File Info

Filename
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1.fastp.log
Size
1.6 KB
Published
Jun 08, 2026 12:23 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 29081498
total bases: 4391306198
Q20 bases: 4224299503(96.1969%)
Q30 bases: 3981906131(90.677%)

Read2 before filtering:
total reads: 29081498
total bases: 4391306198
Q20 bases: 4302210456(97.9711%)
Q30 bases: 4115463793(93.7184%)

Read1 after filtering:
total reads: 28414893
total bases: 2899019427
Q20 bases: 2888535800(99.6384%)
Q30 bases: 2839723014(97.9546%)

Read2 after filtering:
total reads: 28414893
total bases: 2907391550
Q20 bases: 2892321600(99.4817%)
Q30 bases: 2837207728(97.586%)

Filtering result:
reads passed filter: 56829786
reads failed due to low quality: 712190
reads failed due to too many N: 3602
reads failed due to too short: 617418
reads with adapter trimmed: 52295687
bases trimmed due to adapters: 2805784964

Duplication rate: 41.0088%

Insert size peak (evaluated by paired-end reads): 98

JSON report: BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1.fastp.json
HTML report: BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1.fastp.html

fastp --in1 BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_1.fastq.gz --in2 BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_2.fastq.gz --out1 BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_1.fastp.fastq.gz --out2 BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_2.fastp.fastq.gz --json BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1.fastp.json --html BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 55 seconds