File Info

Filename
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3.fastp.log
Size
1.6 KB
Published
Jun 08, 2026 12:23 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 43893420
total bases: 6627906420
Q20 bases: 6377670331(96.2245%)
Q30 bases: 6029840867(90.9766%)

Read2 before filtering:
total reads: 43893420
total bases: 6627906420
Q20 bases: 6491905894(97.9481%)
Q30 bases: 6215164012(93.7727%)

Read1 after filtering:
total reads: 43072207
total bases: 4439993655
Q20 bases: 4425003248(99.6624%)
Q30 bases: 4353227210(98.0458%)

Read2 after filtering:
total reads: 43072207
total bases: 4452348194
Q20 bases: 4430035327(99.4989%)
Q30 bases: 4347926987(97.6547%)

Filtering result:
reads passed filter: 86144414
reads failed due to low quality: 1160272
reads failed due to too many N: 5848
reads failed due to too short: 476306
reads with adapter trimmed: 78763928
bases trimmed due to adapters: 4156457887

Duplication rate: 45.312%

Insert size peak (evaluated by paired-end reads): 96

JSON report: BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3.fastp.json
HTML report: BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3.fastp.html

fastp --in1 BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_1.fastq.gz --in2 BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_2.fastq.gz --out1 BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_1.fastp.fastq.gz --out2 BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_2.fastp.fastq.gz --json BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3.fastp.json --html BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 105 seconds