File Info

Filename
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3.fastp.log
Size
1.6 KB
Published
Jun 08, 2026 12:23 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 38711960
total bases: 5845505960
Q20 bases: 5692053433(97.3749%)
Q30 bases: 5476080196(93.6802%)

Read2 before filtering:
total reads: 38711960
total bases: 5845505960
Q20 bases: 5716510271(97.7933%)
Q30 bases: 5484541679(93.8249%)

Read1 after filtering:
total reads: 37882833
total bases: 4375606899
Q20 bases: 4360251453(99.6491%)
Q30 bases: 4287934940(97.9963%)

Read2 after filtering:
total reads: 37882833
total bases: 4385760987
Q20 bases: 4357923465(99.3653%)
Q30 bases: 4263731229(97.2176%)

Filtering result:
reads passed filter: 75765666
reads failed due to low quality: 1478488
reads failed due to too many N: 6044
reads failed due to too short: 173722
reads with adapter trimmed: 61141196
bases trimmed due to adapters: 2713183851

Duplication rate: 49.5926%

Insert size peak (evaluated by paired-end reads): 107

JSON report: BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3.fastp.json
HTML report: BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3.fastp.html

fastp --in1 BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_1.fastq.gz --in2 BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_2.fastq.gz --out1 BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_1.fastp.fastq.gz --out2 BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_2.fastp.fastq.gz --json BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3.fastp.json --html BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 67 seconds