MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-08, 13:49 UTC based on data in: /tmp/nxf.zNSQWm03vn

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₁ columns.

Sample Name	Unique Reads	Frac Antisense	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	ChrY Signature Score	RNA contaminated	RNA contamination %	Total Reads	Expected Distinct	Frag Length	% Aligned	M Aligned	Duplication	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1	304512094	0.8741	318244238	0.01%	0.83%	53577480	0.85%	0.91%	0.10%	0.09%	45625020	22830837	5431385	2364115	63.42	22.00	0.44%	0.17%	0.98	0.000	116.5bp	112.0bp	0.04%	1.23%	0.49%	0.00%	0.08%	3.37%	0.69%	0.00%	5.84	No	0.00%	9999000000	50089719				83.8%	85.2%	94.3%	150.0M	52.9%	97.7%	35676.2Mb	318.2M	57.9%	98.0%	80.8%
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1_1																																				116.5bp	97.6%	155.2M												87.4%	55%	151bp	151bp	18%	162.4M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1_2																																																		85.5%	56%	151bp	151bp	18%	162.4M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1_trimmed_1																																																		87.4%	57%	115bp	117bp	9%	159.1M	87.4%	57%	115bp	117bp	9%	159.1M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1_trimmed_2																																																		87.0%	58%	115bp	117bp	9%	159.1M	87.0%	58%	115bp	117bp	9%	159.1M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2	159284970	0.9259	166770518	0.01%	0.84%	27393534	0.84%	0.90%	0.11%	0.10%	22937277	11468224	2995342	1298063	32.42	11.00	0.28%	0.07%	0.98	0.000	117.2bp	113.0bp	0.04%	1.17%	0.48%	0.00%	0.07%	3.23%	0.69%	0.00%	5.83	No	0.00%	9999000000	26354030				84.3%	84.8%	94.1%	78.5M	57.2%	97.6%	18781.5Mb	166.8M	58.4%	96.9%	79.0%
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2_1																																				117.2bp	97.3%	81.2M												86.5%	56%	151bp	151bp	18%	86.0M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2_2																																																		84.3%	57%	151bp	151bp	36%	86.0M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2_trimmed_1																																																		86.4%	58%	115bp	117bp	9%	83.4M	86.4%	58%	115bp	117bp	9%	83.4M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2_trimmed_2																																																		86.2%	58%	116bp	117bp	9%	83.4M	86.2%	58%	116bp	117bp	9%	83.4M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3	72361381	0.9573	75765666	0.01%	0.80%	15439260	0.88%	0.93%	0.08%	0.07%	13568684	6802526	1248426	521540	21.26	7.00	0.19%	0.03%	0.98	0.000	119.0bp	114.0bp	0.02%	1.21%	0.55%	0.00%	0.04%	3.37%	0.78%	0.00%	5.80	Yes	1.91%	9999000000	24665572				80.3%	85.0%	94.2%	35.7M	49.6%	97.6%	8551.7Mb	75.8M	58.4%	97.9%	79.0%
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_1																																				119.0bp	97.7%	37.0M												83.3%	56%	151bp	151bp	18%	38.7M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_2																																																		81.6%	57%	151bp	151bp	18%	38.7M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_trimmed_1																																																		83.3%	58%	115bp	117bp	9%	37.9M	83.3%	58%	115bp	117bp	9%	37.9M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3_trimmed_2																																																		83.1%	58%	116bp	117bp	9%	37.9M	83.1%	58%	116bp	117bp	9%	37.9M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1	569901108	0.9141	591215380	0.01%	0.62%	224453032	0.93%	0.95%	0.06%	0.05%	208094815	104659559	13049303	5073517	334.02	132.00	0.66%	0.54%	0.98	0.000	122.1bp	115.0bp	0.01%	1.97%	0.62%	0.00%	0.03%	5.14%	0.86%	0.00%	6.09	No	0.00%	9999000000	196375350				62.4%	88.0%	95.3%	281.8M	37.3%	97.8%	67850.5Mb	591.2M	54.1%	98.5%	75.1%
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1_1																																				122.1bp	98.1%	289.9M												84.6%	52%	151bp	151bp	18%	329.9M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1_2																																																		83.4%	53%	151bp	151bp	18%	329.9M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1_trimmed_1																																																		83.8%	53%	117bp	117bp	9%	295.6M	83.8%	53%	117bp	117bp	9%	295.6M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1_trimmed_2																																																		83.7%	54%	117bp	117bp	9%	295.6M	83.7%	54%	117bp	117bp	9%	295.6M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2	562205613	0.9325	582065066	0.01%	0.66%	198791869	0.92%	0.95%	0.06%	0.05%	183386277	92276884	12190094	4689548	303.40	119.00	0.65%	0.53%	0.98	0.000	128.6bp	121.0bp	0.01%	1.89%	0.62%	0.00%	0.02%	4.98%	0.87%	0.00%	6.25	No	0.00%	9999000000	163403224				66.2%	88.4%	95.4%	277.6M	44.0%	97.8%	69445.0Mb	582.1M	53.6%	98.5%	70.3%
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2_1																																				128.6bp	98.0%	285.3M												84.6%	52%	151bp	151bp	18%	295.6M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2_2																																																		83.5%	53%	151bp	151bp	18%	295.6M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2_trimmed_1																																																		84.7%	53%	122bp	127bp	9%	291.0M	84.7%	53%	122bp	127bp	9%	291.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2_trimmed_2																																																		84.8%	53%	122bp	127bp	9%	291.0M	84.8%	53%	122bp	127bp	9%	291.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3	499023555	0.9495	517037680	0.01%	0.75%	131172417	0.91%	0.95%	0.07%	0.05%	119837393	60249590	8532687	3305079	191.49	71.00	0.61%	0.44%	0.98	0.000	127.4bp	120.0bp	0.01%	1.97%	0.68%	0.00%	0.01%	5.16%	0.95%	0.00%	6.20	No	0.00%	9999000000	101040571				75.0%	88.3%	95.4%	246.6M	50.7%	97.9%	61202.0Mb	517.0M	54.2%	98.5%	71.4%
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3_1																																				127.4bp	98.2%	253.8M												87.0%	53%	151bp	151bp	18%	262.5M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3_2																																																		85.9%	54%	151bp	151bp	18%	262.5M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3_trimmed_1																																																		87.0%	53%	121bp	122bp	9%	258.5M	87.0%	53%	121bp	122bp	9%	258.5M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3_trimmed_2																																																		87.2%	54%	121bp	122bp	9%	258.5M	87.2%	54%	121bp	122bp	9%	258.5M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1	556058394	0.9208	577783726	0.01%	0.76%	138015166	0.89%	0.93%	0.08%	0.07%	123287855	61786010	10799242	4563821	190.47	79.00	0.65%	0.45%	0.98	0.000	121.0bp	115.0bp	0.00%	0.70%	0.40%	0.00%	0.01%	2.26%	0.63%	0.00%	5.41	No	0.00%	9999000000	116868432				76.6%	87.5%	95.1%	274.8M	52.3%	97.7%	66805.3Mb	577.8M	57.2%	98.2%	75.7%
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1_1																																				121.0bp	98.0%	283.0M												87.0%	55%	151bp	151bp	18%	294.1M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1_2																																																		85.6%	56%	151bp	151bp	18%	294.1M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1_trimmed_1																																																		87.1%	57%	118bp	122bp	9%	288.9M	87.1%	57%	118bp	122bp	9%	288.9M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1_trimmed_2																																																		87.0%	57%	118bp	122bp	9%	288.9M	87.0%	57%	118bp	122bp	9%	288.9M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2	431265260	0.9397	448881600	0.01%	0.83%	75417787	0.87%	0.92%	0.09%	0.08%	65500998	32780179	6742906	2849341	99.37	39.00	0.55%	0.28%	0.98	0.000	122.4bp	116.0bp	0.00%	0.74%	0.42%	0.00%	0.00%	2.41%	0.68%	0.00%	5.39	No	0.00%	9999000000	64263826				83.8%	87.1%	95.0%	213.3M	58.3%	97.7%	51878.1Mb	448.9M	57.6%	98.1%	75.1%
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2_1																																				122.4bp	98.0%	220.0M												88.9%	55%	151bp	151bp	18%	228.8M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2_2																																																		87.3%	56%	151bp	151bp	18%	228.8M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2_trimmed_1																																																		89.0%	57%	118bp	122bp	9%	224.4M	89.0%	57%	118bp	122bp	9%	224.4M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2_trimmed_2																																																		88.8%	57%	118bp	122bp	9%	224.4M	88.8%	57%	118bp	122bp	9%	224.4M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3	315024560	0.9721	327393420	0.01%	0.86%	44887523	0.84%	0.90%	0.11%	0.10%	37834228	18933686	4740699	2023469	59.24	23.00	0.45%	0.16%	0.98	0.000	131.1bp	125.0bp	0.00%	0.73%	0.41%	0.00%	0.00%	2.41%	0.67%	0.00%	5.44	No	0.00%	9999000000	43988393				86.9%	87.7%	95.2%	155.8M	61.7%	97.6%	39612.4Mb	327.4M	57.0%	98.1%	68.7%
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3_1																																				131.1bp	97.9%	160.2M												89.8%	55%	151bp	151bp	18%	166.9M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3_2																																																		88.2%	56%	151bp	151bp	18%	166.9M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3_trimmed_1																																																		89.8%	56%	124bp	127bp	9%	163.7M	89.8%	56%	124bp	127bp	9%	163.7M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3_trimmed_2																																																		89.8%	57%	124bp	127bp	9%	163.7M	89.8%	57%	124bp	127bp	9%	163.7M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1	516426908	0.9120	537605858	0.01%	0.67%	178124434	0.92%	0.95%	0.06%	0.05%	163644220	82085248	10558912	4285612	249.58	113.00	0.67%	0.52%	0.98	0.000	116.2bp	111.0bp	0.01%	0.91%	0.46%	0.00%	0.02%	2.79%	0.70%	0.00%	0.05	No	0.00%	9999000000	143312002				67.4%	87.1%	94.8%	254.8M	40.9%	97.8%	60342.1Mb	537.6M	53.8%	98.4%	79.3%
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1_1																																				116.2bp	98.2%	263.9M												83.8%	52%	151bp	151bp	18%	273.3M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1_2																																																		82.5%	53%	151bp	151bp	18%	273.3M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1_trimmed_1																																																		83.8%	53%	115bp	117bp	9%	268.8M	83.8%	53%	115bp	117bp	9%	268.8M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1_trimmed_2																																																		83.8%	53%	115bp	117bp	9%	268.8M	83.8%	53%	115bp	117bp	9%	268.8M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2	389777581	0.9295	405116938	0.01%	0.72%	114430048	0.91%	0.94%	0.07%	0.06%	103901639	52126726	7562857	3110039	159.37	69.00	0.62%	0.43%	0.98	0.000	121.9bp	115.0bp	0.01%	0.86%	0.46%	0.00%	0.02%	2.62%	0.70%	0.00%	0.10	No	0.00%	9999000000	104207433				72.3%	87.5%	94.9%	192.2M	48.6%	97.8%	46917.1Mb	405.1M	53.9%	98.5%	76.4%
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2_1																																				121.9bp	98.1%	198.8M												84.3%	53%	151bp	151bp	18%	205.7M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2_2																																																		83.1%	54%	151bp	151bp	18%	205.7M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2_trimmed_1																																																		84.4%	53%	118bp	122bp	9%	202.6M	84.4%	53%	118bp	122bp	9%	202.6M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2_trimmed_2																																																		84.3%	54%	119bp	122bp	9%	202.6M	84.3%	54%	119bp	122bp	9%	202.6M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3	526186732	0.9459	547232326	0.01%	0.85%	79988027	0.87%	0.93%	0.08%	0.07%	69574509	34841301	6464519	2680159	103.78	43.00	0.56%	0.31%	0.98	0.000	119.1bp	113.0bp	0.00%	0.89%	0.50%	0.00%	0.01%	2.75%	0.77%	0.00%	0.08	No	0.00%	9999000000	66693587				86.0%	87.3%	94.8%	259.5M	57.9%	97.8%	62771.6Mb	547.2M	54.2%	98.4%	76.9%
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3_1																																				119.1bp	98.3%	269.1M												90.0%	53%	151bp	151bp	18%	278.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3_2																																																		88.7%	53%	151bp	151bp	18%	278.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3_trimmed_1																																																		90.1%	53%	117bp	117bp	9%	273.6M	90.1%	53%	117bp	117bp	9%	273.6M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3_trimmed_2																																																		90.1%	54%	117bp	117bp	9%	273.6M	90.1%	54%	117bp	117bp	9%	273.6M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1	408177393	0.9410	425226198	0.01%	0.65%	149104516	0.92%	0.95%	0.06%	0.05%	137011363	68743778	8979127	3665007	208.06	94.00	0.66%	0.49%	0.98	0.000	116.7bp	111.0bp	0.01%	0.96%	0.44%	0.00%	0.02%	2.93%	0.68%	0.00%	0.29	Yes	0.00%	9999000000	138111929				65.4%	86.8%	94.7%	201.4M	39.4%	97.8%	47719.8Mb	425.2M	53.9%	98.5%	79.6%
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1_1																																				116.7bp	98.1%	208.6M												82.7%	52%	151bp	151bp	18%	215.8M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1_2																																																		81.4%	54%	151bp	151bp	27%	215.8M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1_trimmed_1																																																		82.7%	53%	115bp	117bp	9%	212.6M	82.7%	53%	115bp	117bp	9%	212.6M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1_trimmed_2																																																		82.5%	54%	115bp	117bp	9%	212.6M	82.5%	54%	115bp	117bp	9%	212.6M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2	419279266	0.9394	436770622	0.01%	0.74%	113314143	0.90%	0.94%	0.07%	0.06%	102065664	51165862	8128723	3416388	150.37	66.00	0.62%	0.41%	0.98	0.000	114.4bp	109.0bp	0.01%	0.93%	0.45%	0.00%	0.01%	2.84%	0.70%	0.00%	0.29	No	0.00%	9999000000	98195837				74.6%	86.8%	94.7%	206.9M	45.5%	97.8%	48417.2Mb	436.8M	54.2%	98.4%	80.4%
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2_1																																				114.4bp	98.1%	214.2M												85.3%	52%	151bp	151bp	18%	221.9M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2_2																																																		84.0%	54%	151bp	151bp	27%	221.9M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2_trimmed_1																																																		85.3%	53%	113bp	112bp	9%	218.4M	85.3%	53%	113bp	112bp	9%	218.4M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2_trimmed_2																																																		85.1%	54%	113bp	112bp	9%	218.4M	85.1%	54%	113bp	112bp	9%	218.4M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3	288312044	0.9610	300233978	0.01%	0.80%	60925119	0.89%	0.94%	0.07%	0.06%	54290370	27177340	4427614	1812294	80.14	33.00	0.52%	0.24%	0.98	0.000	119.3bp	113.0bp	0.00%	0.96%	0.47%	0.00%	0.01%	2.96%	0.74%	0.00%	0.37	No	0.00%	9999000000	52691793				80.3%	86.9%	94.7%	142.1M	51.5%	97.8%	34302.1Mb	300.2M	53.8%	98.2%	77.5%
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3_1																																				119.3bp	98.3%	147.6M												86.5%	53%	151bp	151bp	18%	152.9M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3_2																																																		85.1%	53%	151bp	151bp	18%	152.9M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3_trimmed_1																																																		86.5%	53%	117bp	117bp	9%	150.1M	86.5%	53%	117bp	117bp	9%	150.1M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3_trimmed_2																																																		86.5%	54%	117bp	117bp	9%	150.1M	86.5%	54%	117bp	117bp	9%	150.1M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1	510767854	0.9299	532071846	0.01%	0.70%	159536016	0.91%	0.94%	0.07%	0.06%	145109483	72782205	10636663	4447344	215.18	99.00	0.66%	0.50%	0.98	0.000	114.0bp	109.0bp	0.01%	0.99%	0.44%	0.00%	0.02%	3.05%	0.67%	0.00%	0.03	No	0.00%	9999000000	122557228				70.5%	87.0%	94.8%	252.3M	43.2%	97.8%	58795.8Mb	532.1M	53.4%	98.6%	81.3%
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1_1																																				114.0bp	98.0%	260.8M												85.0%	52%	151bp	151bp	18%	269.9M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1_2																																																		83.6%	53%	151bp	151bp	27%	269.9M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1_trimmed_1																																																		85.1%	53%	113bp	112bp	9%	266.0M	85.1%	53%	113bp	112bp	9%	266.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1_trimmed_2																																																		84.7%	53%	113bp	112bp	9%	266.0M	84.7%	53%	113bp	112bp	9%	266.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2	493710415	0.9296	513556276	0.01%	0.74%	131300320	0.90%	0.94%	0.07%	0.06%	117975315	59158867	9548437	3991973	178.18	81.00	0.64%	0.46%	0.98	0.000	120.8bp	115.0bp	0.01%	0.94%	0.42%	0.00%	0.02%	2.92%	0.65%	0.00%	0.04	No	0.00%	9999000000	110981851				75.0%	87.2%	94.8%	243.4M	48.5%	97.7%	59207.9Mb	513.6M	53.2%	98.6%	77.1%
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2_1																																				120.8bp	98.0%	251.7M												85.7%	52%	151bp	151bp	18%	260.5M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2_2																																																		84.6%	53%	151bp	151bp	18%	260.5M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2_trimmed_1																																																		85.7%	52%	118bp	117bp	9%	256.8M	85.7%	52%	118bp	117bp	9%	256.8M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2_trimmed_2																																																		85.8%	53%	118bp	117bp	9%	256.8M	85.8%	53%	118bp	117bp	9%	256.8M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3	378205399	0.9606	394408598	0.01%	0.80%	79090653	0.89%	0.93%	0.07%	0.07%	70140990	35136486	5919157	2466023	102.50	44.00	0.57%	0.31%	0.98	0.000	116.0bp	110.0bp	0.01%	1.00%	0.47%	0.00%	0.01%	3.08%	0.72%	0.00%	0.01	No	0.00%	9999000000	71489024				80.6%	86.5%	94.6%	186.5M	49.8%	97.6%	44061.5Mb	394.4M	54.1%	98.4%	79.8%
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3_1																																				116.0bp	98.2%	193.6M												87.3%	53%	151bp	151bp	18%	200.4M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3_2																																																		86.0%	54%	151bp	151bp	18%	200.4M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3_trimmed_1																																																		87.4%	53%	114bp	117bp	9%	197.2M	87.4%	53%	114bp	117bp	9%	197.2M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3_trimmed_2																																																		87.3%	54%	115bp	117bp	9%	197.2M	87.3%	54%	115bp	117bp	9%	197.2M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1	572599992	0.9227	591615240	0.01%	0.54%	273655777	0.94%	0.97%	0.05%	0.03%	257207445	129414698	12667986	4561443	462.17	213.00	0.73%	0.61%	0.98	0.000	133.3bp	126.0bp	0.01%	0.62%	0.45%	0.00%	0.01%	2.06%	0.73%	0.00%	0.01	No	0.00%	9990000000	303334417				54.1%	89.6%	95.7%	283.1M	33.6%	97.7%	72402.1Mb	591.6M	54.7%	98.6%	65.4%
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1_1																																				133.3bp	98.3%	290.7M												83.6%	53%	151bp	151bp	18%	390.9M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1_2																																																		82.6%	54%	151bp	151bp	18%	390.9M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1_trimmed_1																																																		81.5%	54%	125bp	132bp	9%	295.8M	81.5%	54%	125bp	132bp	9%	295.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1_trimmed_2																																																		81.6%	54%	125bp	132bp	9%	295.8M	81.6%	54%	125bp	132bp	9%	295.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2	570554186	0.9306	589529662	0.01%	0.65%	206619644	0.93%	0.96%	0.05%	0.04%	192900065	97008677	9919935	3570841	338.94	151.00	0.70%	0.57%	0.98	0.000	132.6bp	125.0bp	0.00%	0.66%	0.48%	0.00%	0.01%	2.19%	0.78%	0.00%	0.01	No	0.00%	9999000000	170917862				65.4%	89.7%	95.7%	282.2M	41.6%	97.8%	71956.0Mb	589.5M	55.0%	98.5%	66.0%
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2_1																																				132.6bp	98.4%	290.1M												84.5%	53%	151bp	151bp	18%	299.2M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2_2																																																		83.6%	54%	151bp	151bp	18%	299.2M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2_trimmed_1																																																		84.5%	54%	125bp	132bp	9%	294.8M	84.5%	54%	125bp	132bp	9%	294.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2_trimmed_2																																																		84.8%	55%	125bp	132bp	9%	294.8M	84.8%	55%	125bp	132bp	9%	294.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3	570745561	0.9358	589281258	0.01%	0.75%	145053102	0.92%	0.96%	0.06%	0.04%	132832313	66770626	8292156	3003216	235.06	100.00	0.66%	0.50%	0.98	0.000	138.7bp	131.0bp	0.00%	0.62%	0.47%	0.00%	0.01%	2.09%	0.77%	0.00%	0.01	No	0.00%	9999000000	123619653				75.9%	90.0%	95.8%	282.2M	56.3%	97.6%	74072.1Mb	589.3M	55.0%	98.2%	60.7%
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3_1																																				138.7bp	98.4%	289.8M												89.9%	54%	151bp	151bp	18%	419.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3_2																																																		88.2%	54%	151bp	151bp	18%	419.8M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3_trimmed_1																																																		87.5%	54%	129bp	137bp	9%	294.6M	87.5%	54%	129bp	137bp	9%	294.6M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3_trimmed_2																																																		87.5%	55%	129bp	137bp	9%	294.6M	87.5%	55%	129bp	137bp	9%	294.6M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1	515855862	0.8975	534568738	0.01%	0.68%	168666560	0.91%	0.95%	0.06%	0.05%	154128940	77446727	10765544	4284569	259.77	120.00	0.70%	0.54%	0.98	0.000	130.6bp	123.0bp	0.01%	0.81%	0.48%	0.00%	0.01%	2.62%	0.74%	0.00%	0.02	No	0.00%	9999000000	138291319				68.9%	88.6%	95.4%	255.0M	48.5%	97.7%	64762.1Mb	534.6M	54.5%	98.4%	68.3%
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1_1																																				130.6bp	97.9%	261.7M												84.5%	53%	151bp	151bp	18%	271.5M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1_2																																																		83.5%	54%	151bp	151bp	18%	271.5M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1_trimmed_1																																																		84.5%	54%	124bp	127bp	9%	267.3M	84.5%	54%	124bp	127bp	9%	267.3M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1_trimmed_2																																																		84.8%	54%	124bp	127bp	9%	267.3M	84.8%	54%	124bp	127bp	9%	267.3M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2	514455404	0.9106	533631774	0.01%	0.82%	96528725	0.88%	0.93%	0.08%	0.07%	85077774	42717624	7618196	3094059	139.58	61.00	0.62%	0.39%	0.98	0.000	129.2bp	122.0bp	0.00%	0.87%	0.51%	0.00%	0.01%	2.85%	0.79%	0.00%	0.01	No	0.00%	9999000000	79212668				82.5%	88.3%	95.4%	254.4M	57.9%	97.8%	64244.0Mb	533.6M	54.6%	98.5%	68.8%
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2_1																																				129.2bp	98.0%	261.6M												89.0%	53%	151bp	151bp	18%	271.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2_2																																																		87.8%	54%	151bp	151bp	18%	271.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2_trimmed_1																																																		89.1%	54%	123bp	127bp	9%	266.8M	89.1%	54%	123bp	127bp	9%	266.8M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2_trimmed_2																																																		89.1%	54%	123bp	127bp	9%	266.8M	89.1%	54%	123bp	127bp	9%	266.8M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3	365156999	0.9415	378679812	0.01%	0.87%	48120985	0.85%	0.91%	0.10%	0.09%	40685508	20395623	4751944	1976948	66.05	27.00	0.48%	0.18%	0.98	0.000	131.5bp	124.0bp	0.00%	0.85%	0.50%	0.00%	0.01%	2.81%	0.79%	0.00%	0.01	No	0.00%	9999000000	45584589				87.9%	88.5%	95.4%	180.7M	64.7%	97.8%	46130.0Mb	378.7M	54.7%	98.4%	67.3%
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3_1																																				131.5bp	98.0%	185.6M												90.5%	54%	151bp	151bp	18%	192.4M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3_2																																																		89.2%	54%	151bp	151bp	18%	192.4M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3_trimmed_1																																																		90.6%	54%	125bp	127bp	9%	189.3M	90.6%	54%	125bp	127bp	9%	189.3M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3_trimmed_2																																																		90.6%	54%	125bp	132bp	9%	189.3M	90.6%	54%	125bp	132bp	9%	189.3M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1	522267338	0.8720	543902716	0.01%	0.54%	248562602	0.93%	0.96%	0.05%	0.04%	231213990	116515445	13011641	4687402	419.69	207.00	0.74%	0.62%	0.98	0.000	138.6bp	130.0bp	0.01%	0.83%	0.52%	0.00%	0.03%	2.69%	0.80%	0.00%	0.03	No	0.00%	9999000000	253888182				54.7%	87.1%	94.9%	258.1M	36.4%	97.7%	67792.3Mb	543.9M	55.6%	98.5%	61.3%
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1_1																																				138.6bp	97.7%	265.7M												81.4%	54%	151bp	151bp	18%	276.2M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1_2																																																		80.6%	55%	151bp	151bp	18%	276.2M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1_trimmed_1																																																		81.5%	55%	127bp	137bp	9%	272.0M	81.5%	55%	127bp	137bp	9%	272.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1_trimmed_2																																																		81.9%	55%	128bp	137bp	9%	272.0M	81.9%	55%	128bp	137bp	9%	272.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2	566870547	0.8648	590206640	0.01%	0.67%	195239096	0.92%	0.95%	0.06%	0.05%	178776422	90111387	11950341	4406084	321.07	157.00	0.72%	0.58%	0.98	0.000	140.7bp	131.0bp	0.01%	0.82%	0.52%	0.00%	0.03%	2.66%	0.81%	0.00%	0.03	No	0.00%	9999000000	160311046				67.4%	87.2%	95.0%	280.3M	47.4%	97.7%	73712.2Mb	590.2M	55.5%	98.4%	60.3%
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2_1																																				140.7bp	97.7%	288.2M												85.7%	54%	151bp	151bp	18%	336.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2_2																																																		84.7%	55%	151bp	151bp	18%	336.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2_trimmed_1																																																		84.7%	55%	128bp	137bp	9%	295.1M	84.7%	55%	128bp	137bp	9%	295.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2_trimmed_2																																																		85.1%	55%	128bp	137bp	9%	295.1M	85.1%	55%	128bp	137bp	9%	295.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3	442791291	0.9007	462142250	0.01%	0.79%	96531806	0.89%	0.94%	0.07%	0.06%	86020493	43242410	6866283	2564569	145.82	67.00	0.63%	0.41%	0.98	0.000	136.2bp	126.0bp	0.01%	0.90%	0.57%	0.00%	0.01%	2.92%	0.89%	0.00%	0.03	No	0.00%	9999000000	81487709				79.7%	86.6%	94.8%	219.0M	55.7%	97.7%	56515.4Mb	462.1M	55.5%	98.0%	63.0%
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3_1																																				136.2bp	97.8%	226.1M												87.8%	54%	151bp	151bp	18%	235.8M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3_2																																																		86.4%	55%	151bp	151bp	18%	235.8M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3_trimmed_1																																																		87.8%	55%	125bp	132bp	9%	231.1M	87.8%	55%	125bp	132bp	9%	231.1M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3_trimmed_2																																																		87.9%	55%	125bp	132bp	9%	231.1M	87.9%	55%	125bp	132bp	9%	231.1M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1	569065825	0.9405	591593644	0.01%	0.47%	313366125	0.94%	0.97%	0.05%	0.03%	294993596	148850272	14729790	4958478	571.07	243.00	0.73%	0.62%	0.98	0.000	145.6bp	136.0bp	0.01%	1.34%	0.48%	0.00%	0.01%	4.21%	0.75%	0.00%	0.00	No	0.00%	9999000000	421617284				47.3%	88.3%	95.2%	281.5M	31.8%	97.8%	75224.6Mb	591.6M	54.4%	98.6%	56.1%
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1_1																																				145.6bp	98.2%	290.4M												86.3%	53%	151bp	151bp	18%	501.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1_2																																																		85.5%	54%	151bp	151bp	18%	501.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1_trimmed_1																																																		82.8%	54%	130bp	142bp	9%	295.8M	82.8%	54%	130bp	142bp	9%	295.8M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1_trimmed_2																																																		83.3%	54%	130bp	142bp	9%	295.8M	83.3%	54%	130bp	142bp	9%	295.8M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2	568412341	0.9451	590906214	0.01%	0.55%	264867246	0.94%	0.97%	0.05%	0.03%	248385895	125356439	12754593	4209716	479.54	198.00	0.71%	0.59%	0.98	0.000	146.8bp	136.0bp	0.00%	1.37%	0.52%	0.00%	0.01%	4.32%	0.81%	0.00%	0.00	No	0.00%	9999000000	266016673				55.5%	88.4%	95.2%	281.3M	40.2%	97.8%	75620.7Mb	590.9M	54.8%	98.5%	54.7%
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2_1																																				146.8bp	98.3%	290.4M												87.2%	53%	151bp	151bp	18%	452.2M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2_2																																																		86.4%	55%	151bp	151bp	18%	452.2M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2_trimmed_1																																																		84.3%	54%	131bp	142bp	9%	295.5M	84.3%	54%	131bp	142bp	9%	295.5M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2_trimmed_2																																																		84.9%	55%	131bp	142bp	9%	295.5M	84.9%	55%	131bp	142bp	9%	295.5M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3	567371222	0.9508	589950250	0.01%	0.65%	204017799	0.93%	0.96%	0.05%	0.04%	189833014	95745096	10624652	3546181	359.31	145.00	0.68%	0.55%	0.98	0.000	146.0bp	135.0bp	0.00%	1.38%	0.52%	0.00%	0.00%	4.37%	0.82%	0.00%	0.01	No	0.00%	9999000000	167984700				65.8%	88.4%	95.2%	280.9M	48.3%	97.7%	75182.8Mb	590.0M	54.8%	98.3%	55.5%
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3_1																																				146.0bp	98.4%	290.2M												89.7%	54%	151bp	151bp	18%	495.1M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3_2																																																		88.7%	54%	151bp	151bp	18%	495.1M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3_trimmed_1																																																		86.4%	54%	130bp	142bp	9%	295.0M	86.4%	54%	130bp	142bp	9%	295.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3_trimmed_2																																																		86.8%	55%	130bp	142bp	9%	295.0M	86.8%	55%	130bp	142bp	9%	295.0M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1	160459298	0.9614	166577588	0.01%	0.27%	122390696	0.94%	0.97%	0.05%	0.03%	115502776	58367211	5818503	1894708	233.55	103.00	0.66%	0.51%	0.98	0.000	161.2bp	147.0bp	0.01%	0.94%	0.32%	0.00%	0.01%	3.03%	0.51%	0.00%	0.03	No	0.00%	9999000000	285984258				26.7%	88.5%	95.3%	79.4M	18.4%	97.7%	21770.5Mb	166.6M	55.5%	98.5%	48.2%
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1_1																																				161.2bp	97.6%	81.3M												69.4%	54%	151bp	151bp	18%	84.5M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1_2																																																		69.0%	55%	151bp	151bp	18%	84.5M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1_trimmed_1																																																		69.3%	55%	134bp	151bp	9%	83.3M	69.3%	55%	134bp	151bp	9%	83.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1_trimmed_2																																																		69.9%	55%	134bp	151bp	9%	83.3M	69.9%	55%	134bp	151bp	9%	83.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2	568329300	0.9463	590563844	0.01%	0.53%	279642347	0.93%	0.96%	0.06%	0.04%	260265481	131701547	15419327	4979329	518.30	248.00	0.74%	0.63%	0.98	0.000	159.2bp	146.0bp	0.00%	0.94%	0.33%	0.00%	0.01%	3.08%	0.53%	0.00%	0.01	No	0.00%	9999000000	280923332				53.0%	88.4%	95.2%	281.2M	39.0%	97.7%	77481.9Mb	590.6M	56.0%	98.4%	47.7%
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2_1																																				159.2bp	97.7%	288.6M												87.6%	55%	151bp	151bp	18%	542.1M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2_2																																																		86.3%	55%	151bp	151bp	18%	542.1M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2_trimmed_1																																																		83.0%	55%	134bp	151bp	9%	295.3M	83.0%	55%	134bp	151bp	9%	295.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2_trimmed_2																																																		83.3%	56%	134bp	151bp	9%	295.3M	83.3%	56%	134bp	151bp	9%	295.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3	568406304	0.9630	590665188	0.01%	0.61%	230685214	0.92%	0.96%	0.06%	0.04%	213057082	107861460	13872388	4567630	418.25	202.00	0.72%	0.61%	0.98	0.000	159.0bp	146.0bp	0.00%	0.95%	0.34%	0.00%	0.00%	3.08%	0.55%	0.00%	0.01	No	0.00%	9999000000	190558840				61.3%	88.5%	95.3%	281.5M	46.4%	97.7%	77208.5Mb	590.7M	55.8%	98.4%	48.0%
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3_1																																				159.0bp	97.7%	288.5M												87.2%	54%	151bp	151bp	18%	396.8M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3_2																																																		86.2%	55%	151bp	151bp	18%	396.8M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3_trimmed_1																																																		85.0%	55%	134bp	151bp	9%	295.3M	85.0%	55%	134bp	151bp	9%	295.3M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3_trimmed_2																																																		85.4%	56%	134bp	151bp	9%	295.3M	85.4%	56%	134bp	151bp	9%	295.3M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1	51341978	0.9225	56829786	0.02%	0.78%	12727209	0.83%	0.91%	0.09%	0.09%	10551196	5275439	1193772	537346	12.69	4.00	0.09%	0.01%	0.98	0.000	100.3bp	97.0bp	0.03%	1.30%	0.51%	0.00%	0.07%	3.83%	0.78%	0.00%	0.00	No	0.00%	9999000000	12432299				79.0%	72.9%	89.1%	25.3M	41.0%	97.8%	5676.9Mb	56.8M	53.8%	97.7%	89.9%
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_1																																				100.3bp	97.4%	27.7M												82.2%	53%	151bp	151bp	18%	29.1M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_2																																																		80.5%	54%	151bp	151bp	36%	29.1M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_trimmed_1																																																		82.0%	53%	102bp	102bp	9%	28.4M	82.0%	53%	102bp	102bp	9%	28.4M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1_trimmed_2																																																		81.3%	54%	102bp	102bp	9%	28.4M	81.3%	54%	102bp	102bp	9%	28.4M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2	112215857	0.9162	122552894	0.01%	0.85%	17882399	0.81%	0.90%	0.10%	0.10%	14425665	7201271	1755118	781258	17.41	6.00	0.14%	0.02%	0.98	0.000	98.7bp	95.0bp	0.01%	1.46%	0.59%	0.00%	0.03%	4.23%	0.89%	0.00%	0.09	No	0.00%	9999000000	17300497				86.6%	76.0%	90.2%	55.3M	42.8%	97.8%	12105.8Mb	122.6M	53.9%	98.2%	90.7%
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2_1																																				98.7bp	97.8%	60.0M												87.9%	52%	151bp	151bp	27%	62.4M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2_2																																																		86.3%	54%	151bp	151bp	27%	62.4M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2_trimmed_1																																																		87.9%	53%	101bp	97bp	9%	61.3M	87.9%	53%	101bp	97bp	9%	61.3M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2_trimmed_2																																																		87.3%	54%	101bp	97bp	9%	61.3M	87.3%	54%	101bp	97bp	9%	61.3M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3	79615271	0.9376	86144414	0.01%	0.85%	12709778	0.82%	0.90%	0.10%	0.10%	10385599	5186554	1247277	557379	12.77	4.00	0.09%	0.01%	0.98	0.000	101.9bp	98.0bp	0.01%	1.45%	0.58%	0.00%	0.03%	4.21%	0.89%	0.00%	0.11	No	0.00%	9999000000	12646746				86.3%	78.2%	91.1%	39.2M	45.3%	97.9%	8701.2Mb	86.1M	53.1%	98.1%	89.7%
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_1																																				101.9bp	97.9%	42.2M												87.4%	52%	151bp	151bp	18%	43.9M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_2																																																		86.0%	53%	151bp	151bp	36%	43.9M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_trimmed_1																																																		87.3%	52%	103bp	102bp	9%	43.1M	87.3%	52%	103bp	102bp	9%	43.1M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3_trimmed_2																																																		87.1%	53%	103bp	102bp	9%	43.1M	87.1%	53%	103bp	102bp	9%	43.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1	565499312	0.9204	590516390	0.01%	0.63%	219219248	0.93%	0.96%	0.05%	0.04%	203871245	102314561	11517889	4517861	320.22	131.00	0.66%	0.54%	0.98	0.000	118.1bp	112.0bp	0.01%	1.71%	0.64%	0.00%	0.01%	4.65%	0.92%	0.00%	0.01	Yes	0.00%	9999000000	189348639				63.3%	86.2%	94.5%	278.9M	37.6%	97.7%	66692.4Mb	590.5M	54.1%	98.4%	78.1%
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1_1																																				118.1bp	98.1%	289.8M												85.3%	52%	151bp	151bp	18%	367.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1_2																																																		84.2%	54%	151bp	151bp	27%	367.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1_trimmed_1																																																		83.7%	53%	115bp	117bp	9%	295.3M	83.7%	53%	115bp	117bp	9%	295.3M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1_trimmed_2																																																		83.8%	54%	116bp	117bp	9%	295.3M	83.8%	54%	116bp	117bp	9%	295.3M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2	565682229	0.9351	590385532	0.01%	0.73%	161543666	0.92%	0.95%	0.06%	0.05%	148287190	74407071	9268556	3631723	232.43	90.00	0.63%	0.48%	0.98	0.000	122.5bp	116.0bp	0.00%	1.74%	0.69%	0.00%	0.01%	4.78%	1.02%	0.00%	0.03	No	0.00%	9999000000	128201756				73.1%	86.2%	94.5%	278.8M	47.0%	97.8%	68462.8Mb	590.4M	54.6%	98.4%	75.4%
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2_1																																				122.5bp	98.2%	289.9M												88.1%	53%	151bp	151bp	18%	363.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2_2																																																		86.8%	54%	151bp	151bp	18%	363.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2_trimmed_1																																																		86.7%	54%	119bp	122bp	9%	295.2M	86.7%	54%	119bp	122bp	9%	295.2M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2_trimmed_2																																																		86.7%	54%	119bp	122bp	9%	295.2M	86.7%	54%	119bp	122bp	9%	295.2M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3	402835013	0.9624	420206700	0.01%	0.78%	94400279	0.91%	0.95%	0.06%	0.05%	85865420	43042191	5835699	2294775	131.81	48.00	0.56%	0.36%	0.98	0.000	124.0bp	118.0bp	0.00%	1.75%	0.69%	0.00%	0.00%	4.82%	1.03%	0.00%	0.01	No	0.00%	9999000000	75729868				78.0%	86.5%	94.6%	198.7M	52.3%	97.7%	49177.0Mb	420.2M	54.5%	98.3%	74.4%
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3_1																																				124.0bp	98.2%	206.4M												87.5%	53%	151bp	151bp	18%	213.8M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3_2																																																		86.1%	54%	151bp	151bp	18%	213.8M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3_trimmed_1																																																		87.5%	54%	120bp	122bp	9%	210.1M	87.5%	54%	120bp	122bp	9%	210.1M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3_trimmed_2																																																		87.6%	54%	120bp	122bp	9%	210.1M	87.6%	54%	120bp	122bp	9%	210.1M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1	553737723	0.8480	578660638	0.01%	0.79%	120501064	0.89%	0.94%	0.07%	0.06%	107146868	53699811	8479268	3517735	154.29	56.00	0.59%	0.39%	0.98	0.000	112.5bp	107.0bp	0.06%	0.96%	0.59%	0.00%	0.11%	2.59%	0.76%	0.00%	2.84	No	0.00%	9999000000	96531953				79.8%	87.0%	94.9%	274.5M	46.4%	97.8%	63165.6Mb	578.7M	55.1%	98.5%	83.3%
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1_1																																				112.5bp	98.2%	284.0M												87.0%	53%	151bp	151bp	18%	293.8M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1_2																																																		85.5%	54%	151bp	151bp	27%	293.8M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1_trimmed_1																																																		87.0%	54%	111bp	112bp	9%	289.3M	87.0%	54%	111bp	112bp	9%	289.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1_trimmed_2																																																		86.8%	55%	112bp	112bp	9%	289.3M	86.8%	55%	112bp	112bp	9%	289.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2	446379950	0.8904	466458892	0.01%	0.81%	90110575	0.88%	0.93%	0.08%	0.07%	79049404	39603468	6849210	2804841	115.78	39.00	0.54%	0.31%	0.98	0.000	116.5bp	111.0bp	0.04%	0.85%	0.60%	0.00%	0.08%	2.31%	0.78%	0.00%	2.86	No	0.00%	9999000000	70417817				81.4%	86.6%	94.6%	220.7M	49.7%	97.7%	52304.7Mb	466.5M	56.4%	98.2%	80.1%
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2_1																																				116.5bp	98.1%	228.8M												87.2%	55%	151bp	151bp	18%	237.4M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2_2																																																		85.5%	55%	151bp	151bp	27%	237.4M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2_trimmed_1																																																		87.3%	56%	115bp	117bp	9%	233.2M	87.3%	56%	115bp	117bp	9%	233.2M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2_trimmed_2																																																		86.9%	56%	115bp	117bp	9%	233.2M	86.9%	56%	115bp	117bp	9%	233.2M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3	312505659	0.9307	326564186	0.01%	0.84%	51478839	0.86%	0.93%	0.08%	0.07%	44307265	22197683	4085517	1662921	64.95	20.00	0.43%	0.18%	0.98	0.000	119.4bp	114.0bp	0.02%	0.88%	0.64%	0.00%	0.04%	2.37%	0.84%	0.00%	2.64	No	0.00%	9999000000	43060333				85.0%	86.5%	94.6%	154.4M	49.8%	97.7%	37313.8Mb	326.6M	56.8%	98.2%	78.1%
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3_1																																				119.4bp	98.1%	160.2M												88.2%	55%	151bp	151bp	18%	166.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3_2																																																		86.4%	56%	151bp	151bp	18%	166.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3_trimmed_1																																																		88.2%	56%	117bp	117bp	9%	163.3M	88.2%	56%	117bp	117bp	9%	163.3M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3_trimmed_2																																																		87.9%	57%	117bp	117bp	9%	163.3M	87.9%	57%	117bp	117bp	9%	163.3M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1	560073523	0.8909	587640686	0.01%	0.79%	121576138	0.87%	0.93%	0.08%	0.07%	105730993	53209861	9572996	3699247	182.13	46.00	0.57%	0.36%	0.98	0.000	142.1bp	133.0bp	0.01%	0.54%	0.18%	0.00%	0.03%	1.66%	0.32%	0.00%	3.20	No	0.00%	9999000000	98979478				80.2%	85.2%	94.3%	277.1M	59.5%	97.4%	73654.6Mb	587.6M	60.7%	97.9%	59.4%
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1_1																																				142.1bp	97.2%	285.7M												90.9%	59%	151bp	151bp	18%	416.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1_2																																																		89.1%	59%	151bp	151bp	18%	416.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1_trimmed_1																																																		89.1%	60%	129bp	137bp	9%	293.8M	89.1%	60%	129bp	137bp	9%	293.8M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1_trimmed_2																																																		88.9%	61%	129bp	137bp	9%	293.8M	88.9%	61%	129bp	137bp	9%	293.8M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2	535813375	0.8929	561823188	0.01%	0.87%	71759294	0.82%	0.91%	0.10%	0.09%	58532518	29370930	7465053	2952996	99.93	24.00	0.47%	0.24%	0.98	0.000	144.8bp	136.0bp	0.01%	0.52%	0.18%	0.00%	0.03%	1.60%	0.32%	0.00%	3.23	No	0.00%	9999000000	63374579				88.1%	85.7%	94.4%	265.2M	66.7%	97.4%	71418.3Mb	561.8M	60.8%	97.5%	56.3%
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2_1																																				144.8bp	97.2%	273.2M												91.4%	59%	151bp	151bp	18%	288.2M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2_2																																																		89.0%	60%	151bp	151bp	18%	288.2M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2_trimmed_1																																																		91.5%	60%	130bp	142bp	9%	280.9M	91.5%	60%	130bp	142bp	9%	280.9M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2_trimmed_2																																																		91.0%	61%	131bp	142bp	9%	280.9M	91.0%	61%	131bp	142bp	9%	280.9M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3	324186131	0.9389	340580052	0.01%	0.90%	34875703	0.78%	0.90%	0.11%	0.10%	27084364	13565723	3926187	1564510	46.08	11.00	0.32%	0.11%	0.98	0.000	144.6bp	135.0bp	0.01%	0.57%	0.19%	0.00%	0.01%	1.74%	0.34%	0.00%	3.22	No	0.00%	9999000000	33959535				90.8%	85.3%	94.3%	160.6M	68.4%	97.4%	43122.0Mb	340.6M	60.6%	97.8%	57.1%
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3_1																																				144.6bp	97.2%	165.5M												91.8%	59%	151bp	151bp	18%	174.1M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3_2																																																		89.7%	60%	151bp	151bp	18%	174.1M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3_trimmed_1																																																		92.0%	60%	130bp	142bp	9%	170.3M	92.0%	60%	130bp	142bp	9%	170.3M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3_trimmed_2																																																		91.5%	60%	130bp	142bp	9%	170.3M	91.5%	60%	130bp	142bp	9%	170.3M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1	384208960	0.8449	399047534	0.01%	0.64%	144520329	0.92%	0.94%	0.07%	0.06%	132429207	66490555	9538468	3941241	205.34	88.00	0.64%	0.48%	0.98	0.000	122.8bp	117.0bp	0.01%	1.59%	0.55%	0.00%	0.03%	4.50%	0.85%	0.00%	0.02	No	0.00%	9999000000	126880672				64.2%	87.7%	95.2%	189.8M	41.2%	97.9%	46366.9Mb	399.0M	52.7%	98.5%	76.2%
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1_1																																				122.8bp	97.7%	195.0M												82.1%	52%	151bp	151bp	18%	202.6M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1_2																																																		80.7%	52%	151bp	151bp	27%	202.6M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1_trimmed_1																																																		82.2%	52%	119bp	122bp	9%	199.5M	82.2%	52%	119bp	122bp	9%	199.5M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1_trimmed_2																																																		81.9%	52%	119bp	122bp	9%	199.5M	81.9%	52%	119bp	122bp	9%	199.5M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2	520019065	0.7894	540220732	0.01%	0.79%	112388346	0.89%	0.93%	0.08%	0.07%	100095259	50211987	8890859	3710124	151.55	63.00	0.60%	0.41%	0.98	0.000	124.2bp	118.0bp	0.01%	1.69%	0.60%	0.00%	0.01%	4.78%	0.94%	0.00%	0.03	No	0.00%	9999000000	98746881				79.7%	87.5%	95.1%	256.8M	53.2%	97.7%	62884.3Mb	540.2M	52.9%	98.5%	75.5%
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2_1																																				124.2bp	97.9%	264.5M												87.6%	52%	151bp	151bp	18%	274.1M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2_2																																																		86.5%	53%	151bp	151bp	18%	274.1M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2_trimmed_1																																																		87.7%	52%	119bp	122bp	9%	270.1M	87.7%	52%	119bp	122bp	9%	270.1M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2_trimmed_2																																																		87.7%	53%	119bp	122bp	9%	270.1M	87.7%	53%	119bp	122bp	9%	270.1M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3	405689498	0.8097	421877870	0.01%	0.87%	54549271	0.85%	0.90%	0.10%	0.10%	46240977	23154895	5669115	2432904	67.59	26.00	0.48%	0.20%	0.98	0.000	122.4bp	116.0bp	0.01%	1.69%	0.60%	0.00%	0.01%	4.75%	0.96%	0.00%	0.03	No	0.00%	9999000000	60179187				87.6%	87.3%	95.0%	200.5M	59.0%	97.5%	48403.4Mb	421.9M	53.7%	98.4%	76.8%
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3_1																																				122.4bp	97.9%	206.6M												90.2%	52%	151bp	151bp	18%	214.4M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3_2																																																		88.9%	53%	151bp	151bp	18%	214.4M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3_trimmed_1																																																		90.3%	53%	118bp	117bp	9%	210.9M	90.3%	53%	118bp	117bp	9%	210.9M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3_trimmed_2																																																		90.2%	53%	118bp	117bp	9%	210.9M	90.2%	53%	118bp	117bp	9%	210.9M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1	563357052	0.9360	589680938	0.01%	0.69%	184224441	0.92%	0.95%	0.06%	0.05%	169386446	85087736	10681609	4166331	272.36	110.00	0.67%	0.52%	0.98	0.000	124.8bp	119.0bp	0.02%	1.52%	0.64%	0.00%	0.04%	4.36%	0.95%	0.00%	4.39	No	0.00%	9999000000	154413927				69.2%	85.8%	94.3%	277.9M	47.9%	97.7%	69751.8Mb	589.7M	56.5%	98.3%	72.7%
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1_1																																				124.8bp	98.1%	289.1M												87.3%	55%	151bp	151bp	18%	394.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1_2																																																		86.2%	55%	151bp	151bp	18%	394.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1_trimmed_1																																																		85.2%	56%	121bp	122bp	9%	294.8M	85.2%	56%	121bp	122bp	9%	294.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1_trimmed_2																																																		85.4%	56%	121bp	122bp	9%	294.8M	85.4%	56%	121bp	122bp	9%	294.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2	563121439	0.9310	588526388	0.01%	0.81%	109034020	0.89%	0.93%	0.08%	0.07%	96509815	48409160	8388456	3375374	152.75	57.00	0.60%	0.39%	0.98	0.000	127.1bp	121.0bp	0.02%	1.44%	0.63%	0.00%	0.03%	4.17%	0.96%	0.00%	4.30	No	0.00%	9999000000	91760852				82.0%	86.3%	94.4%	277.8M	60.3%	97.7%	70549.1Mb	588.5M	56.9%	98.1%	70.5%
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2_1																																				127.1bp	98.0%	288.5M												89.7%	55%	151bp	151bp	18%	342.6M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2_2																																																		87.9%	56%	151bp	151bp	18%	342.6M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2_trimmed_1																																																		88.9%	56%	123bp	127bp	9%	294.3M	88.9%	56%	123bp	127bp	9%	294.3M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2_trimmed_2																																																		88.8%	57%	123bp	127bp	9%	294.3M	88.8%	57%	123bp	127bp	9%	294.3M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3	343186016	0.9642	359862706	0.01%	0.86%	49899560	0.87%	0.93%	0.08%	0.07%	43169140	21597629	4202809	1692343	65.16	23.00	0.45%	0.18%	0.98	0.000	122.9bp	115.0bp	0.01%	1.60%	0.69%	0.00%	0.02%	4.61%	1.04%	0.00%	4.36	No	0.00%	9999000000	43213506				86.7%	85.6%	94.2%	169.5M	58.3%	97.7%	41827.3Mb	359.9M	56.8%	97.9%	74.0%
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3_1																																				122.9bp	98.1%	176.6M												89.9%	55%	151bp	151bp	18%	183.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3_2																																																		87.9%	56%	151bp	151bp	27%	183.8M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3_trimmed_1																																																		90.0%	56%	119bp	122bp	9%	179.9M	90.0%	56%	119bp	122bp	9%	179.9M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3_trimmed_2																																																		89.7%	57%	119bp	122bp	9%	179.9M	89.7%	57%	119bp	122bp	9%	179.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1	566244211	0.9407	588927612	0.01%	0.60%	233011953	0.94%	0.97%	0.04%	0.03%	218927018	109891942	10177739	3708420	366.39	160.00	0.71%	0.58%	0.98	0.000	123.7bp	117.0bp	0.01%	0.90%	0.64%	0.00%	0.03%	2.99%	1.01%	0.00%	0.02	No	0.00%	9999000000	222208070				60.8%	87.5%	94.9%	279.5M	36.0%	97.8%	68720.2Mb	588.9M	55.1%	98.2%	72.8%
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1_1																																				123.7bp	98.5%	290.2M												87.4%	54%	151bp	151bp	18%	516.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1_2																																																		86.1%	54%	151bp	151bp	18%	516.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1_trimmed_1																																																		83.3%	54%	119bp	122bp	9%	294.5M	83.3%	54%	119bp	122bp	9%	294.5M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1_trimmed_2																																																		83.6%	55%	119bp	122bp	9%	294.5M	83.6%	55%	119bp	122bp	9%	294.5M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2	569487091	0.9393	590783044	0.01%	0.75%	145309534	0.92%	0.96%	0.05%	0.04%	133403790	66983811	7949444	2974129	225.77	91.00	0.66%	0.48%	0.98	0.000	132.0bp	126.0bp	0.01%	0.83%	0.63%	0.00%	0.02%	2.78%	1.02%	0.00%	0.01	No	0.00%	9999000000	115382068				75.9%	88.3%	95.2%	281.2M	53.0%	97.6%	72063.8Mb	590.8M	55.7%	98.5%	67.3%
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2_1																																				132.0bp	98.5%	291.0M												89.7%	54%	151bp	151bp	18%	402.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2_2																																																		88.0%	55%	151bp	151bp	18%	402.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2_trimmed_1																																																		87.6%	55%	125bp	132bp	9%	295.4M	87.6%	55%	125bp	132bp	9%	295.4M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2_trimmed_2																																																		87.2%	55%	125bp	132bp	9%	295.4M	87.2%	55%	125bp	132bp	9%	295.4M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3	568984837	0.9448	590294298	0.01%	0.82%	105460840	0.90%	0.95%	0.06%	0.05%	95397036	47874051	6120000	2276928	159.83	62.00	0.61%	0.40%	0.98	0.000	133.0bp	125.0bp	0.00%	0.85%	0.67%	0.00%	0.01%	2.91%	1.09%	0.00%	0.01	No	0.00%	9999000000	89998602				82.7%	88.3%	95.2%	281.0M	59.7%	97.7%	72550.6Mb	590.3M	55.8%	98.4%	65.6%
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3_1																																				133.0bp	98.6%	290.9M												92.2%	54%	151bp	151bp	18%	491.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3_2																																																		90.8%	55%	151bp	151bp	18%	491.9M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3_trimmed_1																																																		89.6%	55%	126bp	132bp	18%	295.1M	89.6%	55%	126bp	132bp	18%	295.1M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3_trimmed_2																																																		89.6%	56%	126bp	132bp	18%	295.1M	89.6%	56%	126bp	132bp	18%	295.1M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1	555542560	0.9350	588077850	0.01%	0.76%	141869240	0.89%	0.94%	0.07%	0.06%	126498871	63508198	10084605	4001448	201.92	69.00	0.62%	0.43%	0.98	0.000	127.1bp	120.0bp	0.02%	1.23%	0.60%	0.00%	0.03%	3.59%	0.95%	0.00%	5.28	No	0.00%	9999000000	135180298				76.6%	83.3%	93.3%	274.4M	51.8%	97.4%	69879.6Mb	588.1M	59.6%	98.0%	70.5%
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1_1																																				127.1bp	97.7%	287.3M												88.1%	57%	151bp	151bp	18%	344.6M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1_2																																																		86.6%	58%	151bp	151bp	27%	344.6M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1_trimmed_1																																																		87.0%	59%	122bp	127bp	9%	294.0M	87.0%	59%	122bp	127bp	9%	294.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1_trimmed_2																																																		87.1%	59%	122bp	127bp	9%	294.0M	87.1%	59%	122bp	127bp	9%	294.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2	467803340	0.9264	493372714	0.01%	0.85%	73979982	0.85%	0.92%	0.09%	0.08%	62742786	31448749	6984274	2849475	99.85	31.00	0.51%	0.26%	0.98	0.000	132.9bp	125.0bp	0.01%	1.17%	0.58%	0.00%	0.02%	3.43%	0.93%	0.00%	5.19	No	0.00%	9999000000	66467431				85.7%	84.2%	93.7%	231.1M	63.1%	97.6%	60072.7Mb	493.4M	59.9%	97.9%	66.9%
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2_1																																				132.9bp	97.7%	240.9M												89.6%	58%	151bp	151bp	18%	252.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2_2																																																		87.7%	58%	151bp	151bp	18%	252.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2_trimmed_1																																																		89.6%	59%	125bp	132bp	9%	246.7M	89.6%	59%	125bp	132bp	9%	246.7M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2_trimmed_2																																																		89.4%	60%	125bp	132bp	9%	246.7M	89.4%	60%	125bp	132bp	9%	246.7M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3	327898571	0.9651	346909780	0.01%	0.89%	38718581	0.81%	0.90%	0.11%	0.10%	31487139	15749199	4082913	1671315	49.43	14.00	0.36%	0.12%	0.98	0.000	127.7bp	121.0bp	0.01%	1.26%	0.63%	0.00%	0.01%	3.69%	1.01%	0.00%	5.28	No	0.00%	9999000000	36420594				89.7%	83.5%	93.5%	162.1M	62.3%	97.5%	41339.8Mb	346.9M	60.0%	97.8%	69.2%
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3_1																																				127.7bp	97.6%	169.4M												91.2%	57%	151bp	151bp	18%	177.4M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3_2																																																		89.1%	58%	151bp	151bp	27%	177.4M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3_trimmed_1																																																		91.2%	59%	122bp	127bp	9%	173.5M	91.2%	59%	122bp	127bp	9%	173.5M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3_trimmed_2																																																		90.8%	60%	122bp	127bp	9%	173.5M	90.8%	60%	122bp	127bp	9%	173.5M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1	560375960	0.9317	590817390	0.01%	0.50%	295256983	0.94%	0.97%	0.04%	0.03%	277543561	139837722	12824986	4331526	520.44	223.00	0.73%	0.62%	0.98	0.000	139.8bp	130.0bp	0.01%	0.96%	0.74%	0.00%	0.02%	3.01%	1.13%	0.00%	6.15	No	0.00%	9999000000	365035093				50.4%	84.8%	93.8%	277.2M	32.1%	97.7%	73926.9Mb	590.8M	55.9%	98.5%	60.3%
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1_1																																				139.8bp	98.1%	289.8M												86.3%	54%	151bp	151bp	18%	576.3M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1_2																																																		85.4%	55%	151bp	151bp	18%	576.3M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1_trimmed_1																																																		81.6%	55%	128bp	137bp	9%	295.4M	81.6%	55%	128bp	137bp	9%	295.4M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1_trimmed_2																																																		82.1%	56%	128bp	137bp	9%	295.4M	82.1%	56%	128bp	137bp	9%	295.4M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2	560633748	0.9368	590751202	0.01%	0.58%	248355659	0.93%	0.97%	0.05%	0.03%	231883385	116848259	11797500	4040781	433.02	181.00	0.71%	0.59%	0.98	0.000	140.4bp	131.0bp	0.01%	0.94%	0.75%	0.00%	0.02%	2.94%	1.16%	0.00%	6.18	No	0.00%	9999000000	233216682				58.4%	84.9%	93.9%	277.4M	39.7%	97.8%	74201.0Mb	590.8M	56.1%	98.5%	59.2%
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2_1																																				140.4bp	98.1%	289.7M												86.0%	55%	151bp	151bp	18%	428.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2_2																																																		85.2%	55%	151bp	151bp	18%	428.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2_trimmed_1																																																		83.2%	55%	128bp	137bp	9%	295.4M	83.2%	55%	128bp	137bp	9%	295.4M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2_trimmed_2																																																		83.7%	56%	129bp	137bp	9%	295.4M	83.7%	56%	129bp	137bp	9%	295.4M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3	558498786	0.9592	589600056	0.01%	0.70%	176897539	0.92%	0.96%	0.05%	0.04%	162817218	82034485	9093107	3091527	300.59	120.00	0.68%	0.53%	0.98	0.000	142.0bp	132.0bp	0.00%	0.99%	0.80%	0.00%	0.01%	3.12%	1.22%	0.00%	6.18	No	0.00%	9990000000	133905193				70.6%	84.6%	93.8%	276.4M	51.0%	97.7%	74254.2Mb	589.6M	56.2%	98.3%	58.3%
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3_1																																				142.0bp	98.1%	289.3M												89.5%	54%	151bp	151bp	18%	458.1M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3_2																																																		88.3%	55%	151bp	151bp	18%	458.1M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3_trimmed_1																																																		86.6%	55%	129bp	137bp	9%	294.8M	86.6%	55%	129bp	137bp	9%	294.8M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3_trimmed_2																																																		86.8%	56%	129bp	137bp	9%	294.8M	86.8%	56%	129bp	137bp	9%	294.8M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1	564281773	0.9120	589451054	0.01%	0.75%	144546488	0.90%	0.94%	0.07%	0.06%	129699182	65174011	9796163	3813988	218.61	76.00	0.64%	0.45%	0.98	0.000	133.2bp	126.0bp	0.01%	0.74%	0.44%	0.00%	0.03%	2.43%	0.76%	0.00%	0.00	No	0.00%	9999000000	119577135				76.1%	86.4%	94.6%	278.9M	53.9%	97.5%	72251.2Mb	589.5M	59.8%	98.2%	65.6%
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1_1																																				133.2bp	97.8%	288.3M												88.2%	58%	151bp	151bp	18%	363.4M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1_2																																																		86.9%	58%	151bp	151bp	18%	363.4M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1_trimmed_1																																																		86.9%	59%	126bp	132bp	9%	294.7M	86.9%	59%	126bp	132bp	9%	294.7M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1_trimmed_2																																																		87.1%	60%	126bp	132bp	9%	294.7M	87.1%	60%	126bp	132bp	9%	294.7M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2	563246316	0.9100	588509548	0.01%	0.88%	73241660	0.84%	0.91%	0.10%	0.09%	61160633	30646514	7215413	2951221	99.48	31.00	0.51%	0.26%	0.98	0.000	130.9bp	123.0bp	0.01%	0.72%	0.44%	0.00%	0.02%	2.37%	0.78%	0.00%	0.02	No	0.00%	9999000000	65894488				88.3%	86.4%	94.7%	278.6M	62.3%	97.6%	71229.2Mb	588.5M	60.1%	98.1%	66.8%
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2_1																																				130.9bp	97.8%	287.9M												91.1%	58%	151bp	151bp	18%	313.3M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2_2																																																		89.5%	59%	151bp	151bp	18%	313.3M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2_trimmed_1																																																		91.0%	59%	124bp	127bp	9%	294.3M	91.0%	59%	124bp	127bp	9%	294.3M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2_trimmed_2																																																		90.9%	60%	124bp	127bp	9%	294.3M	90.9%	60%	124bp	127bp	9%	294.3M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3	330736107	0.9404	345862218	0.01%	0.88%	39925456	0.84%	0.92%	0.09%	0.08%	33355720	16702219	3676580	1471619	53.95	16.00	0.38%	0.14%	0.98	0.000	132.3bp	124.0bp	0.01%	0.77%	0.47%	0.00%	0.01%	2.56%	0.84%	0.00%	0.02	No	0.00%	9999000000	36589966				89.2%	86.2%	94.6%	163.6M	64.6%	97.6%	42061.9Mb	345.9M	60.3%	98.2%	66.3%
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3_1																																				132.3bp	97.9%	169.3M												91.0%	58%	151bp	151bp	18%	176.2M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3_2																																																		89.1%	59%	151bp	151bp	18%	176.2M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3_trimmed_1																																																		91.1%	60%	125bp	132bp	9%	172.9M	91.1%	60%	125bp	132bp	9%	172.9M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3_trimmed_2																																																		90.6%	60%	125bp	132bp	9%	172.9M	90.6%	60%	125bp	132bp	9%	172.9M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1	561301537	0.9372	590163640	0.01%	0.61%	227583893	0.93%	0.96%	0.05%	0.04%	212657006	106869257	10992196	4074733	351.64	125.00	0.67%	0.53%	0.98	0.000	124.0bp	117.0bp	0.03%	1.52%	0.65%	0.00%	0.05%	4.22%	0.90%	0.00%	5.45	Yes	0.00%	9999000000	197473406				61.8%	84.8%	94.0%	277.4M	38.3%	97.7%	69274.3Mb	590.2M	56.5%	98.4%	73.2%
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1_1																																				124.0bp	98.1%	289.5M												86.9%	55%	151bp	151bp	18%	487.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1_2																																																		85.8%	55%	151bp	151bp	18%	487.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1_trimmed_1																																																		83.1%	56%	120bp	122bp	9%	295.1M	83.1%	56%	120bp	122bp	9%	295.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1_trimmed_2																																																		83.5%	56%	120bp	122bp	9%	295.1M	83.5%	56%	120bp	122bp	9%	295.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2	562417509	0.9498	589522242	0.01%	0.74%	154589064	0.92%	0.95%	0.06%	0.05%	141815798	71207338	9036164	3431931	232.73	78.00	0.62%	0.46%	0.98	0.000	128.9bp	122.0bp	0.03%	1.46%	0.65%	0.00%	0.05%	4.12%	0.92%	0.00%	5.48	No	0.00%	9999000000	171067381				74.2%	85.7%	94.3%	278.1M	49.0%	97.4%	70407.5Mb	589.5M	56.4%	98.3%	70.1%
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2_1																																				128.9bp	98.1%	289.2M												88.8%	55%	151bp	151bp	18%	412.8M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2_2																																																		87.7%	56%	151bp	151bp	18%	412.8M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2_trimmed_1																																																		86.5%	56%	123bp	127bp	9%	294.8M	86.5%	56%	123bp	127bp	9%	294.8M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2_trimmed_2																																																		86.9%	56%	123bp	127bp	9%	294.8M	86.9%	56%	123bp	127bp	9%	294.8M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3	562518611	0.9677	590154944	0.01%	0.83%	98259758	0.89%	0.94%	0.07%	0.06%	87768801	44022646	6701966	2580860	141.13	45.00	0.56%	0.35%	0.98	0.000	128.7bp	122.0bp	0.01%	1.57%	0.70%	0.00%	0.02%	4.40%	0.98%	0.00%	5.55	No	0.00%	9999000000	77464169				83.9%	85.6%	94.3%	278.3M	58.7%	97.7%	70730.1Mb	590.2M	56.5%	98.4%	70.1%
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3_1																																				128.7bp	98.2%	289.6M												91.6%	54%	151bp	151bp	18%	400.6M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3_2																																																		90.0%	55%	151bp	151bp	18%	400.6M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3_trimmed_1																																																		90.0%	56%	123bp	127bp	9%	295.1M	90.0%	56%	123bp	127bp	9%	295.1M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3_trimmed_2																																																		89.9%	56%	123bp	127bp	9%	295.1M	89.9%	56%	123bp	127bp	9%	295.1M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1	568321667	0.9358	590804076	0.01%	0.67%	192340355	0.92%	0.95%	0.06%	0.05%	177705727	89199455	10982028	4390200	277.42	136.00	0.71%	0.56%	0.98	0.000	119.5bp	113.0bp	0.01%	1.54%	0.49%	0.00%	0.02%	4.52%	0.76%	0.00%	6.10	No	0.00%	9999000000	151416141				67.9%	87.8%	95.0%	280.6M	40.7%	97.8%	66934.5Mb	590.8M	53.2%	98.5%	78.0%
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1_1																																				119.5bp	97.9%	289.2M												85.3%	51%	151bp	151bp	18%	334.2M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1_2																																																		83.8%	53%	151bp	151bp	18%	334.2M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1_trimmed_1																																																		84.3%	52%	116bp	117bp	9%	295.4M	84.3%	52%	116bp	117bp	9%	295.4M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1_trimmed_2																																																		84.1%	53%	116bp	117bp	9%	295.4M	84.1%	53%	116bp	117bp	9%	295.4M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2	137850475	0.9394	146067656	0.01%	0.83%	24831667	0.77%	0.84%	0.16%	0.16%	19116450	9564133	3901666	1784741	26.25	9.00	0.23%	0.04%	0.98	0.000	113.1bp	109.0bp	0.01%	1.29%	0.42%	0.00%	0.02%	3.66%	0.66%	0.00%	5.88	No	0.00%	9999000000	26467702				84.0%	80.8%	93.2%	68.0M	50.2%	97.4%	16007.8Mb	146.1M	56.7%	97.7%	82.7%
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2_1																																				113.1bp	95.4%	69.7M												86.0%	54%	151bp	151bp	18%	74.8M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2_2																																																		84.1%	56%	151bp	151bp	27%	74.8M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2_trimmed_1																																																		86.0%	56%	112bp	112bp	9%	73.0M	86.0%	56%	112bp	112bp	9%	73.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2_trimmed_2																																																		85.7%	56%	113bp	112bp	9%	73.0M	85.7%	56%	113bp	112bp	9%	73.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3	526058315	0.9488	546506532	0.01%	0.84%	89898476	0.89%	0.94%	0.07%	0.06%	79782464	39992793	6686313	2730343	121.61	54.00	0.60%	0.36%	0.98	0.000	122.2bp	116.0bp	0.00%	1.55%	0.54%	0.00%	0.01%	4.54%	0.84%	0.00%	6.11	No	0.00%	9999000000	69763006				84.1%	87.9%	95.0%	259.5M	54.9%	97.8%	62914.2Mb	546.5M	53.7%	98.6%	76.4%
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3_1																																				122.2bp	98.0%	267.8M												89.3%	52%	151bp	151bp	18%	277.2M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3_2																																																		88.0%	53%	151bp	151bp	18%	277.2M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3_trimmed_1																																																		89.3%	53%	118bp	117bp	9%	273.3M	89.3%	53%	118bp	117bp	9%	273.3M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3_trimmed_2																																																		89.2%	53%	118bp	117bp	9%	273.3M	89.2%	53%	118bp	117bp	9%	273.3M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1	571034070	0.9384	590300698	0.01%	0.58%	248879242	0.94%	0.97%	0.05%	0.03%	232993038	117445748	12239595	4226600	427.11	208.00	0.74%	0.62%	0.98	0.000	142.1bp	132.0bp	0.01%	0.98%	0.41%	0.00%	0.01%	3.02%	0.66%	0.00%	0.01	No	0.00%	9999000000	233155166				58.2%	90.0%	95.6%	282.2M	40.0%	97.8%	74089.5Mb	590.3M	55.2%	98.4%	60.0%
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1_1																																				142.1bp	98.0%	289.2M												84.5%	54%	151bp	151bp	18%	372.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1_2																																																		83.5%	54%	151bp	151bp	18%	372.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1_trimmed_1																																																		82.7%	54%	128bp	137bp	9%	295.2M	82.7%	54%	128bp	137bp	9%	295.2M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1_trimmed_2																																																		83.0%	55%	128bp	137bp	9%	295.2M	83.0%	55%	128bp	137bp	9%	295.2M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2	567708982	0.9588	588205696	0.01%	0.70%	174863062	0.93%	0.96%	0.05%	0.04%	161756223	81379550	9457152	3328453	279.87	134.00	0.70%	0.55%	0.98	0.000	135.6bp	125.0bp	0.00%	1.10%	0.46%	0.00%	0.01%	3.32%	0.73%	0.00%	0.01	No	0.00%	9999000000	149701314				70.7%	89.5%	95.5%	280.7M	47.9%	97.8%	71684.2Mb	588.2M	54.8%	98.0%	63.8%
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2_1																																				135.6bp	98.1%	288.6M												88.8%	53%	151bp	151bp	18%	434.5M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2_2																																																		87.4%	54%	151bp	151bp	18%	434.5M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2_trimmed_1																																																		85.9%	54%	125bp	132bp	9%	294.1M	85.9%	54%	125bp	132bp	9%	294.1M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2_trimmed_2																																																		86.3%	55%	125bp	132bp	9%	294.1M	86.3%	55%	125bp	132bp	9%	294.1M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3	481307667	0.9702	498079272	0.01%	0.76%	119504397	0.92%	0.96%	0.06%	0.04%	109419964	55069973	7088961	2508280	192.63	88.00	0.66%	0.47%	0.98	0.000	140.1bp	130.0bp	0.00%	1.05%	0.46%	0.00%	0.01%	3.19%	0.72%	0.00%	0.03	No	0.00%	9999000000	103507699				76.5%	90.0%	95.6%	238.1M	55.4%	97.8%	62188.4Mb	498.1M	55.2%	98.2%	60.8%
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3_1																																				140.1bp	98.1%	244.3M												87.3%	53%	151bp	151bp	18%	253.5M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3_2																																																		85.9%	55%	151bp	151bp	18%	253.5M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3_trimmed_1																																																		87.3%	54%	128bp	137bp	9%	249.0M	87.3%	54%	128bp	137bp	9%	249.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3_trimmed_2																																																		87.4%	55%	128bp	137bp	9%	249.0M	87.4%	55%	128bp	137bp	9%	249.0M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1	26515984	0.8557	28219820	0.01%	0.78%	6232693	0.82%	0.87%	0.14%	0.13%	5118250	2558641	849643	393214	6.12	2.00	0.03%	0.00%	0.98	0.000	97.6bp	94.0bp	0.04%	1.60%	0.46%	0.00%	0.07%	4.31%	0.64%	0.00%	0.00	No	0.00%	9999000000	7293737				78.7%	79.4%	92.7%	13.1M	36.9%	97.7%	2745.4Mb	28.2M	53.0%	95.9%	89.7%
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1_1																																				97.6bp	96.5%	13.6M												79.6%	52%	151bp	151bp	36%	14.7M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1_2																																																		78.0%	55%	151bp	151bp	36%	14.7M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1_trimmed_1																																																		79.1%	52%	99bp	97bp	9%	14.1M	79.1%	52%	99bp	97bp	9%	14.1M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1_trimmed_2																																																		78.6%	53%	100bp	97bp	9%	14.1M	78.6%	53%	100bp	97bp	9%	14.1M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2	36516280	0.9170	38636268	0.01%	0.82%	6802930	0.83%	0.89%	0.12%	0.11%	5672534	2835413	786902	356322	7.01	2.00	0.04%	0.01%	0.98	0.000	101.1bp	97.0bp	0.01%	1.64%	0.52%	0.00%	0.03%	4.45%	0.73%	0.00%	0.01	No	0.00%	9999000000	7648570				83.1%	81.9%	93.1%	18.0M	39.9%	97.7%	3869.6Mb	38.6M	53.5%	97.5%	89.1%
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2_1																																				101.1bp	97.5%	18.8M												83.6%	52%	151bp	151bp	27%	19.8M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2_2																																																		82.1%	54%	151bp	151bp	36%	19.8M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2_trimmed_1																																																		83.5%	53%	102bp	102bp	9%	19.3M	83.5%	53%	102bp	102bp	9%	19.3M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2_trimmed_2																																																		83.1%	53%	103bp	102bp	9%	19.3M	83.1%	53%	103bp	102bp	9%	19.3M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3	27149332	0.9276	28608870	0.01%	0.83%	4798177	0.83%	0.89%	0.12%	0.11%	3993522	1995825	562670	254859	4.97	2.00	0.02%	0.00%	0.98	0.000	106.0bp	102.0bp	0.01%	1.62%	0.52%	0.00%	0.02%	4.42%	0.73%	0.00%	0.01	No	0.00%	9999000000	5187946				83.9%	83.0%	93.5%	13.4M	45.2%	97.8%	2960.3Mb	28.6M	53.0%	97.0%	87.1%
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3_1																																				106.0bp	97.5%	14.0M												84.1%	52%	151bp	151bp	18%	14.8M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3_2																																																		82.8%	53%	151bp	151bp	36%	14.8M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3_trimmed_1																																																		83.9%	52%	106bp	107bp	9%	14.3M	83.9%	52%	106bp	107bp	9%	14.3M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3_trimmed_2																																																		83.7%	53%	106bp	107bp	9%	14.3M	83.7%	53%	106bp	107bp	9%	14.3M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1	563126028	0.9340	590613352	0.01%	0.51%	290629747	0.94%	0.97%	0.05%	0.03%	272622233	137319175	13242512	4620090	501.96	224.00	0.73%	0.62%	0.98	0.000	136.9bp	129.0bp	0.01%	0.96%	0.54%	0.00%	0.01%	2.95%	0.82%	0.00%	0.00	No	0.00%	9999000000	334083405				51.2%	86.5%	94.3%	278.4M	32.3%	97.8%	73380.5Mb	590.6M	54.8%	98.4%	62.4%
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1_1																																				136.9bp	98.1%	289.6M												84.4%	54%	151bp	151bp	18%	482.1M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1_2																																																		83.5%	54%	151bp	151bp	18%	482.1M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1_trimmed_1																																																		80.6%	54%	127bp	132bp	9%	295.3M	80.6%	54%	127bp	132bp	9%	295.3M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1_trimmed_2																																																		81.0%	55%	127bp	137bp	9%	295.3M	81.0%	55%	127bp	137bp	9%	295.3M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2	563633542	0.9382	590104632	0.01%	0.59%	241295979	0.93%	0.97%	0.05%	0.03%	224943495	113328057	11506038	3929595	416.20	181.00	0.72%	0.60%	0.98	0.000	141.4bp	132.0bp	0.00%	1.00%	0.59%	0.00%	0.01%	3.05%	0.90%	0.00%	0.01	No	0.00%	9999000000	214690071				59.6%	87.0%	94.5%	278.7M	40.7%	97.8%	74360.2Mb	590.1M	55.0%	98.4%	59.7%
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2_1																																				141.4bp	98.1%	289.5M												86.1%	54%	151bp	151bp	18%	467.6M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2_2																																																		85.2%	54%	151bp	151bp	18%	467.6M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2_trimmed_1																																																		82.4%	54%	129bp	137bp	9%	295.1M	82.4%	54%	129bp	137bp	9%	295.1M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2_trimmed_2																																																		82.9%	55%	129bp	137bp	9%	295.1M	82.9%	55%	129bp	137bp	9%	295.1M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3	564469752	0.9522	590325678	0.01%	0.72%	164255274	0.92%	0.96%	0.06%	0.04%	150527870	75776299	9207552	3303101	268.02	111.00	0.67%	0.52%	0.98	0.000	139.3bp	130.0bp	0.00%	1.01%	0.60%	0.00%	0.01%	3.06%	0.91%	0.00%	0.00	No	0.00%	9999000000	122858259				72.7%	87.3%	94.7%	279.4M	51.5%	97.8%	73284.2Mb	590.3M	55.1%	98.4%	62.0%
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3_1																																				139.3bp	98.1%	289.7M												88.1%	54%	151bp	151bp	18%	372.2M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3_2																																																		86.8%	55%	151bp	151bp	18%	372.2M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3_trimmed_1																																																		86.4%	54%	127bp	132bp	9%	295.2M	86.4%	54%	127bp	132bp	9%	295.2M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3_trimmed_2																																																		86.5%	55%	127bp	137bp	9%	295.2M	86.5%	55%	127bp	137bp	9%	295.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1	422767668	0.9238	440473454	0.01%	0.55%	199099293	0.93%	0.96%	0.05%	0.04%	185307707	93087965	10790546	4247635	306.13	152.00	0.72%	0.58%	0.98	0.000	124.8bp	118.0bp	0.01%	1.52%	0.50%	0.00%	0.02%	4.48%	0.76%	0.00%	0.01	Yes	0.00%	9999000000	195429433				55.2%	87.2%	94.7%	208.6M	33.6%	97.7%	51672.1Mb	440.5M	53.8%	98.5%	73.1%
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1_1																																				124.8bp	97.9%	215.7M												79.2%	52%	151bp	151bp	18%	223.7M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1_2																																																		78.1%	54%	151bp	151bp	27%	223.7M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1_trimmed_1																																																		79.2%	53%	120bp	122bp	9%	220.2M	79.2%	53%	120bp	122bp	9%	220.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1_trimmed_2																																																		79.3%	54%	120bp	122bp	9%	220.2M	79.3%	54%	120bp	122bp	9%	220.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2	500986893	0.9353	521279578	0.01%	0.75%	129557341	0.90%	0.94%	0.07%	0.06%	116811179	58646076	9323301	3836192	187.17	88.00	0.67%	0.47%	0.98	0.000	126.0bp	119.0bp	0.01%	1.48%	0.50%	0.00%	0.01%	4.40%	0.76%	0.00%	0.01	No	0.00%	9999000000	103997269				75.6%	87.8%	94.9%	247.3M	50.5%	97.8%	61604.1Mb	521.3M	53.8%	98.5%	72.3%
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2_1																																				126.0bp	98.0%	255.5M												85.9%	52%	151bp	151bp	18%	264.6M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2_2																																																		84.8%	53%	151bp	151bp	27%	264.6M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2_trimmed_1																																																		85.9%	53%	121bp	122bp	9%	260.6M	85.9%	53%	121bp	122bp	9%	260.6M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2_trimmed_2																																																		86.1%	54%	121bp	122bp	9%	260.6M	86.1%	54%	121bp	122bp	9%	260.6M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3	568368688	0.9410	590751894	0.01%	0.85%	89785098	0.87%	0.93%	0.09%	0.07%	78214136	39243601	7638461	3121898	127.00	58.00	0.62%	0.37%	0.98	0.000	131.5bp	124.0bp	0.00%	1.57%	0.53%	0.00%	0.01%	4.69%	0.81%	0.00%	0.06	No	0.00%	9999000000	72005608				85.4%	88.0%	95.0%	280.5M	61.6%	97.8%	71929.5Mb	590.8M	53.7%	98.5%	68.0%
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3_1																																				131.5bp	98.1%	289.7M												90.3%	52%	151bp	151bp	18%	322.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3_2																																																		88.8%	53%	151bp	151bp	18%	322.2M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3_trimmed_1																																																		89.9%	53%	124bp	127bp	9%	295.4M	89.9%	53%	124bp	127bp	9%	295.4M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3_trimmed_2																																																		89.8%	54%	125bp	127bp	9%	295.4M	89.8%	54%	125bp	127bp	9%	295.4M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1	527751459	0.9121	547985064	0.01%	0.69%	168385770	0.92%	0.94%	0.07%	0.06%	154099582	77345820	10964860	4516196	239.62	109.00	0.66%	0.52%	0.98	0.000	123.0bp	118.0bp	0.01%	2.94%	0.67%	0.00%	0.02%	8.18%	1.01%	0.00%	0.02	No	0.00%	9999000000	143618224				69.7%	87.7%	95.1%	260.5M	45.9%	97.8%	63793.5Mb	548.0M	53.3%	98.6%	75.9%
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1_1																																				123.0bp	97.9%	268.3M												85.1%	52%	151bp	151bp	18%	277.9M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1_2																																																		84.1%	53%	151bp	151bp	27%	277.9M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1_trimmed_1																																																		85.2%	53%	119bp	122bp	9%	274.0M	85.2%	53%	119bp	122bp	9%	274.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1_trimmed_2																																																		85.3%	53%	119bp	122bp	9%	274.0M	85.3%	53%	119bp	122bp	9%	274.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2	568171771	0.9310	591263808	0.01%	0.81%	109591411	0.89%	0.93%	0.08%	0.07%	97749917	48991720	8252441	3429427	145.44	62.00	0.61%	0.40%	0.98	0.000	117.3bp	111.0bp	0.01%	3.17%	0.73%	0.00%	0.01%	8.80%	1.11%	0.00%	0.01	No	0.00%	9999000000	87881136				82.0%	87.1%	94.9%	280.6M	51.0%	97.8%	66773.7Mb	591.3M	53.8%	98.5%	78.7%
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2_1																																				117.3bp	98.2%	290.2M												88.9%	52%	151bp	151bp	18%	300.3M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2_2																																																		88.0%	53%	151bp	151bp	18%	300.3M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2_trimmed_1																																																		88.9%	53%	115bp	117bp	9%	295.6M	88.9%	53%	115bp	117bp	9%	295.6M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2_trimmed_2																																																		89.2%	54%	116bp	117bp	9%	295.6M	89.2%	54%	116bp	117bp	9%	295.6M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3	406679072	0.9430	423041866	0.01%	0.86%	60224721	0.87%	0.92%	0.09%	0.08%	52114731	26091479	5392329	2242905	78.81	32.00	0.51%	0.23%	0.98	0.000	121.5bp	115.0bp	0.01%	3.06%	0.72%	0.00%	0.01%	8.59%	1.10%	0.00%	0.01	No	0.00%	9990000000	55567953				86.3%	87.2%	94.9%	200.8M	57.0%	97.7%	49178.8Mb	423.0M	53.8%	98.1%	75.0%
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3_1																																				121.5bp	98.1%	207.5M												90.2%	53%	151bp	151bp	18%	215.5M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3_2																																																		88.7%	54%	151bp	151bp	18%	215.5M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3_trimmed_1																																																		90.2%	53%	119bp	122bp	9%	211.5M	90.2%	53%	119bp	122bp	9%	211.5M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3_trimmed_2																																																		90.2%	54%	119bp	122bp	9%	211.5M	90.2%	54%	119bp	122bp	9%	211.5M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1	565389040	0.9234	589386616	0.01%	0.70%	179212965	0.91%	0.95%	0.06%	0.05%	163656604	82079935	11122946	4491798	252.44	121.00	0.69%	0.54%	0.98	0.000	120.4bp	115.0bp	0.01%	1.20%	0.69%	0.00%	0.02%	3.41%	0.98%	0.00%	0.01	No	0.00%	9999000000	151706651				70.1%	86.8%	94.6%	278.7M	43.7%	97.7%	67649.5Mb	589.4M	54.6%	98.2%	77.0%
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1_1																																				120.4bp	97.7%	288.0M												84.7%	53%	151bp	151bp	18%	316.2M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1_2																																																		83.2%	54%	151bp	151bp	18%	316.2M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1_trimmed_1																																																		84.2%	54%	117bp	117bp	9%	294.7M	84.2%	54%	117bp	117bp	9%	294.7M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1_trimmed_2																																																		84.1%	54%	118bp	117bp	9%	294.7M	84.1%	54%	118bp	117bp	9%	294.7M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2	393397565	0.9545	410404990	0.01%	0.77%	96033508	0.90%	0.94%	0.07%	0.06%	86762527	43496074	6284741	2557476	130.44	58.00	0.61%	0.38%	0.98	0.000	118.5bp	113.0bp	0.01%	1.29%	0.77%	0.00%	0.01%	3.66%	1.08%	0.00%	0.04	No	0.00%	9999000000	79095447				77.2%	86.6%	94.6%	194.1M	48.4%	97.8%	46467.5Mb	410.4M	54.9%	98.3%	78.5%
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2_1																																				118.5bp	97.9%	200.9M												85.7%	53%	151bp	151bp	18%	208.7M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2_2																																																		84.5%	54%	151bp	151bp	18%	208.7M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2_trimmed_1																																																		85.8%	54%	116bp	117bp	9%	205.2M	85.8%	54%	116bp	117bp	9%	205.2M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2_trimmed_2																																																		85.8%	55%	116bp	117bp	9%	205.2M	85.8%	55%	116bp	117bp	9%	205.2M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3	399949864	0.9680	417000160	0.01%	0.87%	54443078	0.86%	0.92%	0.09%	0.08%	46642539	23330366	4798047	2000868	68.76	29.00	0.50%	0.20%	0.98	0.000	119.6bp	114.0bp	0.01%	1.26%	0.76%	0.00%	0.01%	3.60%	1.08%	0.00%	0.02	No	0.00%	9999000000	47803888				87.6%	86.9%	94.7%	197.4M	57.4%	97.8%	47781.5Mb	417.0M	54.9%	98.2%	77.6%
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3_1																																				119.6bp	97.9%	204.2M												90.2%	53%	151bp	151bp	18%	212.4M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3_2																																																		88.5%	54%	151bp	151bp	18%	212.4M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3_trimmed_1																																																		90.3%	54%	117bp	117bp	9%	208.5M	90.3%	54%	117bp	117bp	9%	208.5M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3_trimmed_2																																																		90.1%	55%	117bp	117bp	9%	208.5M	90.1%	55%	117bp	117bp	9%	208.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1	570853046	0.9335	590852666	0.01%	0.50%	294694175	0.94%	0.97%	0.05%	0.03%	276987576	139420889	13916706	5013912	495.96	268.00	0.77%	0.66%	0.98	0.000	135.8bp	127.0bp	0.01%	1.08%	0.55%	0.00%	0.02%	3.29%	0.81%	0.00%	0.01	Yes	0.00%	9999000000	325750534				50.4%	89.2%	95.5%	282.0M	31.7%	97.8%	72611.7Mb	590.9M	55.1%	98.5%	64.2%
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1_1																																				135.8bp	98.0%	289.6M												82.6%	54%	151bp	151bp	18%	417.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1_2																																																		81.8%	54%	151bp	151bp	18%	417.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1_trimmed_1																																																		79.7%	54%	126bp	132bp	9%	295.4M	79.7%	54%	126bp	132bp	9%	295.4M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1_trimmed_2																																																		80.1%	55%	126bp	132bp	9%	295.4M	80.1%	55%	126bp	132bp	9%	295.4M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2	570831268	0.9475	590697842	0.01%	0.59%	240315057	0.94%	0.97%	0.05%	0.03%	224844876	113226562	11636851	4102558	405.13	213.00	0.76%	0.63%	0.98	0.000	138.4bp	130.0bp	0.00%	1.10%	0.59%	0.00%	0.01%	3.37%	0.88%	0.00%	0.01	Yes	0.00%	9999000000	207075388				59.7%	89.3%	95.5%	282.0M	41.1%	97.7%	73741.1Mb	590.7M	55.4%	98.4%	61.4%
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2_1																																				138.4bp	98.1%	289.8M												85.8%	54%	151bp	151bp	18%	458.2M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2_2																																																		84.7%	55%	151bp	151bp	18%	458.2M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2_trimmed_1																																																		82.2%	55%	128bp	137bp	9%	295.3M	82.2%	55%	128bp	137bp	9%	295.3M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2_trimmed_2																																																		82.4%	55%	128bp	137bp	9%	295.3M	82.4%	55%	128bp	137bp	9%	295.3M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3	569819072	0.9589	589776042	0.01%	0.72%	162456565	0.92%	0.96%	0.06%	0.04%	149484900	75199054	9310521	3389410	260.50	132.00	0.71%	0.56%	0.98	0.000	138.0bp	129.0bp	0.00%	1.09%	0.60%	0.00%	0.01%	3.32%	0.89%	0.00%	0.01	No	0.00%	9999000000	132536177				72.9%	89.4%	95.5%	281.7M	52.7%	97.7%	73118.7Mb	589.8M	55.7%	98.3%	62.8%
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3_1																																				138.0bp	98.2%	289.5M												88.7%	54%	151bp	151bp	18%	419.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3_2																																																		87.4%	55%	151bp	151bp	18%	419.5M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3_trimmed_1																																																		86.2%	55%	127bp	132bp	9%	294.9M	86.2%	55%	127bp	132bp	9%	294.9M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3_trimmed_2																																																		86.3%	55%	127bp	132bp	9%	294.9M	86.3%	55%	127bp	132bp	9%	294.9M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1	567841176	0.9239	589777672	0.01%	0.57%	251947725	0.93%	0.96%	0.05%	0.04%	234636719	118023005	13192251	4920572	410.49	180.00	0.72%	0.60%	0.98	0.000	133.5bp	125.0bp	0.01%	1.28%	0.64%	0.00%	0.01%	3.76%	0.93%	0.00%	0.01	No	0.00%	9999000000	232920978				57.7%	88.1%	95.2%	280.8M	37.2%	97.7%	71773.4Mb	589.8M	56.4%	98.3%	65.9%
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1_1																																				133.5bp	97.9%	288.8M												84.4%	55%	151bp	151bp	18%	397.8M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1_2																																																		83.3%	56%	151bp	151bp	18%	397.8M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1_trimmed_1																																																		81.9%	56%	124bp	132bp	9%	294.9M	81.9%	56%	124bp	132bp	9%	294.9M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1_trimmed_2																																																		82.3%	56%	125bp	132bp	9%	294.9M	82.3%	56%	125bp	132bp	9%	294.9M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2	567979751	0.9370	590143942	0.01%	0.71%	170754366	0.92%	0.95%	0.06%	0.05%	156777628	78818951	9978298	3771778	266.31	112.00	0.67%	0.52%	0.98	0.000	132.7bp	125.0bp	0.00%	1.38%	0.70%	0.00%	0.00%	4.04%	1.00%	0.00%	0.01	No	0.00%	9999000000	135135818				71.6%	88.2%	95.3%	281.1M	48.9%	97.7%	71618.6Mb	590.1M	56.4%	98.4%	66.7%
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2_1																																				132.7bp	98.1%	289.4M												89.5%	55%	151bp	151bp	18%	498.1M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2_2																																																		88.2%	56%	151bp	151bp	18%	498.1M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2_trimmed_1																																																		85.7%	56%	124bp	127bp	9%	295.1M	85.7%	56%	124bp	127bp	9%	295.1M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2_trimmed_2																																																		86.0%	56%	124bp	132bp	9%	295.1M	86.0%	56%	124bp	132bp	9%	295.1M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3	566501191	0.9486	588431562	0.01%	0.82%	106648968	0.89%	0.94%	0.07%	0.06%	94971198	47662897	7650329	2918208	158.75	63.00	0.61%	0.40%	0.98	0.000	135.6bp	128.0bp	0.00%	1.33%	0.70%	0.00%	0.00%	3.91%	1.01%	0.00%	0.01	No	0.00%	9999000000	104962375				82.4%	88.4%	95.3%	280.4M	59.3%	97.5%	72184.7Mb	588.4M	56.6%	98.1%	64.5%
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3_1																																				135.6bp	98.1%	288.7M												90.9%	55%	151bp	151bp	18%	391.5M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3_2																																																		89.1%	56%	151bp	151bp	18%	391.5M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3_trimmed_1																																																		89.4%	56%	126bp	132bp	9%	294.2M	89.4%	56%	126bp	132bp	9%	294.2M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3_trimmed_2																																																		89.3%	56%	126bp	132bp	9%	294.2M	89.3%	56%	126bp	132bp	9%	294.2M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1	572053443	0.9470	590477700	0.01%	0.40%	355191479	0.94%	0.98%	0.05%	0.02%	335519408	170605181	16552720	3910401	779.75	309.00	0.72%	0.63%	0.98	0.000	190.3bp	172.0bp	0.01%	1.97%	0.84%	0.00%	0.02%	5.75%	1.19%	0.00%	4.00	Yes	61.46%	9999000000	595408904				40.1%	90.6%	96.1%	283.8M	30.6%	97.6%	80912.2Mb	590.5M	54.4%	98.4%	31.7%
FFPE_HD789_01_RNA_13_A23WKFTLT4_1_1																																				190.3bp	98.0%	289.2M												89.5%	53%	151bp	151bp	18%	770.1M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1_2																																																		88.4%	54%	151bp	151bp	18%	770.1M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1_trimmed_1																																																		84.3%	53%	140bp	151bp	9%	295.2M	84.3%	53%	140bp	151bp	9%	295.2M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1_trimmed_2																																																		84.8%	54%	140bp	151bp	9%	295.2M	84.8%	54%	140bp	151bp	9%	295.2M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1	568076695	0.9685	590454624	0.01%	0.56%	261625162	0.93%	0.97%	0.06%	0.03%	242551865	123307989	14604275	4112177	517.72	125.00	0.59%	0.52%	0.98	0.000	170.5bp	154.0bp	0.00%	2.13%	1.44%	0.00%	0.01%	5.80%	1.98%	0.00%	6.66	No	0.00%	9999000000	250980668				56.1%	88.7%	95.3%	281.5M	42.9%	97.6%	78970.2Mb	590.5M	54.9%	98.4%	40.0%
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1_1																																				170.5bp	96.7%	285.5M												89.5%	53%	151bp	151bp	18%	489.4M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1_2																																																		88.6%	55%	151bp	151bp	18%	489.4M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1_trimmed_1																																																		86.5%	54%	137bp	151bp	9%	295.2M	86.5%	54%	137bp	151bp	9%	295.2M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1_trimmed_2																																																		87.0%	55%	137bp	151bp	9%	295.2M	87.0%	55%	137bp	151bp	9%	295.2M
NTC_0001_0001_A23WKFTLT4_1	685	0.4304	2660	0.50%	0.28%	1920	0.09%	0.30%	0.22%	0.70%	164	86	421	197	0.00	0.00	0.00%	0.00%	0.95	0.000	141.0bp	133.0bp	0.49%	0.31%	0.00%	0.00%	0.35%	1.19%	0.00%	0.00%	0.00	Skipped	N/A%	9999000000	1202				55.8%	8.3%	24.4%	0.0M	41.3%	87.9%	0.3Mb	0.0M	69.5%	3.1%	50.0%
NTC_0001_0001_A23WKFTLT4_1_1																																				141.0bp	25.3%	0.0M												97.1%	74%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23WKFTLT4_1_2																																																		93.1%	97%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23WKFTLT4_1_trimmed_1																																																		47.8%	65%	112bp	142bp	36%	0.0M	47.8%	65%	112bp	142bp	36%	0.0M
NTC_0001_0001_A23WKFTLT4_1_trimmed_2																																																		53.3%	73%	113bp	151bp	55%	0.0M	53.3%	73%	113bp	151bp	55%	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RSeQC	Unique Reads	Reads with mapq >= mapq_cut (uniquely mapped)	`unique_reads_rseqc`	None
\|\|	Custom content: RSeQC	Frac Antisense	Fraction of reads explained by antisense orientation (1+-,1-+,2++,2--)	`frac_antisense`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Expression QC	ChrY Signature Score	Mean log2(TPM+1) score for chrY signature genes; used for sex verification.	`score_log2tpm1_mean_chry_signature`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_1	355.4M	0.0M	0.0M	35.2M	2.5M	304.5M	152.4M	152.1M	152.3M	152.2M	188.1M	116.4M	302.9M	0.0M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_2	186.9M	0.0M	0.0M	19.0M	1.5M	159.3M	79.7M	79.6M	79.7M	79.6M	98.3M	61.0M	158.4M	0.0M
BVT_FFPE_TRNA_bld_01_A23WKFTLT4_3	84.7M	0.0M	0.0M	8.5M	0.6M	72.4M	36.2M	36.2M	36.2M	36.2M	44.1M	28.2M	72.0M	0.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_1	644.8M	0.0M	0.0M	50.8M	3.3M	569.9M	285.1M	284.8M	285.0M	284.9M	322.3M	247.6M	567.7M	0.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_2	633.2M	0.0M	0.0M	48.1M	3.2M	562.2M	281.2M	281.0M	281.2M	281.0M	306.1M	256.1M	559.7M	0.0M
BVT_FFPE_TRNA_bld_02_A23WKFTLT4_3	562.9M	0.0M	0.0M	43.3M	2.8M	499.0M	249.6M	249.4M	249.6M	249.5M	273.7M	225.4M	496.9M	0.0M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_1	632.9M	0.0M	0.0M	52.4M	3.9M	556.1M	278.3M	277.8M	278.1M	278.0M	342.2M	213.8M	553.8M	0.0M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_2	493.4M	0.0M	0.0M	42.5M	3.2M	431.3M	215.8M	215.5M	215.7M	215.6M	266.2M	165.1M	429.6M	0.0M
BVT_FFPE_TRNA_brn_01_A23WKFTLT4_3	357.7M	0.0M	0.0M	28.8M	2.3M	315.0M	157.6M	157.4M	157.5M	157.5M	186.8M	128.3M	313.8M	0.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_1	590.0M	0.0M	0.0M	49.5M	3.9M	516.4M	258.4M	258.0M	258.3M	258.1M	292.7M	223.7M	514.0M	0.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_2	443.2M	0.0M	0.0M	35.8M	3.0M	389.8M	195.0M	194.8M	195.0M	194.8M	215.4M	174.4M	387.9M	0.0M
BVT_FFPE_TRNA_bst_01_01_A23WKFTLT4_3	599.7M	0.0M	0.0M	49.3M	3.9M	526.2M	263.2M	262.9M	263.2M	263.0M	290.4M	235.7M	523.7M	0.0M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_1	468.0M	0.0M	0.0M	40.4M	3.1M	408.2M	204.2M	203.9M	204.2M	204.0M	234.0M	174.1M	406.3M	0.0M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_2	480.6M	0.0M	0.0M	41.4M	3.1M	419.3M	209.8M	209.5M	209.7M	209.6M	243.2M	176.1M	417.3M	0.0M
BVT_FFPE_TRNA_bst_01_02_A23WKFTLT4_3	330.3M	0.0M	0.0M	28.3M	2.2M	288.3M	144.2M	144.1M	144.2M	144.1M	161.4M	126.9M	286.9M	0.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_1	584.3M	0.0M	0.0M	49.5M	3.8M	510.8M	255.6M	255.2M	255.5M	255.3M	298.2M	212.5M	508.6M	0.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_2	563.3M	0.0M	0.0M	46.8M	3.8M	493.7M	247.0M	246.7M	247.0M	246.7M	278.0M	215.7M	491.3M	0.0M
BVT_FFPE_TRNA_bst_01_03_A23WKFTLT4_3	435.2M	0.0M	0.0M	38.6M	3.0M	378.2M	189.2M	189.0M	189.2M	189.0M	217.8M	160.4M	376.4M	0.0M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_1	636.5M	0.0M	0.0M	42.1M	3.8M	572.6M	286.5M	286.1M	286.4M	286.2M	296.9M	275.7M	570.3M	0.0M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_2	633.3M	0.0M	0.0M	41.2M	3.8M	570.6M	285.5M	285.1M	285.4M	285.2M	292.7M	277.8M	568.4M	0.0M
BVT_FFPE_TRNA_bst_02_A23WKFTLT4_3	631.3M	0.0M	0.0M	39.4M	3.9M	570.7M	285.6M	285.2M	285.5M	285.3M	282.5M	288.2M	568.4M	0.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_1	580.2M	0.0M	0.0M	43.1M	3.8M	515.9M	258.2M	257.7M	258.0M	257.8M	278.9M	236.9M	513.8M	0.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_2	580.5M	0.0M	0.0M	44.5M	3.8M	514.5M	257.5M	257.0M	257.3M	257.1M	277.8M	236.6M	512.5M	0.0M
BVT_FFPE_TRNA_bst_04_A23WKFTLT4_3	411.0M	0.0M	0.0M	30.7M	2.7M	365.2M	182.7M	182.4M	182.6M	182.5M	194.5M	170.6M	363.8M	0.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_1	597.4M	0.0M	0.0M	50.9M	4.3M	522.3M	261.3M	260.9M	261.2M	261.1M	281.2M	241.0M	520.1M	0.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_2	647.2M	0.0M	0.0M	54.3M	4.5M	566.9M	283.6M	283.3M	283.5M	283.4M	303.5M	263.3M	564.7M	0.0M
BVT_FFPE_TRNA_bst_05_A23WKFTLT4_3	509.1M	0.0M	0.0M	44.9M	3.6M	442.8M	221.5M	221.3M	221.5M	221.3M	239.0M	203.8M	441.1M	0.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_1	641.9M	0.0M	0.0M	47.7M	3.6M	569.1M	284.7M	284.3M	284.6M	284.5M	287.0M	282.1M	566.9M	0.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_2	640.5M	0.0M	0.0M	47.2M	3.7M	568.4M	284.4M	284.0M	284.3M	284.1M	284.3M	284.1M	566.3M	0.0M
BVT_FFPE_TRNA_bst_06_A23WKFTLT4_3	639.6M	0.0M	0.0M	47.3M	3.6M	567.4M	283.9M	283.5M	283.8M	283.6M	282.4M	285.0M	565.3M	0.0M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_1	180.6M	0.0M	0.0M	13.4M	1.1M	160.5M	80.3M	80.2M	80.2M	80.2M	88.3M	72.2M	159.8M	0.0M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_2	640.2M	0.0M	0.0M	47.3M	4.0M	568.3M	284.3M	284.0M	284.2M	284.1M	312.0M	256.3M	566.2M	0.0M
BVT_FFPE_TRNA_crv_01_A23WKFTLT4_3	640.0M	0.0M	0.0M	47.1M	3.8M	568.4M	284.4M	284.1M	284.3M	284.2M	312.8M	255.6M	566.4M	0.0M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_1	70.0M	0.0M	0.0M	12.8M	1.0M	51.3M	25.7M	25.7M	25.7M	25.7M	34.4M	16.9M	51.1M	0.0M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_2	146.9M	0.0M	0.0M	23.5M	1.7M	112.2M	56.2M	56.1M	56.1M	56.1M	74.1M	38.1M	111.6M	0.0M
BVT_FFPE_TRNA_crv_02_A23WKFTLT4_3	101.3M	0.0M	0.0M	14.6M	1.1M	79.6M	39.8M	39.8M	39.8M	39.8M	51.4M	28.3M	79.2M	0.0M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_1	652.9M	0.0M	0.0M	58.9M	3.8M	565.5M	282.9M	282.6M	282.9M	282.6M	322.8M	242.7M	562.8M	0.0M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_2	652.8M	0.0M	0.0M	58.8M	4.0M	565.7M	283.0M	282.7M	283.0M	282.7M	314.8M	250.9M	562.9M	0.0M
BVT_FFPE_TRNA_crv_04_A23WKFTLT4_3	463.4M	0.0M	0.0M	40.8M	2.7M	402.8M	201.5M	201.3M	201.5M	201.3M	221.0M	181.9M	400.9M	0.0M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_1	634.7M	0.0M	0.0M	53.8M	4.9M	553.7M	277.0M	276.8M	276.9M	276.8M	324.7M	229.0M	552.0M	0.0M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_2	513.1M	0.0M	0.0M	44.4M	4.2M	446.4M	223.3M	223.1M	223.2M	223.1M	259.4M	187.0M	444.6M	0.0M
BVT_FFPE_TRNA_kid_01_A23WKFTLT4_3	359.8M	0.0M	0.0M	31.6M	3.1M	312.5M	156.3M	156.2M	156.3M	156.2M	178.7M	133.8M	311.2M	0.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_1	654.8M	0.0M	0.0M	64.6M	6.3M	560.1M	280.3M	279.8M	280.1M	280.0M	348.8M	211.3M	558.0M	0.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_2	623.2M	0.0M	0.0M	59.0M	5.8M	535.8M	268.1M	267.7M	268.0M	267.9M	329.7M	206.2M	533.8M	0.0M
BVT_FFPE_TRNA_liv_03_A23WKFTLT4_3	378.9M	0.0M	0.0M	36.9M	3.9M	324.2M	162.2M	162.0M	162.1M	162.1M	198.4M	125.8M	323.1M	0.0M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_1	436.4M	0.0M	0.0M	35.3M	2.6M	384.2M	192.3M	192.0M	192.2M	192.0M	221.8M	162.4M	382.6M	0.0M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_2	592.1M	0.0M	0.0M	49.0M	3.4M	520.0M	260.2M	259.8M	260.1M	259.9M	298.0M	222.0M	517.8M	0.0M
BVT_FFPE_TRNA_skn_01_A23WKFTLT4_3	462.9M	0.0M	0.0M	38.9M	2.6M	405.7M	203.0M	202.7M	202.9M	202.8M	235.5M	170.2M	404.0M	0.0M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_1	653.3M	0.0M	0.0M	60.3M	4.2M	563.4M	281.9M	281.4M	281.8M	281.6M	306.8M	256.6M	560.7M	0.0M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_2	649.4M	0.0M	0.0M	57.6M	4.1M	563.1M	281.8M	281.4M	281.6M	281.5M	303.6M	259.6M	560.5M	0.0M
BVT_FFPE_TRNA_stm_04_A23WKFTLT4_3	399.3M	0.0M	0.0M	37.6M	2.5M	343.2M	171.7M	171.5M	171.7M	171.5M	187.3M	155.9M	341.7M	0.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_1	644.4M	0.0M	0.0M	52.4M	3.9M	566.2M	283.4M	282.9M	283.3M	283.0M	286.4M	279.9M	563.7M	0.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_2	641.9M	0.0M	0.0M	48.2M	4.0M	569.5M	285.0M	284.5M	284.9M	284.6M	273.9M	295.6M	567.0M	0.0M
BVT_FFPE_TRNA_stm_05_A23WKFTLT4_3	641.5M	0.0M	0.0M	48.3M	3.9M	569.0M	284.7M	284.3M	284.6M	284.4M	266.8M	302.2M	566.5M	0.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_1	664.1M	0.0M	0.0M	73.0M	5.3M	555.5M	278.0M	277.6M	277.8M	277.7M	327.6M	228.0M	553.1M	0.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_2	552.9M	0.0M	0.0M	57.0M	4.3M	467.8M	234.0M	233.8M	233.9M	233.9M	270.2M	197.6M	465.8M	0.0M
BVT_FFPE_TRNA_stm_06_A23WKFTLT4_3	391.0M	0.0M	0.0M	42.4M	3.1M	327.9M	164.0M	163.9M	164.0M	163.9M	191.0M	136.9M	326.6M	0.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_1	658.5M	0.0M	0.0M	65.0M	4.9M	560.4M	280.4M	280.0M	280.3M	280.1M	285.3M	275.0M	558.2M	0.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_2	657.5M	0.0M	0.0M	64.3M	4.7M	560.6M	280.5M	280.1M	280.4M	280.2M	284.9M	275.7M	558.5M	0.0M
BVT_FFPE_TRNA_stm_07_A23WKFTLT4_3	657.5M	0.0M	0.0M	65.5M	5.0M	558.5M	279.4M	279.1M	279.3M	279.2M	280.3M	278.2M	556.5M	0.0M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_1	650.1M	0.0M	0.0M	57.9M	5.1M	564.3M	282.4M	281.9M	282.2M	282.1M	316.1M	248.2M	562.0M	0.0M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_2	649.3M	0.0M	0.0M	58.1M	4.9M	563.2M	281.8M	281.4M	281.7M	281.5M	318.2M	245.0M	561.0M	0.0M
BVT_FFPE_TRNA_stm_08_A23WKFTLT4_3	382.3M	0.0M	0.0M	34.9M	2.9M	330.7M	165.5M	165.2M	165.4M	165.3M	183.5M	147.2M	329.5M	0.0M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_1	659.4M	0.0M	0.0M	66.3M	3.9M	561.3M	280.8M	280.5M	280.7M	280.6M	302.4M	258.9M	559.0M	0.0M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_2	653.5M	0.0M	0.0M	61.2M	3.7M	562.4M	281.4M	281.1M	281.3M	281.1M	295.8M	266.6M	560.2M	0.0M
BVT_FFPE_TRNA_stm_09_A23WKFTLT4_3	654.9M	0.0M	0.0M	62.0M	3.8M	562.5M	281.4M	281.1M	281.3M	281.2M	293.5M	269.0M	560.4M	0.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_1	644.6M	0.0M	0.0M	50.6M	3.7M	568.3M	284.3M	284.0M	284.2M	284.1M	324.4M	244.0M	565.8M	0.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_2	169.8M	0.0M	0.0M	22.8M	1.8M	137.9M	69.0M	68.9M	68.9M	68.9M	86.2M	51.7M	137.2M	0.0M
BVT_FFPE_TRNA_thy_01_A23WKFTLT4_3	595.9M	0.0M	0.0M	46.3M	3.4M	526.1M	263.1M	262.9M	263.1M	263.0M	296.0M	230.1M	523.6M	0.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_1	632.0M	0.0M	0.0M	38.9M	3.6M	571.0M	285.7M	285.4M	285.6M	285.5M	303.1M	267.9M	568.7M	0.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_2	631.7M	0.0M	0.0M	40.8M	3.6M	567.7M	284.0M	283.7M	283.9M	283.8M	307.4M	260.3M	565.5M	0.0M
BVT_FFPE_TRNA_thy_02_A23WKFTLT4_3	533.0M	0.0M	0.0M	32.8M	3.0M	481.3M	240.7M	240.6M	240.7M	240.6M	255.7M	225.7M	479.5M	0.0M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_1	33.2M	0.0M	0.0M	4.8M	0.3M	26.5M	13.3M	13.3M	13.3M	13.3M	17.6M	8.9M	26.4M	0.0M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_2	44.4M	0.0M	0.0M	5.5M	0.3M	36.5M	18.3M	18.2M	18.3M	18.3M	23.7M	12.9M	36.3M	0.0M
BVT_FFPE_TRNA_utn_01_A23WKFTLT4_3	32.5M	0.0M	0.0M	3.7M	0.2M	27.1M	13.6M	13.6M	13.6M	13.6M	17.2M	10.0M	27.0M	0.0M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_1	648.6M	0.0M	0.0M	55.2M	4.8M	563.1M	281.8M	281.4M	281.6M	281.5M	299.9M	263.2M	560.9M	0.0M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_2	645.4M	0.0M	0.0M	52.5M	4.8M	563.6M	282.0M	281.7M	281.9M	281.8M	294.8M	268.8M	561.4M	0.0M
BVT_FFPE_TRNA_utn_02_A23WKFTLT4_3	644.0M	0.0M	0.0M	51.2M	4.5M	564.5M	282.4M	282.1M	282.3M	282.2M	297.9M	266.5M	562.4M	0.0M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_1	482.7M	0.0M	0.0M	39.7M	3.0M	422.8M	211.6M	211.2M	211.4M	211.3M	242.8M	180.0M	420.8M	0.0M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_2	568.3M	0.0M	0.0M	44.3M	3.4M	501.0M	250.7M	250.3M	250.5M	250.4M	286.4M	214.6M	498.7M	0.0M
BVT_FFPE_TRNA_utn_04_A23WKFTLT4_3	643.2M	0.0M	0.0M	49.3M	3.9M	568.4M	284.4M	284.0M	284.3M	284.1M	313.1M	255.2M	565.8M	0.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_1	599.0M	0.0M	0.0M	48.1M	3.3M	527.8M	264.1M	263.7M	264.0M	263.8M	290.2M	237.6M	525.4M	0.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_2	649.3M	0.0M	0.0M	54.9M	3.6M	568.2M	284.3M	283.9M	284.2M	284.0M	318.4M	249.8M	565.7M	0.0M
BVT_FFPE_TRNA_utn_05_A23WKFTLT4_3	464.2M	0.0M	0.0M	38.9M	2.7M	406.7M	203.5M	203.2M	203.4M	203.3M	222.1M	184.5M	404.9M	0.0M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_1	648.5M	0.0M	0.0M	55.5M	4.4M	565.4M	282.9M	282.5M	282.8M	282.6M	318.9M	246.5M	562.5M	0.0M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_2	452.3M	0.0M	0.0M	39.5M	3.0M	393.4M	196.8M	196.6M	196.8M	196.6M	223.6M	169.8M	391.5M	0.0M
BVT_FFPE_TRNA_utn_07_A23WKFTLT4_3	458.1M	0.0M	0.0M	38.8M	3.0M	399.9M	200.1M	199.9M	200.0M	199.9M	224.3M	175.6M	398.1M	0.0M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_1	637.0M	0.0M	0.0M	43.3M	3.8M	570.9M	285.6M	285.2M	285.5M	285.4M	314.8M	256.0M	568.4M	0.0M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_2	636.5M	0.0M	0.0M	42.9M	3.8M	570.8M	285.6M	285.2M	285.5M	285.3M	308.9M	261.9M	568.4M	0.0M
BVT_FFPE_TRNA_utn_08_A23WKFTLT4_3	635.1M	0.0M	0.0M	42.6M	3.7M	569.8M	285.1M	284.8M	285.0M	284.8M	309.8M	260.0M	567.5M	0.0M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_1	641.7M	0.0M	0.0M	49.2M	4.1M	567.8M	284.1M	283.7M	284.0M	283.9M	314.1M	253.7M	565.6M	0.0M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_2	641.9M	0.0M	0.0M	49.2M	4.0M	568.0M	284.2M	283.8M	284.0M	283.9M	312.1M	255.9M	565.9M	0.0M
BVT_FFPE_TRNA_utn_09_A23WKFTLT4_3	638.7M	0.0M	0.0M	47.8M	4.0M	566.5M	283.4M	283.1M	283.3M	283.2M	307.5M	259.0M	564.4M	0.0M
FFPE_HD789_01_RNA_13_A23WKFTLT4_1	629.3M	0.0M	0.0M	37.0M	3.1M	572.1M	286.1M	285.9M	286.1M	286.0M	252.6M	319.4M	570.2M	0.0M
FFPE_V4_0002_RNA_0001_A23WKFTLT4_1	638.1M	0.0M	0.0M	45.5M	4.5M	568.1M	284.2M	283.9M	284.1M	284.0M	274.3M	293.8M	566.2M	0.0M
NTC_0001_0001_A23WKFTLT4_1	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	327931373	0.3198%
GATCGGAGAGCACACGTCTGAACTCCAGTCACATGCTTACTGATCTGGGG	2	120	0.0000%
CCTGGGTGGTGGCGCTGTCCTTCAACCTTCTTCAAGTACTGCGACTGTAT	2	13	0.0000%
GAAACAGTCAGAGAGACAATCTCTTGCAGCCAGATGCCAGCTTTCTCAGA	2	12	0.0000%
GGAAGGAGAGCTTGGCCGGGCTACGGGGCGCAATGGGACTCAGGGTGCTC	2	11	0.0000%
CTGAAATTGTCAGGTATGTTGCCATCTCTGTCTTGTTTTTCTTCATGCTG	2	13	0.0000%
GGCAGCGCCATGTCCTCATGGAATCTACAGGGCCTGCAGGGCATTGCCCT	2	9	0.0000%
GTTTTCTAGAAAATGATTCAGGAAGTAATGCACTCCCTGGTGAAGCTTAC	2	8	0.0000%
CTGATACTTAACATCCTAACACCTCTAGTGGGTCACTGGGTCATACCGCG	2	9	0.0000%
CCGACCACCCTCTCCCCACAGACCCCGGTGCTGCTGACACCCAGCTCGCT	2	11	0.0000%
GGCCCACTCAGGGTCCGGGACAGGCATACTCATCGGACCAGTCGGAGCAG	2	12	0.0000%
CGCACTTCACCTCCCAGCCTCCGTACTGCTTGGCTTCCCCATCCCGGATG	2	8	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	6	0.0000%
GGCACTGCCGGAGGGGCTGGGGCCGTATTGTGCTGAAACTCATAGGCGTC	2	5	0.0000%
CTTGGGTCCCTCCTCCCTGAGGCGAGCTGGGAAAGGGGTGTCTGCGAGTC	2	5	0.0000%
CTCAGGCTCAGCGGTCGCATTTTGCGAGTGGCTCCGAGACACACAATGCA	2	5	0.0000%
AGCGACTCAAGCTCTGGGTCTGCTGCCTGTGCCTCGGGCCTGCCCACGGA	2	5	0.0000%
GGGTCCCGCAGAAGAGTGTGTGACGCCTATGAGTTTCAGCACAATACGGC	2	4	0.0000%
CCCGGGCCTGCAAGATGAGGGTCCCGCAGAAGAGTGTGTGACGCCTATGA	2	5	0.0000%
GGAGAGAGCATTCCAGTGCTGAAGACGGCACTGCCGGAGGGGCTGGGGCC	2	4	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	137061471	0.3006%
CCTGGGTGGTGGCGCTGTCCTTCAACCTTCTTCAAGTACTGCGACTGTAT	2	13	0.0000%
GAAACAGTCAGAGAGACAATCTCTTGCAGCCAGATGCCAGCTTTCTCAGA	2	12	0.0000%
GGAAGGAGAGCTTGGCCGGGCTACGGGGCGCAATGGGACTCAGGGTGCTC	2	11	0.0000%
CTGAAATTGTCAGGTATGTTGCCATCTCTGTCTTGTTTTTCTTCATGCTG	2	13	0.0000%
GGCAGCGCCATGTCCTCATGGAATCTACAGGGCCTGCAGGGCATTGCCCT	2	9	0.0000%
GTTTTCTAGAAAATGATTCAGGAAGTAATGCACTCCCTGGTGAAGCTTAC	2	8	0.0000%
CTGATACTTAACATCCTAACACCTCTAGTGGGTCACTGGGTCATACCGCG	2	9	0.0000%
CCGACCACCCTCTCCCCACAGACCCCGGTGCTGCTGACACCCAGCTCGCT	2	11	0.0000%
GGCCCACTCAGGGTCCGGGACAGGCATACTCATCGGACCAGTCGGAGCAG	2	12	0.0000%
CGCACTTCACCTCCCAGCCTCCGTACTGCTTGGCTTCCCCATCCCGGATG	2	8	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	6	0.0000%
GGCACTGCCGGAGGGGCTGGGGCCGTATTGTGCTGAAACTCATAGGCGTC	2	5	0.0000%
CTTGGGTCCCTCCTCCCTGAGGCGAGCTGGGAAAGGGGTGTCTGCGAGTC	2	5	0.0000%
CTCAGGCTCAGCGGTCGCATTTTGCGAGTGGCTCCGAGACACACAATGCA	2	5	0.0000%
AGCGACTCAAGCTCTGGGTCTGCTGCCTGTGCCTCGGGCCTGCCCACGGA	2	5	0.0000%
GGGTCCCGCAGAAGAGTGTGTGACGCCTATGAGTTTCAGCACAATACGGC	2	4	0.0000%
CCCGGGCCTGCAAGATGAGGGTCCCGCAGAAGAGTGTGTGACGCCTATGA	2	5	0.0000%
GGAGAGAGCATTCCAGTGCTGAAGACGGCACTGCCGGAGGGGCTGGGGCC	2	4	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	4	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
RSEQC_TO_MULTIQC	python	`3.11.14`
	rseqc_to_multiqc	`1.0.0`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.14`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__73d51683--20260607-225254' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0012_exp0013-73d51683 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0033_A23WKFTLT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0033_A23WKFTLT4/bclconvert_samplesheet_8bpIndex_correctSampleIDs.csv' --flowcell_id 20260428_LH00995_0033_A23WKFTLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__73d51683--20260607-225254'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0012_exp0013-73d51683
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Skip steps

skip_picard_qc: true

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0012_exp0013/A23WKFTLT4/nfcore_rnafusion__73d51683--20260607-225254
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0033_A23WKFTLT4/
flowcell_id: 20260428_LH00995_0033_A23WKFTLT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0033_A23WKFTLT4/bclconvert_samplesheet_8bpIndex_correctSampleIDs.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Mark Duplicates Help

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks