastq.gz --json NTC_0001_0001_A23WKFTLT4_1.fastp.json --html NTC_0001_0001_A23WKFTLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1 seconds