MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-16, 18:04 UTC based on data in: /tmp/nxf.88AXA1Vqki

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	Total Reads	Expected Distinct	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	RNA contaminated	RNA contamination %	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
659_6i-T1-TRNA-1_A23MVY2LT4_1	9999000000	122711241	369722048	0.01%	0.62%	139413426	0.90%	0.94%	0.08%	0.06%	126048684	63426395	10714150	4387071	218.68	111.00	0.70%	0.52%	0.98	0.000	No	0.00%	138.2bp	131.0bp	0.01%	1.22%	0.39%	0.00%	0.02%	3.76%	0.61%	0.00%				145bp	248bp	62.7%	0.0%	96.1%	88.6%	95.2%	176.1M	44.3%	97.4%	46200.5Mb	369.7M	53.8%	98.5%	63.1%
659_6i-T1-TRNA-1_A23MVY2LT4_1_1																																	138.2bp	97.4%	180.0M																80.8%	53%	151bp	151bp	18%	187.8M
659_6i-T1-TRNA-1_A23MVY2LT4_1_2																																																			80.1%	54%	151bp	151bp	18%	187.8M
659_6i-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			80.9%	53%	128bp	137bp	9%	184.9M	80.9%	53%	128bp	137bp	9%	184.9M
659_6i-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			81.3%	54%	128bp	137bp	9%	184.9M	81.3%	54%	128bp	137bp	9%	184.9M
659_6i-T1-TRNA-1_A23MVY2LT4_2	9999000000	86764997	405102760	0.01%	0.78%	90984870	0.86%	0.90%	0.11%	0.10%	78384794	39425832	9691029	4141264	131.76	63.00	0.63%	0.39%	0.98	0.000	No	0.00%	136.5bp	129.0bp	0.01%	1.35%	0.44%	0.00%	0.01%	4.16%	0.69%	0.00%				143bp	242bp	78.1%	0.0%	96.1%	88.2%	95.2%	192.8M	59.3%	97.5%	50196.5Mb	405.1M	54.5%	98.4%	64.5%
659_6i-T1-TRNA-1_A23MVY2LT4_2_1																																	136.5bp	97.3%	197.1M																86.1%	53%	151bp	151bp	18%	205.8M
659_6i-T1-TRNA-1_A23MVY2LT4_2_2																																																			85.0%	54%	151bp	151bp	18%	205.8M
659_6i-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.1%	54%	127bp	132bp	9%	202.6M	86.1%	54%	127bp	132bp	9%	202.6M
659_6i-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.2%	54%	127bp	132bp	9%	202.6M	86.2%	54%	127bp	132bp	9%	202.6M
659_Dl-T1-TRNA-1_A23MVY2LT4_1	9999000000	99602868	451678338	0.01%	0.76%	106347390	0.87%	0.92%	0.10%	0.08%	92399065	46517372	10264871	4249166	161.30	71.00	0.64%	0.43%	0.97	0.000	No	0.00%	140.2bp	132.0bp	0.01%	1.32%	0.43%	0.00%	0.02%	4.34%	0.72%	0.00%				150bp	261bp	77.1%	0.0%	96.5%	85.7%	94.3%	213.0M	56.0%	97.3%	56780.9Mb	451.7M	54.8%	98.4%	60.5%
659_Dl-T1-TRNA-1_A23MVY2LT4_1_1																																	140.2bp	97.3%	219.7M																86.1%	54%	151bp	151bp	18%	229.4M
659_Dl-T1-TRNA-1_A23MVY2LT4_1_2																																																			85.1%	54%	151bp	151bp	18%	229.4M
659_Dl-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			86.2%	54%	129bp	137bp	9%	225.8M	86.2%	54%	129bp	137bp	9%	225.8M
659_Dl-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			86.3%	55%	129bp	137bp	9%	225.8M	86.3%	55%	129bp	137bp	9%	225.8M
659_Dl-T1-TRNA-1_A23MVY2LT4_2	9999000000	56455296	337284940	0.01%	0.85%	50675435	0.81%	0.88%	0.13%	0.12%	41174847	20720143	6712554	2867885	72.23	30.00	0.50%	0.21%	0.97	0.000	No	0.00%	143.7bp	135.0bp	0.01%	1.41%	0.46%	0.00%	0.02%	4.66%	0.76%	0.00%				154bp	274bp	85.7%	0.0%	96.4%	85.4%	94.2%	158.9M	64.4%	97.3%	42635.9Mb	337.3M	55.3%	98.1%	58.4%
659_Dl-T1-TRNA-1_A23MVY2LT4_2_1																																	143.7bp	97.0%	163.5M																88.8%	54%	151bp	151bp	18%	171.9M
659_Dl-T1-TRNA-1_A23MVY2LT4_2_2																																																			87.4%	55%	151bp	151bp	18%	171.9M
659_Dl-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			88.9%	54%	130bp	142bp	9%	168.6M	88.9%	54%	130bp	142bp	9%	168.6M
659_Dl-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			88.7%	55%	130bp	142bp	9%	168.6M	88.7%	55%	130bp	142bp	9%	168.6M
659_Lx-T1-TRNA-1_A23MVY2LT4_1	9999000000	197751475	472731300	0.01%	0.57%	204924135	0.93%	0.96%	0.06%	0.04%	190724878	95997343	11557004	4354587	346.65	158.00	0.71%	0.58%	0.98	0.000	No	0.00%	138.3bp	130.0bp	0.01%	1.04%	0.35%	0.00%	0.02%	3.34%	0.56%	0.00%				151bp	347bp	57.0%	0.0%	97.6%	90.5%	95.9%	226.7M	38.7%	97.5%	58573.3Mb	472.7M	53.5%	98.5%	63.5%
659_Lx-T1-TRNA-1_A23MVY2LT4_1_1																																	138.3bp	98.2%	232.2M																82.3%	52%	151bp	151bp	18%	240.1M
659_Lx-T1-TRNA-1_A23MVY2LT4_1_2																																																			81.7%	53%	151bp	151bp	18%	240.1M
659_Lx-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			82.4%	53%	127bp	132bp	9%	236.4M	82.4%	53%	127bp	132bp	9%	236.4M
659_Lx-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			82.9%	53%	127bp	132bp	9%	236.4M	82.9%	53%	127bp	132bp	9%	236.4M
659_Lx-T1-TRNA-1_A23MVY2LT4_2	9999000000	134657805	525908288	0.01%	0.68%	169536169	0.92%	0.95%	0.07%	0.05%	155446647	78245827	11221158	4345904	280.84	125.00	0.69%	0.54%	0.98	0.000	No	0.00%	139.6bp	131.0bp	0.01%	1.01%	0.35%	0.00%	0.01%	3.27%	0.57%	0.00%				154bp	359bp	68.1%	0.0%	97.6%	90.6%	96.0%	252.3M	47.7%	97.5%	65528.2Mb	525.9M	53.7%	98.5%	62.5%
659_Lx-T1-TRNA-1_A23MVY2LT4_2_1																																	139.6bp	98.2%	258.2M																85.4%	53%	151bp	151bp	18%	267.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_2_2																																																			84.3%	54%	151bp	151bp	18%	267.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			85.4%	53%	128bp	137bp	9%	263.0M	85.4%	53%	128bp	137bp	9%	263.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			85.6%	53%	128bp	137bp	9%	263.0M	85.6%	53%	128bp	137bp	9%	263.0M
659_Mt-T1-TRNA-1_A23MVY2LT4_1	9999000000	175254736	410870718	0.01%	0.57%	174687175	0.92%	0.95%	0.07%	0.05%	160396784	80959307	11534912	4329733	312.74	142.00	0.70%	0.56%	0.98	0.000	No	0.00%	151.7bp	142.0bp	0.01%	0.73%	0.29%	0.00%	0.02%	2.38%	0.47%	0.00%				170bp	333bp	57.9%	0.0%	96.7%	87.2%	94.9%	194.9M	42.8%	97.4%	53690.7Mb	410.9M	54.1%	98.5%	51.2%
659_Mt-T1-TRNA-1_A23MVY2LT4_1_1																																	151.7bp	97.4%	200.1M																82.0%	53%	151bp	151bp	27%	208.5M
659_Mt-T1-TRNA-1_A23MVY2LT4_1_2																																																			81.7%	54%	151bp	151bp	27%	208.5M
659_Mt-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			82.1%	53%	134bp	147bp	18%	205.4M	82.1%	53%	134bp	147bp	18%	205.4M
659_Mt-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			82.8%	54%	134bp	147bp	18%	205.4M	82.8%	54%	134bp	147bp	18%	205.4M
659_Mt-T1-TRNA-1_A23MVY2LT4_2	9999000000	108569758	487609194	0.01%	0.76%	116490707	0.88%	0.92%	0.09%	0.08%	102301002	51593736	10944439	4405970	190.10	81.00	0.65%	0.46%	0.97	0.000	No	0.00%	147.1bp	137.0bp	0.01%	0.84%	0.32%	0.00%	0.01%	2.76%	0.53%	0.00%				163bp	315bp	76.6%	0.0%	96.7%	86.8%	94.8%	231.1M	56.8%	97.3%	62457.6Mb	487.6M	54.6%	98.4%	55.3%
659_Mt-T1-TRNA-1_A23MVY2LT4_2_1																																	147.1bp	97.4%	237.5M																87.3%	53%	151bp	151bp	27%	247.7M
659_Mt-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.2%	54%	151bp	151bp	18%	247.7M
659_Mt-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			87.4%	54%	132bp	142bp	9%	243.8M	87.4%	54%	132bp	142bp	9%	243.8M
659_Mt-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			87.4%	54%	132bp	142bp	18%	243.8M	87.4%	54%	132bp	142bp	18%	243.8M
659_bCu-T1-TRNA-1_A23MVY2LT4_1	9999000000	84571576	482784100	0.01%	0.83%	83820050	0.82%	0.88%	0.13%	0.12%	69120750	34727617	10640692	4618681	115.57	29.00	0.50%	0.27%	0.97	0.000	No	0.00%	133.8bp	127.0bp	0.00%	0.55%	0.24%	0.00%	0.00%	1.86%	0.40%	0.00%				138bp	206bp	83.3%	0.0%	96.2%	87.0%	94.9%	229.1M	57.8%	97.2%	58875.4Mb	482.8M	59.7%	98.2%	65.9%
659_bCu-T1-TRNA-1_A23MVY2LT4_1_1																																	133.8bp	97.1%	234.5M																88.9%	58%	151bp	151bp	18%	245.9M
659_bCu-T1-TRNA-1_A23MVY2LT4_1_2																																																			87.3%	58%	151bp	151bp	18%	245.9M
659_bCu-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			89.0%	59%	125bp	132bp	9%	241.4M	89.0%	59%	125bp	132bp	9%	241.4M
659_bCu-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			88.8%	59%	126bp	132bp	9%	241.4M	88.8%	59%	126bp	132bp	9%	241.4M
659_bCu-T1-TRNA-1_A23MVY2LT4_2	9999000000	40766331	214549178	0.01%	0.83%	35987478	0.81%	0.87%	0.14%	0.13%	29210747	14670108	4930256	2148507	49.14	11.00	0.33%	0.12%	0.97	0.000	No	0.00%	140.8bp	133.0bp	0.00%	0.57%	0.25%	0.00%	0.00%	1.97%	0.42%	0.00%				147bp	228bp	83.9%	0.0%	96.0%	87.1%	94.9%	101.8M	60.9%	97.1%	26844.9Mb	214.5M	60.1%	98.0%	61.2%
659_bCu-T1-TRNA-1_A23MVY2LT4_2_1																																	140.8bp	97.0%	104.0M																87.8%	58%	151bp	151bp	18%	109.5M
659_bCu-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.1%	59%	151bp	151bp	18%	109.5M
659_bCu-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			87.9%	59%	129bp	137bp	9%	107.3M	87.9%	59%	129bp	137bp	9%	107.3M
659_bCu-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			87.6%	60%	129bp	137bp	9%	107.3M	87.6%	60%	129bp	137bp	9%	107.3M
659_bGW-T1-TRNA-1_A23MVY2LT4_1	9999000000	343547875	590748766	0.01%	0.50%	297162172	0.94%	0.97%	0.04%	0.03%	280365566	141693485	13332279	4026596	574.62	259.00	0.75%	0.64%	0.97	0.000	No	0.00%	155.1bp	144.0bp	0.01%	1.24%	0.65%	0.00%	0.03%	4.07%	0.96%	0.00%				216bp	556bp	50.0%	0.0%	98.0%	89.3%	95.5%	281.9M	36.2%	97.3%	77605.5Mb	590.7M	55.0%	98.5%	48.5%
659_bGW-T1-TRNA-1_A23MVY2LT4_1_1																																	155.1bp	98.4%	290.5M																87.2%	54%	151bp	151bp	18%	471.6M
659_bGW-T1-TRNA-1_A23MVY2LT4_1_2																																																			86.4%	55%	151bp	151bp	18%	471.6M
659_bGW-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.1%	54%	135bp	151bp	9%	295.4M	84.1%	54%	135bp	151bp	9%	295.4M
659_bGW-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.6%	55%	135bp	151bp	9%	295.4M	84.6%	55%	135bp	151bp	9%	295.4M
659_bGW-T1-TRNA-1_A23MVY2LT4_2	9999000000	224392019	590952262	0.01%	0.58%	246822387	0.94%	0.97%	0.05%	0.03%	230921672	116782548	12352002	3837285	467.52	200.00	0.73%	0.61%	0.97	0.000	No	0.00%	154.9bp	142.0bp	0.01%	1.31%	0.71%	0.00%	0.03%	4.34%	1.05%	0.00%				218bp	544bp	58.6%	0.0%	97.9%	89.1%	95.4%	281.9M	42.3%	97.3%	77219.3Mb	591.0M	55.9%	98.5%	48.8%
659_bGW-T1-TRNA-1_A23MVY2LT4_2_1																																	154.9bp	98.3%	290.4M																89.3%	55%	151bp	151bp	18%	532.5M
659_bGW-T1-TRNA-1_A23MVY2LT4_2_2																																																			88.3%	55%	151bp	151bp	18%	532.5M
659_bGW-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			85.4%	55%	134bp	151bp	9%	295.5M	85.4%	55%	134bp	151bp	9%	295.5M
659_bGW-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			85.9%	56%	134bp	151bp	9%	295.5M	85.9%	56%	134bp	151bp	9%	295.5M
659_bGc-T1-TRNA-1_A23MVY2LT4_1	9999000000	202638424	590321106	0.01%	0.62%	225730634	0.92%	0.96%	0.06%	0.04%	208257496	105089882	13650576	4890601	392.92	186.00	0.74%	0.61%	0.98	0.000	No	0.00%	146.7bp	136.0bp	0.01%	0.92%	0.38%	0.00%	0.01%	2.82%	0.57%	0.00%				167bp	373bp	62.2%	0.0%	97.2%	90.6%	95.9%	283.1M	44.4%	97.4%	75291.2Mb	590.3M	55.7%	98.4%	56.4%
659_bGc-T1-TRNA-1_A23MVY2LT4_1_1																																	146.7bp	98.1%	289.5M																85.1%	54%	151bp	151bp	18%	319.2M
659_bGc-T1-TRNA-1_A23MVY2LT4_1_2																																																			84.3%	55%	151bp	151bp	18%	319.2M
659_bGc-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.6%	55%	131bp	142bp	9%	295.2M	84.6%	55%	131bp	142bp	9%	295.2M
659_bGc-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			85.1%	56%	131bp	142bp	9%	295.2M	85.1%	56%	131bp	142bp	9%	295.2M
659_bGc-T1-TRNA-1_A23MVY2LT4_2	9999000000	135826535	590718792	0.01%	0.74%	150879924	0.90%	0.94%	0.08%	0.06%	135778797	68570997	11336233	4202825	256.79	117.00	0.70%	0.53%	0.97	0.000	No	0.00%	151.1bp	141.0bp	0.01%	0.96%	0.41%	0.00%	0.01%	3.00%	0.61%	0.00%				183bp	434bp	74.9%	0.0%	97.1%	90.9%	96.0%	283.6M	58.5%	97.4%	76534.8Mb	590.7M	55.6%	98.5%	52.6%
659_bGc-T1-TRNA-1_A23MVY2LT4_2_1																																	151.1bp	98.0%	289.3M																88.9%	54%	151bp	151bp	18%	361.7M
659_bGc-T1-TRNA-1_A23MVY2LT4_2_2																																																			87.9%	55%	151bp	151bp	18%	361.7M
659_bGc-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			87.6%	55%	133bp	147bp	9%	295.4M	87.6%	55%	133bp	147bp	9%	295.4M
659_bGc-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			87.9%	55%	133bp	147bp	9%	295.4M	87.9%	55%	133bp	147bp	9%	295.4M
659_bNS-T1-TRNA-1_A23MVY2LT4_1	9999000000	233117319	589893144	0.01%	0.58%	245422175	0.93%	0.97%	0.06%	0.03%	228072907	115597877	13677128	4169032	469.80	207.00	0.74%	0.62%	0.97	0.000	No	0.00%	158.5bp	145.0bp	0.01%	1.34%	0.55%	0.00%	0.02%	4.04%	0.83%	0.00%				224bp	582bp	58.8%	0.0%	97.5%	90.3%	95.8%	282.4M	43.3%	97.2%	77582.9Mb	589.9M	56.0%	98.3%	46.8%
659_bNS-T1-TRNA-1_A23MVY2LT4_1_1																																	158.5bp	98.2%	289.7M																87.1%	55%	151bp	151bp	18%	331.5M
659_bNS-T1-TRNA-1_A23MVY2LT4_1_2																																																			85.6%	56%	151bp	151bp	18%	331.5M
659_bNS-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			86.4%	55%	135bp	151bp	9%	294.9M	86.4%	55%	135bp	151bp	9%	294.9M
659_bNS-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			86.2%	56%	135bp	151bp	9%	294.9M	86.2%	56%	135bp	151bp	9%	294.9M
659_bNS-T1-TRNA-1_A23MVY2LT4_2	9999000000	183950262	590472974	0.01%	0.64%	213000606	0.92%	0.96%	0.06%	0.04%	196900332	99782497	12601766	3942493	406.12	184.00	0.73%	0.60%	0.98	0.000	No	0.00%	160.3bp	146.0bp	0.01%	1.38%	0.56%	0.00%	0.02%	4.20%	0.84%	0.00%				233bp	623bp	64.3%	0.0%	97.5%	90.6%	95.9%	283.1M	49.4%	97.4%	77857.4Mb	590.5M	55.3%	98.4%	45.9%
659_bNS-T1-TRNA-1_A23MVY2LT4_2_1																																	160.3bp	98.2%	289.9M																87.0%	54%	151bp	151bp	18%	323.1M
659_bNS-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.1%	55%	151bp	151bp	18%	323.1M
659_bNS-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.5%	54%	135bp	151bp	9%	295.2M	86.5%	54%	135bp	151bp	9%	295.2M
659_bNS-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.8%	55%	135bp	151bp	9%	295.2M	86.8%	55%	135bp	151bp	9%	295.2M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1	9999000000	194376101	540201404	0.01%	0.59%	220470439	0.92%	0.96%	0.06%	0.04%	203475014	102962826	12401222	4032472	415.35	187.00	0.73%	0.60%	0.97	0.000	No	0.00%	159.7bp	149.0bp	0.01%	1.34%	0.57%	0.00%	0.01%	4.11%	0.86%	0.00%				208bp	476bp	59.7%	0.0%	97.0%	88.9%	95.2%	257.1M	44.7%	97.4%	71731.3Mb	540.2M	56.2%	98.5%	45.8%
659_bQZ-T1-TRNA-1_A23MVY2LT4_1_1																																	159.7bp	97.8%	264.0M																84.3%	55%	151bp	151bp	18%	274.2M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1_2																																																			83.8%	56%	151bp	151bp	18%	274.2M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.3%	55%	136bp	151bp	18%	270.1M	84.3%	55%	136bp	151bp	18%	270.1M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.9%	56%	136bp	151bp	9%	270.1M	84.9%	56%	136bp	151bp	9%	270.1M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2	9999000000	131323217	590311358	0.01%	0.74%	154766623	0.90%	0.95%	0.07%	0.05%	139395180	70577981	10939414	3739830	279.59	118.00	0.69%	0.53%	0.97	0.000	No	0.00%	163.0bp	152.0bp	0.01%	1.42%	0.61%	0.00%	0.01%	4.39%	0.94%	0.00%				225bp	519bp	74.3%	0.0%	96.9%	89.1%	95.3%	281.4M	58.4%	97.3%	79145.6Mb	590.3M	56.7%	98.4%	42.7%
659_bQZ-T1-TRNA-1_A23MVY2LT4_2_1																																	163.0bp	97.6%	288.2M																89.8%	55%	151bp	151bp	18%	398.9M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2_2																																																			88.6%	56%	151bp	151bp	18%	398.9M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			88.0%	56%	138bp	151bp	9%	295.2M	88.0%	56%	138bp	151bp	9%	295.2M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			88.1%	57%	138bp	151bp	9%	295.2M	88.1%	57%	138bp	151bp	9%	295.2M
659_bTo-T1-TRNA-1_A23MVY2LT4_1	9999000000	370869163	591384920	0.00%	0.49%	302955668	0.95%	0.98%	0.04%	0.02%	287028540	145324495	13010268	3509690	622.16	239.00	0.71%	0.62%	0.97	0.000	No	0.00%	165.4bp	151.0bp	0.01%	0.71%	0.68%	0.00%	0.01%	2.33%	1.01%	0.00%				286bp	802bp	49.0%	0.0%	98.0%	92.5%	96.6%	285.6M	36.3%	97.4%	78991.5Mb	591.4M	54.8%	98.6%	42.2%
659_bTo-T1-TRNA-1_A23MVY2LT4_1_1																																	165.4bp	98.5%	291.2M																87.9%	54%	151bp	151bp	18%	454.9M
659_bTo-T1-TRNA-1_A23MVY2LT4_1_2																																																			87.4%	55%	151bp	151bp	18%	454.9M
659_bTo-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			85.2%	54%	137bp	151bp	9%	295.7M	85.2%	54%	137bp	151bp	9%	295.7M
659_bTo-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			86.0%	55%	137bp	151bp	9%	295.7M	86.0%	55%	137bp	151bp	9%	295.7M
659_bTo-T1-TRNA-1_A23MVY2LT4_2	9999000000	189032919	589227876	0.01%	0.64%	214094561	0.94%	0.97%	0.05%	0.03%	200281438	101338884	10696203	3036578	420.01	150.00	0.68%	0.56%	0.98	0.000	No	0.00%	164.7bp	149.0bp	0.01%	0.78%	0.75%	0.00%	0.01%	2.56%	1.11%	0.00%				289bp	787bp	64.0%	0.0%	97.9%	92.3%	96.5%	284.3M	49.6%	97.4%	78202.0Mb	589.2M	55.2%	98.2%	43.0%
659_bTo-T1-TRNA-1_A23MVY2LT4_2_1																																	164.7bp	98.5%	290.1M																90.7%	54%	151bp	151bp	18%	484.5M
659_bTo-T1-TRNA-1_A23MVY2LT4_2_2																																																			89.4%	55%	151bp	151bp	18%	484.5M
659_bTo-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			87.8%	54%	136bp	151bp	9%	294.6M	87.8%	54%	136bp	151bp	9%	294.6M
659_bTo-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			88.2%	55%	136bp	151bp	9%	294.6M	88.2%	55%	136bp	151bp	9%	294.6M
659_bUW-T1-TRNA-1_A23MVY2LT4_1	9999000000	407394333	312959954	0.01%	0.35%	203584985	0.95%	0.98%	0.04%	0.02%	193386305	97954843	8232716	2122647	430.25	155.00	0.67%	0.56%	0.98	0.000	No	0.00%	170.2bp	154.0bp	0.01%	1.51%	0.62%	0.00%	0.03%	4.74%	0.94%	0.00%				266bp	813bp	35.2%	0.0%	98.2%	84.4%	93.4%	146.1M	25.1%	97.4%	41992.8Mb	313.0M	53.4%	98.5%	40.7%
659_bUW-T1-TRNA-1_A23MVY2LT4_1_1																																	170.2bp	98.5%	154.1M																80.7%	52%	151bp	151bp	18%	158.8M
659_bUW-T1-TRNA-1_A23MVY2LT4_1_2																																																			80.3%	53%	151bp	151bp	18%	158.8M
659_bUW-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			80.7%	52%	138bp	151bp	9%	156.5M	80.7%	52%	138bp	151bp	9%	156.5M
659_bUW-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			81.5%	53%	138bp	151bp	9%	156.5M	81.5%	53%	138bp	151bp	9%	156.5M
659_bUW-T1-TRNA-1_A23MVY2LT4_2	9999000000	321306908	591729018	0.01%	0.51%	289941721	0.94%	0.98%	0.05%	0.02%	273281564	138515622	13155477	3477595	603.70	229.00	0.70%	0.60%	0.97	0.000	Yes	0.00%	169.4bp	154.0bp	0.01%	1.48%	0.62%	0.00%	0.03%	4.65%	0.95%	0.00%				269bp	820bp	51.3%	0.0%	98.2%	84.8%	93.5%	276.8M	38.2%	97.4%	79442.7Mb	591.7M	53.5%	98.6%	40.6%
659_bUW-T1-TRNA-1_A23MVY2LT4_2_1																																	169.4bp	98.5%	291.4M																85.8%	53%	151bp	151bp	18%	310.0M
659_bUW-T1-TRNA-1_A23MVY2LT4_2_2																																																			85.2%	53%	151bp	151bp	18%	310.0M
659_bUW-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			85.7%	53%	138bp	151bp	9%	295.9M	85.7%	53%	138bp	151bp	9%	295.9M
659_bUW-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.1%	53%	138bp	151bp	9%	295.9M	86.1%	53%	138bp	151bp	9%	295.9M
659_bhK-T1-TRNA-1_A23MVY2LT4_1	9999000000	248353122	590660126	0.01%	0.59%	239465725	0.93%	0.97%	0.06%	0.03%	222761030	112928509	13183726	3984557	476.64	209.00	0.73%	0.62%	0.97	0.000	No	0.00%	166.1bp	152.0bp	0.00%	0.63%	0.38%	0.00%	0.01%	2.36%	0.66%	0.00%				288bp	750bp	59.8%	0.0%	97.3%	92.2%	96.5%	285.0M	45.1%	97.4%	78722.0Mb	590.7M	55.5%	98.4%	42.9%
659_bhK-T1-TRNA-1_A23MVY2LT4_1_1																																	166.1bp	98.2%	290.1M																86.6%	54%	151bp	151bp	18%	331.9M
659_bhK-T1-TRNA-1_A23MVY2LT4_1_2																																																			85.9%	55%	151bp	151bp	18%	331.9M
659_bhK-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			85.9%	55%	137bp	151bp	9%	295.3M	85.9%	55%	137bp	151bp	9%	295.3M
659_bhK-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			86.5%	55%	137bp	151bp	9%	295.3M	86.5%	55%	137bp	151bp	9%	295.3M
659_bhK-T1-TRNA-1_A23MVY2LT4_2	9999000000	136397683	590746412	0.01%	0.71%	172324792	0.91%	0.96%	0.07%	0.04%	157581142	80055474	11259102	3435135	341.19	141.00	0.70%	0.56%	0.97	0.000	No	0.00%	175.1bp	161.0bp	0.00%	0.61%	0.36%	0.00%	0.01%	2.32%	0.63%	0.00%				342bp	866bp	71.2%	0.0%	97.2%	92.4%	96.6%	285.3M	56.0%	97.3%	80400.1Mb	590.7M	55.6%	98.5%	36.9%
659_bhK-T1-TRNA-1_A23MVY2LT4_2_1																																	175.1bp	98.2%	289.9M																89.5%	54%	151bp	151bp	18%	388.4M
659_bhK-T1-TRNA-1_A23MVY2LT4_2_2																																																			88.5%	55%	151bp	151bp	18%	388.4M
659_bhK-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			87.9%	55%	140bp	151bp	9%	295.4M	87.9%	55%	140bp	151bp	9%	295.4M
659_bhK-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			88.1%	55%	140bp	151bp	9%	295.4M	88.1%	55%	140bp	151bp	9%	295.4M
659_buD-T1-TRNA-1_A23MVY2LT4_1	9999000000	297227450	590980670	0.01%	0.52%	284919117	0.93%	0.96%	0.05%	0.04%	265550775	134215858	15425960	5161782	526.49	270.00	0.76%	0.66%	0.97	0.000	No	0.00%	150.4bp	139.0bp	0.01%	1.08%	0.59%	0.00%	0.03%	3.39%	0.88%	0.00%				197bp	512bp	52.1%	0.0%	97.3%	90.1%	95.8%	282.9M	37.6%	97.4%	76037.2Mb	591.0M	53.7%	98.5%	52.9%
659_buD-T1-TRNA-1_A23MVY2LT4_1_1																																	150.4bp	98.1%	289.8M																84.6%	53%	151bp	151bp	18%	315.6M
659_buD-T1-TRNA-1_A23MVY2LT4_1_2																																																			83.9%	54%	151bp	151bp	18%	315.6M
659_buD-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.3%	53%	132bp	147bp	9%	295.5M	84.3%	53%	132bp	147bp	9%	295.5M
659_buD-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.8%	54%	132bp	147bp	9%	295.5M	84.8%	54%	132bp	147bp	9%	295.5M
659_buD-T1-TRNA-1_A23MVY2LT4_2	9999000000	179416459	447523764	0.01%	0.57%	191699362	0.93%	0.96%	0.06%	0.04%	177815969	89879896	11016359	3716047	353.07	174.00	0.73%	0.60%	0.98	0.000	No	0.00%	152.8bp	141.0bp	0.01%	1.06%	0.58%	0.00%	0.02%	3.35%	0.87%	0.00%				206bp	550bp	57.5%	0.0%	97.3%	90.3%	95.8%	214.4M	41.7%	97.5%	58194.4Mb	447.5M	53.4%	98.5%	51.1%
659_buD-T1-TRNA-1_A23MVY2LT4_2_1																																	152.8bp	98.1%	219.5M																83.7%	52%	151bp	151bp	18%	227.1M
659_buD-T1-TRNA-1_A23MVY2LT4_2_2																																																			83.4%	53%	151bp	151bp	18%	227.1M
659_buD-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			83.7%	53%	133bp	147bp	9%	223.8M	83.7%	53%	133bp	147bp	9%	223.8M
659_buD-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			84.5%	53%	133bp	147bp	9%	223.8M	84.5%	53%	133bp	147bp	9%	223.8M
659_bua-T1-TRNA-1_A23MVY2LT4_1	9999000000	292363696	591453148	0.01%	0.53%	276169830	0.93%	0.96%	0.06%	0.04%	257672492	130256862	15255938	5131451	516.30	205.00	0.69%	0.59%	0.97	0.000	No	0.00%	150.8bp	140.0bp	0.01%	0.69%	0.55%	0.00%	0.01%	2.26%	0.80%	0.00%				194bp	468bp	53.6%	0.0%	97.0%	91.4%	96.2%	284.6M	38.0%	97.4%	76550.5Mb	591.5M	54.0%	98.6%	51.2%
659_bua-T1-TRNA-1_A23MVY2LT4_1_1																																	150.8bp	98.0%	289.8M																85.3%	53%	151bp	151bp	18%	384.4M
659_bua-T1-TRNA-1_A23MVY2LT4_1_2																																																			84.6%	54%	151bp	151bp	18%	384.4M
659_bua-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			83.4%	53%	133bp	147bp	9%	295.7M	83.4%	53%	133bp	147bp	9%	295.7M
659_bua-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			83.9%	54%	133bp	147bp	9%	295.7M	83.9%	54%	133bp	147bp	9%	295.7M
659_bua-T1-TRNA-1_A23MVY2LT4_2	9999000000	168233575	591101856	0.01%	0.67%	192651298	0.92%	0.95%	0.07%	0.05%	176444879	89212001	12870521	4472075	349.92	130.00	0.66%	0.54%	0.97	0.000	No	0.00%	152.7bp	141.0bp	0.01%	0.73%	0.58%	0.00%	0.01%	2.42%	0.87%	0.00%				206bp	502bp	67.8%	0.0%	97.0%	91.4%	96.2%	284.5M	49.9%	97.4%	77057.6Mb	591.1M	54.6%	98.5%	49.9%
659_bua-T1-TRNA-1_A23MVY2LT4_2_1																																	152.7bp	98.0%	289.6M																87.0%	54%	151bp	151bp	18%	325.1M
659_bua-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.2%	54%	151bp	151bp	18%	325.1M
659_bua-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.4%	54%	134bp	151bp	9%	295.6M	86.4%	54%	134bp	151bp	9%	295.6M
659_bua-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.8%	54%	134bp	151bp	9%	295.6M	86.8%	54%	134bp	151bp	9%	295.6M
659_c95-T1-TRNA-1_A23MVY2LT4_1	9999000000	405212395	591386466	0.01%	0.47%	314983309	0.94%	0.97%	0.05%	0.03%	294875278	149417923	16486596	5084312	622.21	306.00	0.75%	0.65%	0.98	0.000	Yes	0.16%	162.3bp	149.0bp	0.01%	1.00%	0.45%	0.00%	0.03%	3.17%	0.67%	0.00%				232bp	609bp	47.0%	0.0%	97.2%	89.4%	95.7%	283.1M	34.2%	97.4%	77982.6Mb	591.4M	53.9%	98.6%	45.4%
659_c95-T1-TRNA-1_A23MVY2LT4_1_1																																	162.3bp	97.8%	289.2M																85.0%	53%	151bp	151bp	27%	348.1M
659_c95-T1-TRNA-1_A23MVY2LT4_1_2																																																			84.4%	54%	151bp	151bp	18%	348.1M
659_c95-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.1%	53%	135bp	151bp	9%	295.7M	84.1%	53%	135bp	151bp	9%	295.7M
659_c95-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.5%	54%	135bp	151bp	9%	295.7M	84.5%	54%	135bp	151bp	9%	295.7M
659_c95-T1-TRNA-1_A23MVY2LT4_2	9999000000	281529652	579786172	0.01%	0.53%	272903925	0.93%	0.96%	0.06%	0.04%	254106575	128856226	15232534	4674033	540.83	261.00	0.74%	0.64%	0.98	0.000	Yes	0.13%	167.0bp	152.0bp	0.01%	0.96%	0.44%	0.00%	0.03%	3.10%	0.66%	0.00%				245bp	650bp	53.3%	0.0%	97.2%	89.4%	95.7%	277.5M	40.1%	97.4%	77331.0Mb	579.8M	54.0%	98.5%	42.7%
659_c95-T1-TRNA-1_A23MVY2LT4_2_1																																	167.0bp	97.8%	283.4M																84.5%	53%	151bp	151bp	27%	294.4M
659_c95-T1-TRNA-1_A23MVY2LT4_2_2																																																			83.9%	54%	151bp	151bp	18%	294.4M
659_c95-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			84.6%	53%	137bp	151bp	9%	289.9M	84.6%	53%	137bp	151bp	9%	289.9M
659_c95-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			85.2%	54%	137bp	151bp	9%	289.9M	85.2%	54%	137bp	151bp	9%	289.9M
659_cAd-T1-TRNA-1_A23MVY2LT4_1	9999000000	264556305	534805094	0.01%	0.52%	255211176	0.93%	0.96%	0.06%	0.04%	237019062	119425222	14133255	5169679	440.81	191.00	0.72%	0.60%	0.97	0.000	Yes	0.03%	140.4bp	132.0bp	0.01%	1.08%	0.71%	0.00%	0.03%	3.34%	1.05%	0.00%				156bp	318bp	52.7%	0.0%	97.2%	88.9%	95.3%	254.9M	35.9%	97.4%	67113.6Mb	534.8M	55.0%	98.5%	60.6%
659_cAd-T1-TRNA-1_A23MVY2LT4_1_1																																	140.4bp	97.9%	261.9M																82.5%	54%	151bp	151bp	18%	271.5M
659_cAd-T1-TRNA-1_A23MVY2LT4_1_2																																																			81.9%	55%	151bp	151bp	18%	271.5M
659_cAd-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			82.5%	54%	129bp	137bp	9%	267.4M	82.5%	54%	129bp	137bp	9%	267.4M
659_cAd-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			83.1%	55%	129bp	137bp	9%	267.4M	83.1%	55%	129bp	137bp	9%	267.4M
659_cAd-T1-TRNA-1_A23MVY2LT4_2	9999000000	168421019	589788690	0.01%	0.67%	194802467	0.91%	0.95%	0.07%	0.05%	176942032	89146541	13264557	5025438	322.67	133.00	0.69%	0.55%	0.98	0.000	No	0.00%	140.6bp	132.0bp	0.01%	1.18%	0.76%	0.00%	0.03%	3.68%	1.15%	0.00%				160bp	332bp	67.5%	0.0%	97.2%	88.9%	95.3%	281.0M	48.6%	97.5%	74017.7Mb	589.8M	55.3%	98.3%	60.0%
659_cAd-T1-TRNA-1_A23MVY2LT4_2_1																																	140.6bp	97.8%	288.5M																87.1%	54%	151bp	151bp	18%	337.7M
659_cAd-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.0%	55%	151bp	151bp	18%	337.7M
659_cAd-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.2%	55%	129bp	137bp	9%	294.9M	86.2%	55%	129bp	137bp	9%	294.9M
659_cAd-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.6%	55%	129bp	137bp	9%	294.9M	86.6%	55%	129bp	137bp	9%	294.9M
659_cIX-T1-TRNA-1_A23MVY2LT4_1	9999000000	299663468	585007414	0.01%	0.52%	280140651	0.94%	0.97%	0.05%	0.03%	262477458	132859029	14619710	4554000	555.64	235.00	0.72%	0.62%	0.97	0.000	No	0.00%	163.2bp	150.0bp	0.01%	0.91%	0.53%	0.00%	0.01%	3.10%	0.81%	0.00%				226bp	617bp	52.4%	0.0%	97.4%	91.8%	96.4%	282.1M	37.7%	97.3%	77598.7Mb	585.0M	54.1%	98.4%	44.2%
659_cIX-T1-TRNA-1_A23MVY2LT4_1_1																																	163.2bp	98.1%	287.0M																84.1%	53%	151bp	151bp	18%	297.2M
659_cIX-T1-TRNA-1_A23MVY2LT4_1_2																																																			83.5%	54%	151bp	151bp	18%	297.2M
659_cIX-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.1%	53%	136bp	151bp	9%	292.5M	84.1%	53%	136bp	151bp	9%	292.5M
659_cIX-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.7%	54%	136bp	151bp	9%	292.5M	84.7%	54%	136bp	151bp	9%	292.5M
659_cIX-T1-TRNA-1_A23MVY2LT4_2	9999000000	194899623	590849882	0.01%	0.63%	219454165	0.93%	0.96%	0.06%	0.04%	203305689	102927009	13088437	4257081	422.48	170.00	0.70%	0.58%	0.98	0.000	No	0.00%	162.2bp	148.0bp	0.01%	1.00%	0.59%	0.00%	0.01%	3.40%	0.90%	0.00%				228bp	605bp	63.2%	0.0%	97.3%	91.7%	96.4%	284.9M	47.5%	97.4%	78212.6Mb	590.8M	54.7%	98.5%	44.5%
659_cIX-T1-TRNA-1_A23MVY2LT4_2_1																																	162.2bp	98.1%	289.8M																87.4%	54%	151bp	151bp	18%	370.1M
659_cIX-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.7%	54%	151bp	151bp	18%	370.1M
659_cIX-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			85.9%	54%	136bp	151bp	9%	295.4M	85.9%	54%	136bp	151bp	9%	295.4M
659_cIX-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.4%	55%	136bp	151bp	9%	295.4M	86.4%	55%	136bp	151bp	9%	295.4M
659_cRB-T1-TRNA-1_A23MVY2LT4_1	9999000000	148045895	477824582	0.01%	0.67%	158606692	0.91%	0.94%	0.07%	0.06%	144351545	72522803	10925019	4433840	243.20	115.00	0.69%	0.53%	0.97	0.000	No	0.00%	128.2bp	122.0bp	0.01%	0.99%	0.62%	0.00%	0.03%	3.24%	0.96%	0.00%				147bp	298bp	67.3%	0.0%	97.3%	89.4%	95.5%	228.2M	43.9%	97.3%	57419.8Mb	477.8M	54.8%	98.5%	70.2%
659_cRB-T1-TRNA-1_A23MVY2LT4_1_1																																	128.2bp	98.1%	234.3M																84.3%	54%	151bp	151bp	18%	242.7M
659_cRB-T1-TRNA-1_A23MVY2LT4_1_2																																																			83.3%	54%	151bp	151bp	18%	242.7M
659_cRB-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.4%	54%	123bp	127bp	9%	238.9M	84.4%	54%	123bp	127bp	9%	238.9M
659_cRB-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.5%	55%	124bp	127bp	9%	238.9M	84.5%	55%	124bp	127bp	9%	238.9M
659_cRB-T1-TRNA-1_A23MVY2LT4_2	9999000000	111403143	567211638	0.01%	0.78%	123639576	0.88%	0.93%	0.08%	0.07%	109412618	54950163	10392931	4306725	182.87	82.00	0.65%	0.46%	0.98	0.000	No	0.00%	129.8bp	123.0bp	0.01%	1.07%	0.67%	0.00%	0.02%	3.54%	1.06%	0.00%				156bp	329bp	78.7%	0.0%	97.4%	89.6%	95.6%	271.1M	55.3%	97.5%	68756.6Mb	567.2M	55.1%	98.4%	68.5%
659_cRB-T1-TRNA-1_A23MVY2LT4_2_1																																	129.8bp	98.1%	278.3M																88.3%	54%	151bp	151bp	18%	288.1M
659_cRB-T1-TRNA-1_A23MVY2LT4_2_2																																																			87.2%	54%	151bp	151bp	18%	288.1M
659_cRB-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			88.4%	54%	124bp	127bp	9%	283.6M	88.4%	54%	124bp	127bp	9%	283.6M
659_cRB-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			88.4%	55%	124bp	127bp	9%	283.6M	88.4%	55%	124bp	127bp	9%	283.6M
659_cRa-T1-TRNA-1_A23MVY2LT4_1	9999000000	279883847	591216258	0.01%	0.56%	262367007	0.93%	0.97%	0.05%	0.03%	245252008	124106142	13562222	4229390	523.66	253.00	0.75%	0.65%	0.97	0.000	No	0.00%	159.7bp	146.0bp	0.01%	0.83%	0.49%	0.00%	0.01%	2.99%	0.80%	0.00%				286bp	690bp	56.0%	0.0%	97.8%	91.3%	96.2%	284.5M	41.3%	97.4%	78325.6Mb	591.2M	55.8%	98.5%	44.6%
659_cRa-T1-TRNA-1_A23MVY2LT4_1_1																																	159.7bp	98.2%	290.4M																88.0%	54%	151bp	151bp	27%	440.0M
659_cRa-T1-TRNA-1_A23MVY2LT4_1_2																																																			87.4%	55%	151bp	151bp	27%	440.0M
659_cRa-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			85.4%	55%	136bp	151bp	18%	295.6M	85.4%	55%	136bp	151bp	18%	295.6M
659_cRa-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			86.2%	56%	136bp	151bp	18%	295.6M	86.2%	56%	136bp	151bp	18%	295.6M
659_cRa-T1-TRNA-1_A23MVY2LT4_2	9999000000	166634867	590334908	0.01%	0.66%	199176837	0.92%	0.96%	0.06%	0.04%	183907985	93062627	11570002	3695460	388.85	178.00	0.73%	0.60%	0.97	0.000	No	0.00%	162.0bp	149.0bp	0.00%	0.87%	0.53%	0.00%	0.01%	3.24%	0.88%	0.00%				312bp	721bp	66.7%	0.0%	97.9%	91.3%	96.2%	284.0M	50.6%	97.3%	78366.7Mb	590.3M	56.2%	98.4%	43.7%
659_cRa-T1-TRNA-1_A23MVY2LT4_2_1																																	162.0bp	98.2%	289.9M																90.4%	55%	151bp	151bp	27%	483.4M
659_cRa-T1-TRNA-1_A23MVY2LT4_2_2																																																			89.4%	56%	151bp	151bp	27%	483.4M
659_cRa-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			87.4%	55%	136bp	151bp	18%	295.2M	87.4%	55%	136bp	151bp	18%	295.2M
659_cRa-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			88.0%	56%	137bp	151bp	18%	295.2M	88.0%	56%	137bp	151bp	18%	295.2M
659_cTi-T1-TRNA-1_A23MVY2LT4_1	9999000000	334791242	591121784	0.01%	0.50%	296985217	0.94%	0.97%	0.05%	0.03%	278198035	140564017	14837374	4794593	561.01	293.00	0.78%	0.68%	0.97	0.000	No	0.00%	152.0bp	139.0bp	0.01%	0.89%	0.52%	0.00%	0.02%	2.79%	0.78%	0.00%				207bp	551bp	50.1%	0.0%	97.6%	90.4%	95.8%	283.0M	35.5%	97.3%	76208.0Mb	591.1M	54.5%	98.5%	51.9%
659_cTi-T1-TRNA-1_A23MVY2LT4_1_1																																	152.0bp	98.0%	289.7M																85.9%	54%	151bp	151bp	18%	391.1M
659_cTi-T1-TRNA-1_A23MVY2LT4_1_2																																																			85.2%	54%	151bp	151bp	18%	391.1M
659_cTi-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.0%	54%	132bp	147bp	9%	295.6M	84.0%	54%	132bp	147bp	9%	295.6M
659_cTi-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.6%	54%	133bp	147bp	9%	295.6M	84.6%	54%	133bp	147bp	9%	295.6M
659_cTi-T1-TRNA-1_A23MVY2LT4_2	9999000000	196360611	591122682	0.01%	0.62%	226497613	0.93%	0.96%	0.05%	0.04%	209820196	106213825	12423812	3922422	436.36	218.00	0.76%	0.64%	0.98	0.000	No	0.00%	164.8bp	152.0bp	0.01%	0.87%	0.55%	0.00%	0.02%	2.82%	0.83%	0.00%				264bp	732bp	62.1%	0.0%	97.6%	90.9%	95.8%	283.3M	47.9%	97.4%	79292.3Mb	591.1M	54.5%	98.5%	42.3%
659_cTi-T1-TRNA-1_A23MVY2LT4_2_1																																	164.8bp	97.8%	289.1M																87.9%	53%	151bp	151bp	18%	384.2M
659_cTi-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.8%	54%	151bp	151bp	18%	384.2M
659_cTi-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.1%	54%	138bp	151bp	9%	295.6M	86.1%	54%	138bp	151bp	9%	295.6M
659_cTi-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.4%	54%	138bp	151bp	9%	295.6M	86.4%	54%	138bp	151bp	9%	295.6M
659_cVw-T1-TRNA-1_A23MVY2LT4_1	9999000000	324761133	590880390	0.01%	0.49%	300812838	0.93%	0.97%	0.05%	0.03%	281080174	142501900	15855460	4689163	617.07	287.00	0.75%	0.65%	0.97	0.000	No	0.00%	172.3bp	156.0bp	0.01%	1.13%	0.47%	0.00%	0.02%	3.70%	0.76%	0.00%				234bp	581bp	49.4%	0.0%	97.3%	88.6%	95.3%	281.4M	37.5%	97.3%	79231.8Mb	590.9M	55.8%	98.5%	39.7%
659_cVw-T1-TRNA-1_A23MVY2LT4_1_1																																	172.3bp	98.0%	289.4M																85.6%	55%	151bp	151bp	18%	327.2M
659_cVw-T1-TRNA-1_A23MVY2LT4_1_2																																																			84.8%	56%	151bp	151bp	18%	327.2M
659_cVw-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			85.0%	55%	138bp	151bp	9%	295.4M	85.0%	55%	138bp	151bp	9%	295.4M
659_cVw-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			85.4%	56%	138bp	151bp	9%	295.4M	85.4%	56%	138bp	151bp	9%	295.4M
659_cVw-T1-TRNA-1_A23MVY2LT4_2	9999000000	187449459	590529712	0.01%	0.62%	225447751	0.92%	0.96%	0.06%	0.04%	207657880	105467068	13901672	4154051	460.76	202.00	0.73%	0.61%	0.97	0.000	No	0.00%	178.5bp	162.0bp	0.01%	1.21%	0.51%	0.00%	0.01%	3.99%	0.83%	0.00%				258bp	649bp	62.2%	0.0%	97.2%	88.8%	95.3%	281.4M	49.2%	97.3%	80341.0Mb	590.5M	56.3%	98.4%	35.4%
659_cVw-T1-TRNA-1_A23MVY2LT4_2_1																																	178.5bp	97.8%	288.8M																88.9%	55%	151bp	151bp	18%	412.4M
659_cVw-T1-TRNA-1_A23MVY2LT4_2_2																																																			88.0%	56%	151bp	151bp	18%	412.4M
659_cVw-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.8%	55%	140bp	151bp	9%	295.3M	86.8%	55%	140bp	151bp	9%	295.3M
659_cVw-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			87.3%	56%	140bp	151bp	9%	295.3M	87.3%	56%	140bp	151bp	9%	295.3M
659_cWx-T1-TRNA-1_A23MVY2LT4_1	9999000000	203053246	588173086	0.01%	0.62%	223055005	0.92%	0.95%	0.07%	0.05%	204128720	103311364	14772966	4890718	408.48	152.00	0.71%	0.57%	0.97	0.000	No	0.00%	157.2bp	144.0bp	0.01%	1.15%	0.46%	0.00%	0.03%	3.61%	0.74%	0.00%				193bp	380bp	62.5%	0.0%	96.5%	87.1%	94.9%	279.0M	46.0%	97.1%	76554.7Mb	588.2M	59.4%	98.0%	47.8%
659_cWx-T1-TRNA-1_A23MVY2LT4_1_1																																	157.2bp	97.4%	286.6M																87.7%	58%	151bp	151bp	18%	371.9M
659_cWx-T1-TRNA-1_A23MVY2LT4_1_2																																																			86.5%	59%	151bp	151bp	18%	371.9M
659_cWx-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			86.2%	59%	134bp	151bp	9%	294.1M	86.2%	59%	134bp	151bp	9%	294.1M
659_cWx-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			86.6%	59%	134bp	151bp	9%	294.1M	86.6%	59%	134bp	151bp	9%	294.1M
659_cWx-T1-TRNA-1_A23MVY2LT4_2	9999000000	150763487	559540888	0.01%	0.70%	169385768	0.90%	0.95%	0.07%	0.05%	153194173	77693542	12249717	4053646	312.55	110.00	0.68%	0.52%	0.97	0.000	No	0.00%	167.6bp	155.0bp	0.01%	1.17%	0.48%	0.00%	0.02%	3.73%	0.79%	0.00%				217bp	435bp	70.2%	0.0%	96.4%	87.6%	95.0%	265.8M	55.3%	97.2%	75085.9Mb	559.5M	59.8%	98.2%	40.7%
659_cWx-T1-TRNA-1_A23MVY2LT4_2_1																																	167.6bp	97.2%	271.9M																87.6%	58%	151bp	151bp	18%	284.8M
659_cWx-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.4%	59%	151bp	151bp	18%	284.8M
659_cWx-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			87.6%	59%	138bp	151bp	9%	279.8M	87.6%	59%	138bp	151bp	9%	279.8M
659_cWx-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			87.9%	60%	138bp	151bp	9%	279.8M	87.9%	60%	138bp	151bp	9%	279.8M
659_cfy-T1-TRNA-1_A23MVY2LT4_1	9999000000	309136353	590927154	0.00%	0.51%	290422997	0.94%	0.97%	0.05%	0.03%	273562039	138483577	13974170	4094092	580.11	247.00	0.73%	0.62%	0.97	0.000	No	0.00%	163.2bp	149.0bp	0.02%	0.95%	0.64%	0.00%	0.04%	2.93%	0.92%	0.00%				244bp	659bp	51.1%	0.0%	97.7%	91.6%	96.3%	284.6M	38.1%	97.4%	78631.1Mb	590.9M	55.5%	98.5%	43.9%
659_cfy-T1-TRNA-1_A23MVY2LT4_1_1																																	163.2bp	98.2%	290.2M																86.6%	54%	151bp	151bp	18%	379.5M
659_cfy-T1-TRNA-1_A23MVY2LT4_1_2																																																			85.8%	55%	151bp	151bp	18%	379.5M
659_cfy-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			85.0%	55%	137bp	151bp	9%	295.5M	85.0%	55%	137bp	151bp	9%	295.5M
659_cfy-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			85.5%	55%	137bp	151bp	9%	295.5M	85.5%	55%	137bp	151bp	9%	295.5M
659_cfy-T1-TRNA-1_A23MVY2LT4_2	9999000000	164194879	588716550	0.01%	0.68%	188088891	0.92%	0.96%	0.06%	0.04%	173715580	87860795	11253770	3550298	352.20	139.00	0.68%	0.55%	0.97	0.000	No	0.00%	161.6bp	146.0bp	0.02%	1.07%	0.71%	0.00%	0.03%	3.29%	1.02%	0.00%				239bp	629bp	68.4%	0.0%	97.6%	91.2%	96.2%	283.1M	51.7%	97.2%	77396.0Mb	588.7M	55.9%	98.1%	45.5%
659_cfy-T1-TRNA-1_A23MVY2LT4_2_1																																	161.6bp	98.2%	289.1M																89.8%	55%	151bp	151bp	18%	425.6M
659_cfy-T1-TRNA-1_A23MVY2LT4_2_2																																																			88.4%	56%	151bp	151bp	18%	425.6M
659_cfy-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			87.5%	55%	135bp	151bp	9%	294.4M	87.5%	55%	135bp	151bp	9%	294.4M
659_cfy-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			87.8%	56%	135bp	151bp	9%	294.4M	87.8%	56%	135bp	151bp	9%	294.4M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1	9999000000	355296639	590628272	0.01%	0.48%	308532615	0.93%	0.97%	0.05%	0.03%	287775082	146005068	16798738	5036081	609.38	299.00	0.78%	0.67%	0.97	0.000	No	0.00%	165.9bp	152.0bp	0.01%	0.82%	0.41%	0.00%	0.01%	2.59%	0.62%	0.00%				219bp	525bp	48.1%	0.0%	96.6%	90.3%	95.8%	282.9M	36.8%	97.4%	78785.6Mb	590.6M	56.2%	98.4%	42.2%
659_ciJ-T1-TRNA-1_A23MVY2LT4_1_1																																	165.9bp	97.6%	288.2M																85.7%	55%	151bp	151bp	18%	379.9M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1_2																																																			85.0%	56%	151bp	151bp	18%	379.9M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.0%	55%	137bp	151bp	9%	295.3M	84.0%	55%	137bp	151bp	9%	295.3M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.6%	56%	137bp	151bp	9%	295.3M	84.6%	56%	137bp	151bp	9%	295.3M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2	9999000000	240163170	590612628	0.01%	0.56%	259205490	0.92%	0.96%	0.06%	0.04%	239355136	121693116	15995656	4797873	515.83	251.00	0.77%	0.65%	0.97	0.000	No	0.00%	172.2bp	158.0bp	0.01%	0.81%	0.40%	0.00%	0.01%	2.57%	0.61%	0.00%				238bp	593bp	56.5%	0.0%	96.4%	90.5%	95.9%	283.2M	44.1%	97.4%	80000.2Mb	590.6M	56.0%	98.4%	38.2%
659_ciJ-T1-TRNA-1_A23MVY2LT4_2_1																																	172.2bp	97.5%	287.8M																86.5%	55%	151bp	151bp	18%	345.2M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2_2																																																			85.7%	56%	151bp	151bp	18%	345.2M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			85.4%	55%	139bp	151bp	9%	295.3M	85.4%	55%	139bp	151bp	9%	295.3M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.0%	56%	139bp	151bp	9%	295.3M	86.0%	56%	139bp	151bp	9%	295.3M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1	9999000000	211594042	590996452	0.01%	0.63%	220249688	0.92%	0.95%	0.06%	0.05%	203212584	102297486	13276562	5041480	359.12	161.00	0.70%	0.58%	0.97	0.000	Yes	0.00%	136.4bp	129.0bp	0.01%	1.71%	0.66%	0.00%	0.02%	4.97%	0.95%	0.00%				151bp	331bp	63.1%	0.0%	97.6%	88.7%	95.2%	281.3M	42.9%	97.2%	73062.1Mb	591.0M	53.0%	98.5%	64.8%
659_ciZ-T1-TRNA-1_A23MVY2LT4_1_1																																	136.4bp	98.1%	289.9M																85.1%	52%	151bp	151bp	18%	305.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1_2																																																			84.1%	53%	151bp	151bp	18%	305.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			85.0%	52%	127bp	132bp	9%	295.5M	85.0%	52%	127bp	132bp	9%	295.5M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			85.2%	53%	127bp	132bp	9%	295.5M	85.2%	53%	127bp	132bp	9%	295.5M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2	9999000000	133743938	590606900	0.01%	0.77%	137631396	0.89%	0.93%	0.08%	0.07%	122948273	61835974	10988424	4404716	208.31	86.00	0.65%	0.47%	0.97	0.000	No	0.00%	132.9bp	126.0bp	0.01%	1.88%	0.74%	0.00%	0.02%	5.40%	1.08%	0.00%				143bp	292bp	77.2%	0.0%	97.6%	88.4%	95.1%	280.8M	51.9%	97.3%	71372.9Mb	590.6M	53.9%	98.4%	67.7%
659_ciZ-T1-TRNA-1_A23MVY2LT4_2_1																																	132.9bp	98.1%	289.7M																88.8%	53%	151bp	151bp	18%	327.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2_2																																																			87.5%	54%	151bp	151bp	18%	327.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			88.2%	53%	124bp	127bp	9%	295.3M	88.2%	53%	124bp	127bp	9%	295.3M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			88.2%	54%	124bp	127bp	9%	295.3M	88.2%	54%	124bp	127bp	9%	295.3M
659_d01-T1-TRNA-1_A23MVY2LT4_1	9999000000	233990666	550091604	0.01%	0.55%	247002771	0.92%	0.95%	0.06%	0.05%	227723128	115225578	15816702	5537956	446.80	234.00	0.75%	0.64%	0.98	0.000	No	0.00%	155.4bp	144.0bp	0.01%	0.92%	0.37%	0.00%	0.01%	3.00%	0.57%	0.00%				173bp	324bp	55.4%	0.0%	95.9%	89.5%	95.6%	263.0M	40.4%	97.4%	71796.1Mb	550.1M	55.2%	98.4%	49.6%
659_d01-T1-TRNA-1_A23MVY2LT4_1_1																																	155.4bp	97.4%	267.9M																81.3%	54%	151bp	151bp	18%	279.4M
659_d01-T1-TRNA-1_A23MVY2LT4_1_2																																																			80.8%	55%	151bp	151bp	18%	279.4M
659_d01-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			81.3%	54%	134bp	151bp	9%	275.0M	81.3%	54%	134bp	151bp	9%	275.0M
659_d01-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			82.0%	55%	134bp	151bp	9%	275.0M	82.0%	55%	134bp	151bp	9%	275.0M
659_d01-T1-TRNA-1_A23MVY2LT4_2	9999000000	142680172	420786928	0.01%	0.63%	155122232	0.91%	0.95%	0.07%	0.05%	141354299	71585979	11180911	3932966	279.63	142.00	0.71%	0.56%	0.97	0.000	No	0.00%	161.5bp	150.0bp	0.00%	0.89%	0.34%	0.00%	0.01%	2.93%	0.54%	0.00%				185bp	358bp	63.5%	0.0%	95.8%	89.6%	95.7%	201.3M	48.6%	97.3%	55927.8Mb	420.8M	55.1%	98.4%	44.9%
659_d01-T1-TRNA-1_A23MVY2LT4_2_1																																	161.5bp	97.3%	204.8M																82.2%	54%	151bp	151bp	18%	213.8M
659_d01-T1-TRNA-1_A23MVY2LT4_2_2																																																			81.6%	55%	151bp	151bp	18%	213.8M
659_d01-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			82.2%	54%	137bp	151bp	9%	210.4M	82.2%	54%	137bp	151bp	9%	210.4M
659_d01-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			82.8%	55%	137bp	151bp	9%	210.4M	82.8%	55%	137bp	151bp	9%	210.4M
659_dES-T1-TRNA-1_A23MVY2LT4_1	9999000000	325524298	591685756	0.01%	0.50%	298213228	0.93%	0.96%	0.06%	0.04%	276817668	139835325	17528903	6258707	555.73	278.00	0.76%	0.65%	0.98	0.000	Yes	0.00%	154.4bp	144.0bp	0.01%	1.22%	0.38%	0.00%	0.03%	3.84%	0.63%	0.00%				187bp	455bp	49.9%	0.0%	97.1%	88.7%	95.3%	282.1M	38.1%	97.5%	77433.5Mb	591.7M	52.8%	98.6%	49.8%
659_dES-T1-TRNA-1_A23MVY2LT4_1_1																																	154.4bp	97.8%	289.5M																84.1%	52%	151bp	151bp	18%	324.4M
659_dES-T1-TRNA-1_A23MVY2LT4_1_2																																																			83.8%	53%	151bp	151bp	18%	324.4M
659_dES-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			83.6%	52%	134bp	151bp	9%	295.8M	83.6%	52%	134bp	151bp	9%	295.8M
659_dES-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.3%	53%	134bp	151bp	9%	295.8M	84.3%	53%	134bp	151bp	9%	295.8M
659_dES-T1-TRNA-1_A23MVY2LT4_2	9999000000	183489136	514089484	0.01%	0.59%	208384394	0.92%	0.95%	0.07%	0.05%	191043305	96527234	13912806	5090510	379.05	181.00	0.72%	0.60%	0.98	0.000	No	0.00%	156.3bp	144.0bp	0.01%	1.33%	0.42%	0.00%	0.02%	4.20%	0.70%	0.00%				188bp	448bp	59.9%	0.0%	97.0%	88.7%	95.3%	245.1M	45.5%	97.4%	67152.9Mb	514.1M	53.3%	98.4%	49.9%
659_dES-T1-TRNA-1_A23MVY2LT4_2_1																																	156.3bp	97.8%	251.4M																84.8%	52%	151bp	151bp	18%	261.2M
659_dES-T1-TRNA-1_A23MVY2LT4_2_2																																																			84.3%	53%	151bp	151bp	18%	261.2M
659_dES-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			84.9%	52%	134bp	151bp	9%	257.0M	84.9%	52%	134bp	151bp	9%	257.0M
659_dES-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			85.6%	53%	134bp	151bp	9%	257.0M	85.6%	53%	134bp	151bp	9%	257.0M
659_dc8-T1-TRNA-1_A23MVY2LT4_1	9999000000	291400994	590597348	0.01%	0.52%	285523121	0.93%	0.96%	0.06%	0.04%	265667720	134638059	16234328	5140949	553.52	287.00	0.76%	0.66%	0.97	0.000	No	0.00%	164.0bp	150.0bp	0.02%	1.53%	0.47%	0.00%	0.05%	4.65%	0.73%	0.00%				216bp	527bp	52.0%	0.0%	96.7%	89.5%	95.5%	282.1M	38.8%	97.4%	78297.8Mb	590.6M	55.1%	98.4%	44.2%
659_dc8-T1-TRNA-1_A23MVY2LT4_1_1																																	164.0bp	97.6%	288.2M																84.8%	54%	151bp	151bp	18%	327.6M
659_dc8-T1-TRNA-1_A23MVY2LT4_1_2																																																			84.0%	55%	151bp	151bp	18%	327.6M
659_dc8-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.2%	54%	136bp	151bp	9%	295.3M	84.2%	54%	136bp	151bp	9%	295.3M
659_dc8-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.6%	55%	136bp	151bp	9%	295.3M	84.6%	55%	136bp	151bp	9%	295.3M
659_dc8-T1-TRNA-1_A23MVY2LT4_2	9999000000	178442949	590697900	0.01%	0.64%	212890491	0.92%	0.96%	0.07%	0.04%	195075013	98934654	14161384	4645221	402.43	198.00	0.73%	0.61%	0.97	0.000	No	0.00%	163.7bp	150.0bp	0.02%	1.64%	0.51%	0.00%	0.04%	5.00%	0.81%	0.00%				220bp	526bp	64.4%	0.0%	96.6%	89.2%	95.4%	281.9M	49.2%	97.4%	78544.5Mb	590.7M	55.7%	98.4%	43.2%
659_dc8-T1-TRNA-1_A23MVY2LT4_2_1																																	163.7bp	97.3%	287.5M																87.5%	54%	151bp	151bp	18%	346.2M
659_dc8-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.5%	55%	151bp	151bp	18%	346.2M
659_dc8-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.5%	55%	137bp	151bp	9%	295.3M	86.5%	55%	137bp	151bp	9%	295.3M
659_dc8-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.8%	56%	137bp	151bp	9%	295.3M	86.8%	56%	137bp	151bp	9%	295.3M
659_dcz-T1-TRNA-1_A23MVY2LT4_1	9999000000	46192447	180081228	0.01%	0.78%	39024059	0.81%	0.86%	0.14%	0.14%	31727290	15895236	5598751	2561351	46.97	19.00	0.41%	0.12%	0.97	0.000	No	0.00%	124.9bp	120.0bp	0.01%	1.09%	0.27%	0.00%	0.02%	3.39%	0.46%	0.00%				124bp	162bp	79.1%	0.0%	95.6%	85.0%	94.0%	84.7M	53.4%	97.3%	21071.8Mb	180.1M	54.6%	98.3%	75.7%
659_dcz-T1-TRNA-1_A23MVY2LT4_1_1																																	124.9bp	96.6%	87.0M																82.7%	54%	151bp	151bp	18%	91.6M
659_dcz-T1-TRNA-1_A23MVY2LT4_1_2																																																			81.1%	54%	151bp	151bp	18%	91.6M
659_dcz-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			82.7%	54%	120bp	122bp	9%	90.0M	82.7%	54%	120bp	122bp	9%	90.0M
659_dcz-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			82.3%	54%	120bp	122bp	9%	90.0M	82.3%	54%	120bp	122bp	9%	90.0M
659_dcz-T1-TRNA-1_A23MVY2LT4_2	9999000000	26698224	120151114	0.01%	0.83%	20679065	0.77%	0.82%	0.18%	0.18%	15836368	7931071	3733691	1738217	23.18	9.00	0.23%	0.04%	0.97	0.000	No	0.00%	121.7bp	116.0bp	0.01%	1.23%	0.29%	0.00%	0.02%	3.80%	0.51%	0.00%				120bp	158bp	83.6%	0.0%	95.4%	84.8%	94.0%	56.5M	53.3%	97.3%	13759.8Mb	120.2M	54.7%	97.8%	77.6%
659_dcz-T1-TRNA-1_A23MVY2LT4_2_1																																	121.7bp	96.3%	57.8M																84.5%	54%	151bp	151bp	18%	61.4M
659_dcz-T1-TRNA-1_A23MVY2LT4_2_2																																																			83.3%	54%	151bp	151bp	27%	61.4M
659_dcz-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			84.4%	54%	118bp	117bp	9%	60.1M	84.4%	54%	118bp	117bp	9%	60.1M
659_dcz-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			84.4%	54%	118bp	117bp	9%	60.1M	84.4%	54%	118bp	117bp	9%	60.1M
659_djb-T1-TRNA-1_A23MVY2LT4_1	9999000000	236554736	527166558	0.01%	0.55%	238227941	0.93%	0.96%	0.06%	0.04%	220989926	111414575	13901882	5151834	418.83	183.00	0.71%	0.59%	0.98	0.000	No	0.00%	145.2bp	136.0bp	0.02%	1.60%	0.56%	0.00%	0.04%	4.85%	0.86%	0.00%				175bp	416bp	55.2%	0.0%	97.3%	89.6%	95.7%	252.1M	39.6%	97.5%	67379.8Mb	527.2M	53.4%	98.6%	57.2%
659_djb-T1-TRNA-1_A23MVY2LT4_1_1																																	145.2bp	98.0%	258.4M																83.0%	52%	151bp	151bp	18%	267.4M
659_djb-T1-TRNA-1_A23MVY2LT4_1_2																																																			82.6%	53%	151bp	151bp	18%	267.4M
659_djb-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			83.0%	53%	131bp	142bp	9%	263.6M	83.0%	53%	131bp	142bp	9%	263.6M
659_djb-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			83.7%	53%	131bp	142bp	9%	263.6M	83.7%	53%	131bp	142bp	9%	263.6M
659_djb-T1-TRNA-1_A23MVY2LT4_2	9999000000	149003250	589736474	0.01%	0.69%	180488123	0.91%	0.94%	0.07%	0.06%	163366909	82192414	13299316	5220124	289.96	120.00	0.67%	0.53%	0.97	0.000	No	0.00%	136.2bp	127.0bp	0.01%	1.86%	0.63%	0.00%	0.03%	5.58%	1.00%	0.00%				158bp	355bp	69.8%	0.0%	97.3%	89.0%	95.5%	281.6M	49.1%	97.4%	72429.5Mb	589.7M	53.8%	98.3%	63.8%
659_djb-T1-TRNA-1_A23MVY2LT4_2_1																																	136.2bp	98.0%	289.0M																87.5%	53%	151bp	151bp	18%	336.1M
659_djb-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.3%	54%	151bp	151bp	18%	336.1M
659_djb-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.7%	53%	126bp	132bp	9%	294.9M	86.7%	53%	126bp	132bp	9%	294.9M
659_djb-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.9%	54%	126bp	132bp	9%	294.9M	86.9%	54%	126bp	132bp	9%	294.9M
659_dm4-T1-TRNA-1_A23MVY2LT4_1	9999000000	82623177	336261552	0.01%	0.76%	80762386	0.86%	0.90%	0.11%	0.10%	69076845	34684624	9034736	3971426	111.50	49.00	0.59%	0.33%	0.98	0.000	No	0.00%	131.9bp	126.0bp	0.01%	1.12%	0.27%	0.00%	0.03%	3.46%	0.46%	0.00%				133bp	185bp	76.6%	0.0%	95.7%	86.0%	94.3%	158.6M	55.6%	97.4%	41017.4Mb	336.3M	54.5%	98.4%	68.4%
659_dm4-T1-TRNA-1_A23MVY2LT4_1_1																																	131.9bp	97.0%	163.1M																84.0%	53%	151bp	151bp	18%	170.9M
659_dm4-T1-TRNA-1_A23MVY2LT4_1_2																																																			82.6%	54%	151bp	151bp	18%	170.9M
659_dm4-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.0%	54%	125bp	132bp	9%	168.1M	84.0%	54%	125bp	132bp	9%	168.1M
659_dm4-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			83.8%	54%	125bp	132bp	9%	168.1M	83.8%	54%	125bp	132bp	9%	168.1M
659_dm4-T1-TRNA-1_A23MVY2LT4_2	9999000000	52672785	266778546	0.01%	0.83%	44532196	0.80%	0.86%	0.15%	0.14%	35686722	17896654	6721061	3029074	55.96	24.00	0.45%	0.15%	0.97	0.000	No	0.00%	129.6bp	123.0bp	0.01%	1.27%	0.30%	0.00%	0.03%	3.91%	0.53%	0.00%				130bp	180bp	84.0%	0.0%	95.6%	85.1%	94.2%	125.6M	58.6%	97.3%	31951.4Mb	266.8M	55.4%	98.1%	70.0%
659_dm4-T1-TRNA-1_A23MVY2LT4_2_1																																	129.6bp	96.8%	129.1M																86.9%	54%	151bp	151bp	18%	136.0M
659_dm4-T1-TRNA-1_A23MVY2LT4_2_2																																																			85.2%	55%	151bp	151bp	18%	136.0M
659_dm4-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.9%	55%	123bp	127bp	9%	133.4M	86.9%	55%	123bp	127bp	9%	133.4M
659_dm4-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.5%	55%	123bp	127bp	9%	133.4M	86.5%	55%	123bp	127bp	9%	133.4M
659_dts-T1-TRNA-1_A23MVY2LT4_1	9999000000	193305133	539858052	0.01%	0.60%	217690041	0.92%	0.96%	0.06%	0.04%	200362999	101050932	13067478	4756064	371.80	188.00	0.75%	0.61%	0.97	0.000	No	0.00%	144.4bp	135.0bp	0.01%	0.81%	0.45%	0.00%	0.01%	2.55%	0.69%	0.00%				165bp	346bp	60.2%	0.0%	97.3%	88.5%	95.2%	256.9M	43.8%	97.4%	68821.0Mb	539.9M	56.1%	98.5%	56.7%
659_dts-T1-TRNA-1_A23MVY2LT4_1_1																																	144.4bp	97.9%	264.3M																84.3%	55%	151bp	151bp	18%	274.0M
659_dts-T1-TRNA-1_A23MVY2LT4_1_2																																																			83.6%	56%	151bp	151bp	18%	274.0M
659_dts-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.3%	55%	131bp	142bp	9%	269.9M	84.3%	55%	131bp	142bp	9%	269.9M
659_dts-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			84.8%	56%	131bp	142bp	9%	269.9M	84.8%	56%	131bp	142bp	9%	269.9M
659_dts-T1-TRNA-1_A23MVY2LT4_2	9999000000	180090674	590610852	0.01%	0.65%	205834371	0.91%	0.95%	0.06%	0.05%	188281585	95056798	13112709	4705222	359.34	184.00	0.74%	0.61%	0.97	0.000	Yes	0.09%	149.2bp	139.0bp	0.00%	0.90%	0.49%	0.00%	0.01%	2.87%	0.74%	0.00%				177bp	405bp	65.6%	0.0%	97.2%	88.8%	95.3%	281.3M	49.2%	97.4%	75850.1Mb	590.6M	55.5%	98.4%	54.4%
659_dts-T1-TRNA-1_A23MVY2LT4_2_1																																	149.2bp	97.8%	288.9M																88.3%	54%	151bp	151bp	18%	409.0M
659_dts-T1-TRNA-1_A23MVY2LT4_2_2																																																			87.3%	55%	151bp	151bp	18%	409.0M
659_dts-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.1%	55%	132bp	142bp	9%	295.3M	86.1%	55%	132bp	142bp	9%	295.3M
659_dts-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.4%	55%	132bp	147bp	9%	295.3M	86.4%	55%	132bp	147bp	9%	295.3M
659_eHw-T1-TRNA-1_A23MVY2LT4_1	9999000000	155123969	589604712	0.01%	0.69%	184947706	0.92%	0.96%	0.06%	0.04%	170835965	86251675	10645828	3499342	347.80	90.00	0.66%	0.48%	0.97	0.000	No	0.00%	159.7bp	149.0bp	0.00%	0.47%	0.61%	0.00%	0.01%	1.68%	0.99%	0.00%				224bp	482bp	69.0%	0.0%	97.7%	90.4%	96.0%	283.1M	51.4%	97.0%	78200.8Mb	589.6M	60.9%	98.3%	44.5%
659_eHw-T1-TRNA-1_A23MVY2LT4_1_1																																	159.7bp	98.3%	289.8M																90.9%	59%	151bp	151bp	18%	483.1M
659_eHw-T1-TRNA-1_A23MVY2LT4_1_2																																																			89.5%	60%	151bp	151bp	18%	483.1M
659_eHw-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			88.2%	60%	137bp	151bp	9%	294.8M	88.2%	60%	137bp	151bp	9%	294.8M
659_eHw-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			88.4%	61%	137bp	151bp	9%	294.8M	88.4%	61%	137bp	151bp	9%	294.8M
659_eHw-T1-TRNA-1_A23MVY2LT4_2	9999000000	117049101	589492568	0.01%	0.77%	136918684	0.91%	0.95%	0.07%	0.05%	124142215	62604226	9314104	3259700	244.72	61.00	0.61%	0.41%	0.97	0.000	No	0.00%	155.4bp	144.0bp	0.00%	0.53%	0.68%	0.00%	0.01%	1.91%	1.11%	0.00%				216bp	453bp	77.2%	0.0%	97.7%	89.9%	95.9%	282.7M	57.7%	97.1%	76855.0Mb	589.5M	61.3%	98.2%	48.8%
659_eHw-T1-TRNA-1_A23MVY2LT4_2_1																																	155.4bp	98.3%	289.6M																91.9%	59%	151bp	151bp	18%	426.6M
659_eHw-T1-TRNA-1_A23MVY2LT4_2_2																																																			90.4%	60%	151bp	151bp	18%	426.6M
659_eHw-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			90.0%	60%	134bp	151bp	9%	294.7M	90.0%	60%	134bp	151bp	9%	294.7M
659_eHw-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			90.0%	61%	134bp	151bp	9%	294.7M	90.0%	61%	134bp	151bp	9%	294.7M
659_ecd-T1-TRNA-1_A23MVY2LT4_1	9999000000	355461595	540181198	0.01%	0.45%	295726141	0.94%	0.97%	0.05%	0.03%	276890083	140292117	15918237	4970689	588.23	281.00	0.76%	0.65%	0.98	0.000	No	0.00%	162.8bp	149.0bp	0.01%	0.73%	0.34%	0.00%	0.03%	2.33%	0.52%	0.00%				218bp	564bp	45.5%	0.0%	97.1%	90.1%	95.9%	259.0M	34.0%	97.5%	71736.0Mb	540.2M	54.4%	98.6%	43.9%
659_ecd-T1-TRNA-1_A23MVY2LT4_1_1																																	162.8bp	97.9%	264.5M																83.1%	53%	151bp	151bp	18%	273.9M
659_ecd-T1-TRNA-1_A23MVY2LT4_1_2																																																			82.8%	54%	151bp	151bp	18%	273.9M
659_ecd-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			83.2%	54%	136bp	151bp	9%	270.1M	83.2%	54%	136bp	151bp	9%	270.1M
659_ecd-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			83.9%	54%	136bp	151bp	9%	270.1M	83.9%	54%	136bp	151bp	9%	270.1M
659_ecd-T1-TRNA-1_A23MVY2LT4_2	9999000000	308195964	455111232	0.01%	0.44%	253945574	0.94%	0.97%	0.05%	0.03%	237890511	120824118	13608953	3870026	533.15	245.00	0.75%	0.63%	0.97	0.000	No	0.00%	179.7bp	162.0bp	0.01%	0.80%	0.38%	0.00%	0.02%	2.61%	0.59%	0.00%				280bp	791bp	44.4%	0.0%	97.1%	90.5%	96.0%	218.5M	33.9%	97.4%	61985.3Mb	455.1M	54.4%	98.5%	35.7%
659_ecd-T1-TRNA-1_A23MVY2LT4_2_1																																	179.7bp	97.8%	222.7M																82.1%	53%	151bp	151bp	18%	231.0M
659_ecd-T1-TRNA-1_A23MVY2LT4_2_2																																																			81.6%	54%	151bp	151bp	18%	231.0M
659_ecd-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			82.1%	53%	140bp	151bp	9%	227.6M	82.1%	53%	140bp	151bp	9%	227.6M
659_ecd-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			82.8%	54%	140bp	151bp	9%	227.6M	82.8%	54%	140bp	151bp	9%	227.6M
659_epP-T1-TRNA-1_A23MVY2LT4_1	9999000000	202585948	589179086	0.01%	0.61%	227684165	0.92%	0.96%	0.06%	0.04%	209281144	106096163	14413411	4587048	437.72	205.00	0.73%	0.61%	0.97	0.000	No	0.00%	166.6bp	153.0bp	0.00%	0.66%	0.34%	0.00%	0.01%	2.17%	0.55%	0.00%				211bp	448bp	61.8%	0.0%	96.3%	86.8%	94.6%	278.7M	47.3%	97.2%	79395.6Mb	589.2M	56.7%	98.2%	40.2%
659_epP-T1-TRNA-1_A23MVY2LT4_1_1																																	166.6bp	97.6%	287.5M																87.9%	55%	151bp	151bp	18%	420.8M
659_epP-T1-TRNA-1_A23MVY2LT4_1_2																																																			86.8%	56%	151bp	151bp	18%	420.8M
659_epP-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			85.4%	56%	139bp	151bp	9%	294.6M	85.4%	56%	139bp	151bp	9%	294.6M
659_epP-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			85.8%	57%	139bp	151bp	9%	294.6M	85.8%	57%	139bp	151bp	9%	294.6M
659_epP-T1-TRNA-1_A23MVY2LT4_2	9999000000	143468675	588125580	0.01%	0.74%	153557070	0.90%	0.95%	0.08%	0.05%	137760323	69786234	11640021	3836156	282.21	123.00	0.68%	0.54%	0.97	0.000	No	0.00%	167.4bp	154.0bp	0.00%	0.71%	0.37%	0.00%	0.01%	2.36%	0.59%	0.00%				211bp	438bp	74.4%	0.0%	96.4%	86.2%	94.4%	277.6M	59.4%	97.2%	79091.2Mb	588.1M	57.6%	98.0%	40.4%
659_epP-T1-TRNA-1_A23MVY2LT4_2_1																																	167.4bp	97.6%	287.0M																88.9%	56%	151bp	151bp	18%	336.9M
659_epP-T1-TRNA-1_A23MVY2LT4_2_2																																																			87.0%	57%	151bp	151bp	18%	336.9M
659_epP-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			88.2%	57%	138bp	151bp	9%	294.1M	88.2%	57%	138bp	151bp	9%	294.1M
659_epP-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			87.8%	57%	138bp	151bp	9%	294.1M	87.8%	57%	138bp	151bp	9%	294.1M
659_ezg-T1-TRNA-1_A23MVY2LT4_1	9999000000	354481274	591795694	0.01%	0.48%	306738023	0.94%	0.97%	0.05%	0.03%	287448017	145247340	15613036	5142858	575.30	277.00	0.75%	0.64%	0.97	0.000	Yes	0.00%	152.1bp	140.0bp	0.01%	1.49%	0.63%	0.00%	0.02%	4.57%	0.94%	0.00%				192bp	459bp	48.5%	0.0%	97.3%	89.1%	95.5%	282.6M	33.9%	97.4%	76319.3Mb	591.8M	54.8%	98.6%	52.2%
659_ezg-T1-TRNA-1_A23MVY2LT4_1_1																																	152.1bp	97.8%	289.5M																84.6%	54%	151bp	151bp	18%	362.0M
659_ezg-T1-TRNA-1_A23MVY2LT4_1_2																																																			84.2%	54%	151bp	151bp	18%	362.0M
659_ezg-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			83.2%	54%	132bp	147bp	9%	295.9M	83.2%	54%	132bp	147bp	9%	295.9M
659_ezg-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			83.9%	55%	132bp	147bp	9%	295.9M	83.9%	55%	132bp	147bp	9%	295.9M
659_ezg-T1-TRNA-1_A23MVY2LT4_2	9999000000	236806824	590959336	0.01%	0.57%	253603353	0.93%	0.96%	0.06%	0.04%	235620129	119186408	14110114	4622849	478.84	222.00	0.73%	0.62%	0.97	0.000	No	0.00%	158.6bp	147.0bp	0.01%	1.58%	0.67%	0.00%	0.02%	4.86%	1.00%	0.00%				215bp	528bp	57.5%	0.0%	97.2%	89.3%	95.5%	282.3M	42.7%	97.4%	77822.2Mb	591.0M	55.1%	98.5%	47.5%
659_ezg-T1-TRNA-1_A23MVY2LT4_2_1																																	158.6bp	97.6%	288.5M																88.0%	54%	151bp	151bp	18%	453.4M
659_ezg-T1-TRNA-1_A23MVY2LT4_2_2																																																			87.2%	55%	151bp	151bp	18%	453.4M
659_ezg-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			85.1%	54%	135bp	151bp	9%	295.5M	85.1%	54%	135bp	151bp	9%	295.5M
659_ezg-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			85.6%	55%	135bp	151bp	9%	295.5M	85.6%	55%	135bp	151bp	9%	295.5M
659_gK-T1-TRNA-1_A23MVY2LT4_1	9999000000	309032942	591390610	0.01%	0.51%	290812039	0.93%	0.97%	0.06%	0.03%	271053883	137653592	16269091	4759138	593.31	258.00	0.72%	0.62%	0.97	0.000	No	0.00%	172.8bp	158.0bp	0.02%	1.27%	0.46%	0.00%	0.04%	4.08%	0.73%	0.00%				235bp	598bp	51.1%	0.0%	96.9%	88.0%	94.9%	280.6M	39.3%	97.3%	80170.9Mb	591.4M	54.3%	98.6%	37.9%
659_gK-T1-TRNA-1_A23MVY2LT4_1_1																																	172.8bp	97.9%	289.4M																85.8%	53%	151bp	151bp	18%	375.3M
659_gK-T1-TRNA-1_A23MVY2LT4_1_2																																																			85.4%	54%	151bp	151bp	18%	375.3M
659_gK-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			84.1%	53%	139bp	151bp	9%	295.7M	84.1%	53%	139bp	151bp	9%	295.7M
659_gK-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			85.0%	54%	139bp	151bp	9%	295.7M	85.0%	54%	139bp	151bp	9%	295.7M
659_gK-T1-TRNA-1_A23MVY2LT4_2	9999000000	195875134	590827346	0.01%	0.62%	223496882	0.92%	0.96%	0.06%	0.04%	205801952	104510560	14121792	4412106	435.10	181.00	0.70%	0.58%	0.97	0.000	No	0.00%	167.3bp	152.0bp	0.02%	1.46%	0.53%	0.00%	0.04%	4.60%	0.82%	0.00%				221bp	544bp	62.6%	0.0%	96.9%	88.0%	95.0%	280.5M	48.0%	97.4%	78914.0Mb	590.8M	54.7%	98.5%	41.8%
659_gK-T1-TRNA-1_A23MVY2LT4_2_1																																	167.3bp	97.9%	289.2M																87.8%	53%	151bp	151bp	18%	368.0M
659_gK-T1-TRNA-1_A23MVY2LT4_2_2																																																			87.0%	54%	151bp	151bp	18%	368.0M
659_gK-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			86.3%	54%	137bp	151bp	9%	295.4M	86.3%	54%	137bp	151bp	9%	295.4M
659_gK-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			86.8%	55%	137bp	151bp	9%	295.4M	86.8%	55%	137bp	151bp	9%	295.4M
659_rd-T1-TRNA-1_A23MVY2LT4_1	9999000000	385722251	473600946	0.01%	0.42%	272938635	0.94%	0.97%	0.05%	0.03%	255988191	129824715	14413839	4323955	560.55	244.00	0.75%	0.63%	0.98	0.000	No	0.00%	171.1bp	156.0bp	0.00%	1.08%	0.28%	0.00%	0.01%	3.70%	0.48%	0.00%				246bp	689bp	42.6%	0.0%	96.9%	91.8%	96.3%	228.1M	32.2%	97.5%	63711.9Mb	473.6M	53.5%	98.6%	39.9%
659_rd-T1-TRNA-1_A23MVY2LT4_1_1																																	171.1bp	97.9%	231.7M																82.7%	52%	151bp	151bp	18%	240.1M
659_rd-T1-TRNA-1_A23MVY2LT4_1_2																																																			81.9%	53%	151bp	151bp	18%	240.1M
659_rd-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																			82.7%	53%	138bp	151bp	9%	236.8M	82.7%	53%	138bp	151bp	9%	236.8M
659_rd-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																			83.1%	53%	138bp	151bp	9%	236.8M	83.1%	53%	138bp	151bp	9%	236.8M
659_rd-T1-TRNA-1_A23MVY2LT4_2	9999000000	245132651	591237046	0.01%	0.56%	261084971	0.93%	0.96%	0.06%	0.04%	242019555	122945708	15832305	4861547	529.53	227.00	0.74%	0.63%	0.98	0.000	No	0.00%	174.3bp	158.0bp	0.00%	1.19%	0.31%	0.00%	0.01%	4.12%	0.54%	0.00%				260bp	722bp	56.1%	0.0%	96.9%	91.9%	96.3%	284.8M	43.6%	97.4%	79788.8Mb	591.2M	54.0%	98.5%	38.5%
659_rd-T1-TRNA-1_A23MVY2LT4_2_1																																	174.3bp	97.8%	289.1M																86.9%	53%	151bp	151bp	18%	361.4M
659_rd-T1-TRNA-1_A23MVY2LT4_2_2																																																			86.0%	54%	151bp	151bp	18%	361.4M
659_rd-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																			85.6%	53%	138bp	151bp	9%	295.6M	85.6%	53%	138bp	151bp	9%	295.6M
659_rd-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																			85.9%	54%	139bp	151bp	9%	295.6M	85.9%	54%	139bp	151bp	9%	295.6M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1	9999000000	493532943	512573856	0.01%	0.39%	313257078	0.94%	0.98%	0.05%	0.02%	295440108	150143084	15002380	3733130	685.33	274.00	0.71%	0.62%	0.97	0.000	Yes	62.22%	188.5bp	171.0bp	0.01%	1.69%	0.76%	0.00%	0.02%	4.97%	1.08%	0.00%				354bp	1022bp	39.1%	0.0%	97.5%	90.6%	96.1%	246.2M	29.6%	97.3%	70181.3Mb	512.6M	54.8%	98.6%	32.5%
FFPE_HD789_01_RNA_13_A23MVY2LT4_1_1																																	188.5bp	98.0%	251.1M																83.5%	54%	151bp	151bp	18%	260.0M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1_2																																																			83.2%	55%	151bp	151bp	18%	260.0M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1_trimmed_1																																																			83.5%	54%	141bp	151bp	9%	256.3M	83.5%	54%	141bp	151bp	9%	256.3M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1_trimmed_2																																																			84.3%	55%	141bp	151bp	9%	256.3M	84.3%	55%	141bp	151bp	9%	256.3M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1	9999000000	318186658	590517774	0.01%	0.52%	286073265	0.93%	0.97%	0.06%	0.03%	265278038	135029091	16740784	4731767	589.61	150.00	0.61%	0.53%	0.97	0.000	No	0.00%	178.5bp	164.0bp	0.01%	1.47%	0.98%	0.00%	0.02%	4.18%	1.36%	0.00%				271bp	743bp	51.9%	0.0%	96.3%	89.9%	95.8%	282.8M	39.8%	97.2%	80726.5Mb	590.5M	54.3%	98.4%	34.3%
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1_1																																	178.5bp	96.8%	285.9M																86.7%	53%	151bp	151bp	18%	346.8M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1_2																																																			86.3%	54%	151bp	151bp	18%	346.8M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1_trimmed_1																																																			85.7%	53%	141bp	151bp	9%	295.3M	85.7%	53%	141bp	151bp	9%	295.3M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1_trimmed_2																																																			86.6%	54%	141bp	151bp	9%	295.3M	86.6%	54%	141bp	151bp	9%	295.3M
NTC_0001_0001_A23MVY2LT4_1	9999000000	1993	1682	0.63%	0.15%	1432	0.04%	0.19%	0.22%	0.81%	63	34	315	149	0.00	0.00	0.00%	0.00%	0.93	0.000	Skipped	N/A%	81.2bp	72.0bp	0.00%	3.80%	3.80%	0.00%	0.00%	9.89%	9.89%	0.00%				32bp	35bp	39.8%	0.4%	33.8%	2.9%	9.4%	0.0M	44.0%	88.5%	0.2Mb	0.0M	71.3%	2.5%	50.1%
NTC_0001_0001_A23MVY2LT4_1_1																																	81.2bp	9.5%	0.0M																97.0%	76%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23MVY2LT4_1_2																																																			95.4%	98%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23MVY2LT4_1_trimmed_1																																																			35.0%	67%	108bp	137bp	45%	0.0M	35.0%	67%	108bp	137bp	45%	0.0M
NTC_0001_0001_A23MVY2LT4_1_trimmed_2																																																			42.9%	75%	110bp	142bp	45%	0.0M	42.9%	75%	110bp	142bp	45%	0.0M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1	9999000000	265943868	591605900	0.01%	0.55%	266743033	0.94%	0.96%	0.05%	0.04%	249848414	126023861	13781338	4772553	474.03	196.00	0.71%	0.60%	0.98	0.000	No	0.00%	143.6bp	135.0bp	0.01%	1.32%	0.61%	0.00%	0.02%	4.18%	0.90%	0.00%				160bp	352bp	55.2%	0.0%	97.5%	90.6%	96.0%	284.0M	38.1%	97.5%	75057.4Mb	591.6M	54.3%	98.6%	57.5%
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1_1																																	143.6bp	98.3%	290.7M																86.5%	53%	151bp	151bp	18%	391.3M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1_2																																																			85.4%	54%	151bp	151bp	18%	391.3M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																			84.6%	53%	130bp	142bp	9%	295.8M	84.6%	53%	130bp	142bp	9%	295.8M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																			84.7%	54%	130bp	142bp	9%	295.8M	84.7%	54%	130bp	142bp	9%	295.8M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1	9999000000	140801160	581201710	0.01%	0.72%	162166354	0.91%	0.95%	0.07%	0.05%	147754102	74203312	10697616	4249465	247.81	92.00	0.64%	0.49%	0.98	0.000	No	0.00%	130.1bp	124.0bp	0.01%	0.98%	0.80%	0.00%	0.03%	3.09%	1.15%	0.00%				134bp	221bp	72.6%	0.0%	97.4%	89.8%	95.7%	278.0M	49.0%	97.4%	70271.8Mb	581.2M	54.7%	98.3%	69.1%
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1_1																																	130.1bp	98.2%	285.3M																86.6%	53%	151bp	151bp	18%	295.6M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1_2																																																			85.3%	54%	151bp	151bp	18%	295.6M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																			86.6%	54%	124bp	127bp	9%	290.6M	86.6%	54%	124bp	127bp	9%	290.6M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																			86.6%	54%	124bp	127bp	9%	290.6M	86.6%	54%	124bp	127bp	9%	290.6M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1	9999000000	202052096	590808070	0.01%	0.61%	232051368	0.93%	0.96%	0.06%	0.04%	215246791	108583996	13320086	4743697	410.30	167.00	0.70%	0.58%	0.98	0.000	No	0.00%	145.3bp	136.0bp	0.01%	1.10%	0.63%	0.00%	0.02%	3.54%	0.95%	0.00%				160bp	334bp	61.1%	0.0%	97.2%	90.3%	95.9%	283.3M	43.6%	97.4%	75610.3Mb	590.8M	54.4%	98.5%	55.6%
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1_1																																	145.3bp	98.1%	289.6M																87.2%	53%	151bp	151bp	18%	396.1M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1_2																																																			86.0%	54%	151bp	151bp	18%	396.1M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1_trimmed_1																																																			85.3%	54%	131bp	142bp	9%	295.4M	85.3%	54%	131bp	142bp	9%	295.4M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1_trimmed_2																																																			85.4%	54%	131bp	142bp	9%	295.4M	85.4%	54%	131bp	142bp	9%	295.4M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1	9999000000	139806567	590126794	0.01%	0.73%	156829212	0.91%	0.95%	0.07%	0.05%	142967370	71859203	10310854	3950938	251.02	106.00	0.67%	0.51%	0.97	0.000	No	0.00%	136.1bp	129.0bp	0.01%	1.11%	0.70%	0.00%	0.02%	3.55%	1.04%	0.00%				146bp	286bp	73.9%	0.0%	97.6%	90.2%	95.9%	282.9M	51.6%	97.2%	73085.1Mb	590.1M	54.7%	98.4%	63.5%
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1_1																																	136.1bp	98.3%	290.1M																89.3%	54%	151bp	151bp	18%	376.0M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1_2																																																			87.9%	54%	151bp	151bp	18%	376.0M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1_trimmed_1																																																			87.8%	54%	127bp	132bp	9%	295.1M	87.8%	54%	127bp	132bp	9%	295.1M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1_trimmed_2																																																			87.7%	54%	128bp	137bp	9%	295.1M	87.7%	54%	128bp	137bp	9%	295.1M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1	9999000000	116638841	589216832	0.01%	0.77%	136312057	0.90%	0.94%	0.07%	0.06%	123035147	61816270	9376623	3669052	208.85	92.00	0.67%	0.48%	0.97	0.000	No	0.00%	132.0bp	125.0bp	0.04%	0.93%	0.48%	0.00%	0.08%	2.71%	0.70%	0.00%				138bp	243bp	77.4%	0.0%	97.4%	89.4%	95.4%	281.2M	56.7%	97.4%	71714.6Mb	589.2M	54.4%	98.2%	66.8%
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1_1																																	132.0bp	98.2%	289.3M																88.7%	53%	151bp	151bp	18%	343.3M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1_2																																																			87.3%	54%	151bp	151bp	18%	343.3M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																			87.7%	54%	125bp	132bp	9%	294.6M	87.7%	54%	125bp	132bp	9%	294.6M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																			87.6%	54%	125bp	132bp	9%	294.6M	87.6%	54%	125bp	132bp	9%	294.6M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1	9999000000	188477457	523873694	0.01%	0.60%	210725942	0.93%	0.96%	0.06%	0.04%	195136194	98249155	11936768	4396448	360.45	181.00	0.74%	0.61%	0.98	0.000	No	0.00%	140.7bp	133.0bp	0.01%	0.62%	0.35%	0.00%	0.02%	2.11%	0.57%	0.00%				149bp	264bp	60.2%	0.0%	97.1%	87.0%	94.5%	247.5M	43.4%	97.4%	66216.9Mb	523.9M	55.4%	98.4%	59.4%
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1_1																																	140.7bp	98.2%	257.2M																84.6%	54%	151bp	151bp	18%	266.2M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1_2																																																			83.2%	55%	151bp	151bp	18%	266.2M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																			84.6%	55%	130bp	137bp	9%	261.9M	84.6%	55%	130bp	137bp	9%	261.9M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																			84.4%	55%	130bp	137bp	9%	261.9M	84.4%	55%	130bp	137bp	9%	261.9M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1	9999000000	138839805	589255236	0.01%	0.70%	177095898	0.90%	0.95%	0.07%	0.05%	159635483	80430296	11617854	4288797	297.51	143.00	0.72%	0.57%	0.97	0.000	No	0.00%	145.1bp	136.0bp	0.01%	0.46%	0.33%	0.00%	0.01%	1.62%	0.56%	0.00%				153bp	255bp	70.6%	0.0%	96.7%	84.7%	93.4%	275.3M	51.0%	97.3%	74963.0Mb	589.3M	57.5%	98.2%	56.4%
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1_1																																	145.1bp	97.9%	288.6M																88.4%	56%	151bp	151bp	18%	364.0M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1_2																																																			87.0%	57%	151bp	151bp	27%	364.0M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																			87.0%	57%	131bp	142bp	18%	294.6M	87.0%	57%	131bp	142bp	18%	294.6M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																			87.1%	57%	131bp	142bp	18%	294.6M	87.1%	57%	131bp	142bp	18%	294.6M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1	9999000000	41069821	220127548	0.01%	0.82%	40042751	0.85%	0.90%	0.11%	0.10%	34100284	17068194	4348347	1912315	48.95	21.00	0.43%	0.13%	0.97	0.000	No	0.00%	117.9bp	114.0bp	0.07%	0.67%	0.31%	0.00%	0.14%	1.91%	0.44%	0.00%				118bp	172bp	82.4%	0.0%	97.0%	87.2%	95.0%	104.5M	51.1%	97.3%	24771.9Mb	220.1M	54.9%	98.0%	80.5%
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1_1																																	117.9bp	97.7%	107.5M																86.1%	54%	151bp	151bp	18%	112.3M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1_2																																																			84.9%	55%	151bp	151bp	27%	112.3M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																			86.1%	54%	115bp	117bp	9%	110.1M	86.1%	54%	115bp	117bp	9%	110.1M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																			86.0%	55%	116bp	117bp	9%	110.1M	86.0%	55%	116bp	117bp	9%	110.1M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1	9999000000	74604231	557404190	0.01%	0.86%	78246677	0.82%	0.89%	0.12%	0.11%	63859710	32029863	9593228	4136212	99.02	25.00	0.47%	0.24%	0.97	0.000	No	0.00%	126.0bp	121.0bp	0.02%	0.46%	0.55%	0.00%	0.03%	1.29%	0.79%	0.00%				128bp	185bp	86.7%	0.0%	96.9%	85.9%	94.5%	263.4M	58.4%	97.1%	65633.8Mb	557.4M	60.7%	97.9%	72.3%
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1_1																																	126.0bp	97.4%	271.4M																90.5%	58%	151bp	151bp	18%	284.6M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1_2																																																			88.9%	59%	151bp	151bp	18%	284.6M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																			90.6%	60%	121bp	122bp	9%	278.7M	90.6%	60%	121bp	122bp	9%	278.7M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																			90.4%	60%	121bp	127bp	9%	278.7M	90.4%	60%	121bp	127bp	9%	278.7M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1	9999000000	6221904	30609244	0.01%	0.82%	5595717	0.82%	0.88%	0.13%	0.12%	4609235	2303496	704224	315636	5.99	1.00	0.04%	0.01%	0.97	0.000	No	0.00%	108.9bp	105.0bp	0.04%	0.70%	0.44%	0.00%	0.08%	1.90%	0.62%	0.00%				106bp	135bp	82.5%	0.0%	96.8%	82.9%	93.5%	14.3M	45.2%	97.1%	3208.1Mb	30.6M	58.3%	95.0%	86.0%
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_1																																	108.9bp	97.0%	14.8M																83.1%	57%	151bp	151bp	36%	16.1M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_2																																																			81.4%	58%	151bp	151bp	36%	16.1M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_trimmed_1																																																			82.6%	58%	108bp	107bp	9%	15.3M	82.6%	58%	108bp	107bp	9%	15.3M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_trimmed_2																																																			82.3%	58%	108bp	107bp	9%	15.3M	82.3%	58%	108bp	107bp	9%	15.3M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1	9999000000	58644573	461742130	0.01%	0.86%	64824812	0.84%	0.91%	0.10%	0.09%	54653854	27445528	6669365	2790304	92.22	29.00	0.50%	0.23%	0.97	0.000	No	0.00%	134.2bp	127.0bp	0.02%	1.61%	0.28%	0.00%	0.03%	3.57%	0.38%	0.00%				153bp	378bp	86.6%	0.0%	97.3%	81.5%	92.0%	212.5M	60.3%	97.3%	56452.5Mb	461.7M	53.9%	98.2%	66.4%
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1_1																																	134.2bp	97.1%	224.2M																90.6%	53%	151bp	151bp	27%	235.1M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1_2																																																			89.1%	54%	151bp	151bp	18%	235.1M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																			90.6%	53%	126bp	132bp	9%	230.9M	90.6%	53%	126bp	132bp	9%	230.9M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																			90.4%	54%	126bp	132bp	9%	230.9M	90.4%	54%	126bp	132bp	9%	230.9M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1	9999000000	60087708	446469968	0.01%	0.86%	61797160	0.81%	0.89%	0.12%	0.11%	50067171	25086417	7425565	3239179	78.37	29.00	0.50%	0.20%	0.97	0.000	No	0.00%	126.2bp	120.0bp	0.02%	1.15%	0.23%	0.00%	0.04%	2.71%	0.31%	0.00%				130bp	227bp	87.0%	0.0%	96.6%	80.6%	92.0%	205.3M	56.4%	97.1%	52582.9Mb	446.5M	54.6%	98.2%	73.7%
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1_1																																	126.2bp	97.0%	216.6M																89.9%	54%	151bp	151bp	18%	227.3M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1_2																																																			88.2%	54%	151bp	151bp	18%	227.3M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																			90.0%	54%	121bp	122bp	9%	223.2M	90.0%	54%	121bp	122bp	9%	223.2M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																			89.6%	54%	121bp	122bp	9%	223.2M	89.6%	54%	121bp	122bp	9%	223.2M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1	9999000000	145763366	562945688	0.01%	0.68%	181484166	0.92%	0.95%	0.06%	0.05%	166858062	83899157	10818305	4104017	292.57	120.00	0.68%	0.53%	0.98	0.000	No	0.00%	134.2bp	127.0bp	0.01%	2.13%	0.47%	0.00%	0.01%	5.21%	0.65%	0.00%				152bp	354bp	68.2%	0.0%	97.6%	87.7%	94.8%	266.9M	46.1%	97.4%	68845.7Mb	562.9M	53.7%	98.3%	66.4%
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1_1																																	134.2bp	97.8%	275.3M																85.1%	53%	151bp	151bp	18%	286.2M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1_2																																																			83.8%	53%	151bp	151bp	27%	286.2M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1_trimmed_1																																																			85.2%	53%	125bp	132bp	9%	281.5M	85.2%	53%	125bp	132bp	9%	281.5M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1_trimmed_2																																																			85.2%	53%	126bp	132bp	9%	281.5M	85.2%	53%	126bp	132bp	9%	281.5M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1	9999000000	124133890	531990824	0.01%	0.75%	134402616	0.89%	0.92%	0.09%	0.08%	119388667	59935219	11523256	4863982	192.65	99.00	0.69%	0.50%	0.98	0.000	No	0.00%	128.0bp	121.0bp	0.01%	1.19%	0.45%	0.00%	0.03%	3.61%	0.70%	0.00%				130bp	211bp	75.2%	0.0%	96.6%	88.8%	95.4%	253.7M	53.8%	97.5%	63358.5Mb	532.0M	53.9%	98.2%	71.0%
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1_1																																	128.0bp	97.7%	259.9M																85.7%	53%	151bp	151bp	18%	270.7M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1_2																																																			84.7%	53%	151bp	151bp	18%	270.7M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																			85.8%	53%	122bp	127bp	9%	266.0M	85.8%	53%	122bp	127bp	9%	266.0M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																			85.9%	54%	122bp	127bp	9%	266.0M	85.9%	54%	122bp	127bp	9%	266.0M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1	9999000000	138640455	590422322	0.01%	0.71%	170345832	0.90%	0.95%	0.07%	0.05%	153536633	77402649	11772003	4415831	287.09	132.00	0.70%	0.55%	0.98	0.000	No	0.00%	145.2bp	137.0bp	0.03%	0.73%	0.27%	0.00%	0.07%	2.14%	0.40%	0.00%				166bp	363bp	71.8%	0.0%	96.9%	85.1%	93.6%	276.2M	52.5%	97.4%	75713.9Mb	590.4M	55.5%	98.4%	55.8%
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1_1																																	145.2bp	97.9%	288.9M																87.0%	54%	151bp	151bp	18%	303.3M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1_2																																																			85.7%	55%	151bp	151bp	18%	303.3M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																			87.0%	55%	132bp	142bp	9%	295.2M	87.0%	55%	132bp	142bp	9%	295.2M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																			86.9%	55%	132bp	142bp	9%	295.2M	86.9%	55%	132bp	142bp	9%	295.2M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1	9999000000	134894619	331671720	0.01%	0.57%	143587602	0.92%	0.96%	0.06%	0.04%	132730244	67017579	8046006	2739352	263.82	119.00	0.69%	0.53%	0.97	0.000	No	0.00%	154.8bp	144.0bp	0.03%	0.77%	0.28%	0.00%	0.06%	2.31%	0.42%	0.00%				181bp	410bp	57.2%	0.0%	96.7%	84.8%	93.5%	155.0M	41.5%	97.3%	43409.9Mb	331.7M	55.3%	98.4%	49.7%
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1_1																																	154.8bp	97.8%	162.1M																81.7%	54%	151bp	151bp	18%	168.6M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1_2																																																			80.7%	55%	151bp	151bp	18%	168.6M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																			81.7%	55%	134bp	151bp	9%	165.8M	81.7%	55%	134bp	151bp	9%	165.8M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																			81.9%	55%	135bp	151bp	9%	165.8M	81.9%	55%	135bp	151bp	9%	165.8M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1	9999000000	173462335	589871676	0.01%	0.65%	205886920	0.93%	0.96%	0.06%	0.04%	190574174	95980479	11387014	4040186	353.30	146.00	0.69%	0.56%	0.97	0.000	No	0.00%	141.7bp	134.0bp	0.03%	0.99%	0.48%	0.00%	0.05%	2.80%	0.66%	0.00%				162bp	381bp	65.5%	0.0%	97.4%	87.9%	94.8%	279.5M	45.7%	97.4%	74758.3Mb	589.9M	53.6%	98.3%	58.4%
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1_1																																	141.7bp	98.1%	289.4M																86.3%	52%	151bp	151bp	18%	334.1M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1_2																																																			85.2%	54%	151bp	151bp	18%	334.1M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1_trimmed_1																																																			85.4%	53%	130bp	142bp	9%	294.9M	85.4%	53%	130bp	142bp	9%	294.9M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1_trimmed_2																																																			85.6%	53%	130bp	142bp	9%	294.9M	85.6%	53%	130bp	142bp	9%	294.9M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
659_6i-T1-TRNA-1_A23MVY2LT4_1	401.0M	0.0M	0.0M	29.3M	2.7M	356.8M	178.5M	178.3M	178.4M	178.4M	197.9M	158.9M	355.1M	0.0M
659_6i-T1-TRNA-1_A23MVY2LT4_2	440.5M	0.0M	0.0M	33.4M	2.9M	390.3M	195.3M	195.0M	195.2M	195.1M	217.8M	172.5M	388.6M	0.0M
659_Dl-T1-TRNA-1_A23MVY2LT4_1	500.2M	0.0M	0.0M	46.7M	3.7M	430.3M	215.3M	215.0M	215.2M	215.1M	237.8M	192.5M	428.8M	0.0M
659_Dl-T1-TRNA-1_A23MVY2LT4_2	374.3M	0.0M	0.0M	35.7M	2.8M	320.9M	160.6M	160.4M	160.5M	160.4M	177.0M	144.0M	319.8M	0.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_1	505.2M	0.0M	0.0M	30.0M	2.6M	459.4M	229.8M	229.6M	229.8M	229.7M	235.6M	223.9M	457.3M	0.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_2	562.0M	0.0M	0.0M	33.4M	2.9M	511.2M	255.7M	255.5M	255.7M	255.6M	260.5M	250.7M	508.9M	0.0M
659_Mt-T1-TRNA-1_A23MVY2LT4_1	450.3M	0.0M	0.0M	37.7M	2.8M	394.0M	197.2M	196.9M	197.1M	197.0M	209.6M	184.4M	392.5M	0.0M
659_Mt-T1-TRNA-1_A23MVY2LT4_2	536.3M	0.0M	0.0M	46.6M	3.2M	467.0M	233.7M	233.4M	233.6M	233.4M	250.5M	216.5M	465.3M	0.0M
659_bCu-T1-TRNA-1_A23MVY2LT4_1	530.3M	0.0M	0.0M	45.3M	4.1M	463.3M	231.8M	231.4M	231.7M	231.6M	279.5M	183.7M	461.4M	0.0M
659_bCu-T1-TRNA-1_A23MVY2LT4_2	235.5M	0.0M	0.0M	19.9M	1.8M	205.9M	103.0M	102.9M	103.0M	102.9M	121.5M	84.4M	205.1M	0.0M
659_bGW-T1-TRNA-1_A23MVY2LT4_1	636.1M	0.0M	0.0M	42.7M	3.5M	570.5M	285.4M	285.1M	285.3M	285.2M	264.9M	305.6M	568.1M	0.0M
659_bGW-T1-TRNA-1_A23MVY2LT4_2	637.6M	0.0M	0.0M	44.0M	3.5M	570.2M	285.3M	285.0M	285.2M	285.0M	266.4M	303.9M	567.9M	0.0M
659_bGc-T1-TRNA-1_A23MVY2LT4_1	629.8M	0.0M	0.0M	36.8M	3.8M	572.8M	286.6M	286.3M	286.5M	286.4M	293.3M	279.5M	570.5M	0.0M
659_bGc-T1-TRNA-1_A23MVY2LT4_2	628.4M	0.0M	0.0M	35.1M	3.8M	573.6M	286.9M	286.7M	286.9M	286.7M	286.8M	286.8M	571.3M	0.0M
659_bNS-T1-TRNA-1_A23MVY2LT4_1	630.2M	0.0M	0.0M	37.7M	3.7M	571.3M	285.7M	285.6M	285.7M	285.6M	269.0M	302.2M	568.9M	0.0M
659_bNS-T1-TRNA-1_A23MVY2LT4_2	628.8M	0.0M	0.0M	35.9M	3.5M	572.2M	286.2M	286.0M	286.2M	286.0M	268.3M	303.9M	570.0M	0.0M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1	582.6M	0.0M	0.0M	40.1M	4.6M	519.7M	260.0M	259.7M	259.9M	259.8M	253.2M	266.5M	517.7M	0.0M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2	635.8M	0.0M	0.0M	43.1M	4.4M	568.6M	284.5M	284.2M	284.4M	284.2M	272.1M	296.5M	566.5M	0.0M
659_bTo-T1-TRNA-1_A23MVY2LT4_1	621.5M	0.0M	0.0M	27.8M	2.9M	577.1M	288.7M	288.4M	288.7M	288.5M	254.0M	323.1M	574.9M	0.0M
659_bTo-T1-TRNA-1_A23MVY2LT4_2	620.1M	0.0M	0.0M	28.5M	3.1M	574.4M	287.3M	287.1M	287.3M	287.1M	252.9M	321.5M	572.2M	0.0M
659_bUW-T1-TRNA-1_A23MVY2LT4_1	348.3M	0.0M	0.0M	34.2M	2.0M	295.0M	147.6M	147.4M	147.5M	147.5M	131.8M	163.2M	293.9M	0.0M
659_bUW-T1-TRNA-1_A23MVY2LT4_2	656.8M	0.0M	0.0M	62.8M	3.5M	558.8M	279.5M	279.3M	279.4M	279.4M	249.1M	309.6M	556.8M	0.0M
659_bhK-T1-TRNA-1_A23MVY2LT4_1	621.7M	0.0M	0.0M	29.0M	3.5M	575.3M	287.8M	287.5M	287.8M	287.5M	259.6M	315.7M	573.3M	0.0M
659_bhK-T1-TRNA-1_A23MVY2LT4_2	621.0M	0.0M	0.0M	28.2M	3.5M	575.6M	287.9M	287.7M	287.9M	287.7M	251.8M	323.8M	573.7M	0.0M
659_buD-T1-TRNA-1_A23MVY2LT4_1	632.4M	0.0M	0.0M	38.8M	3.9M	572.5M	286.4M	286.1M	286.3M	286.2M	273.9M	298.6M	570.1M	0.0M
659_buD-T1-TRNA-1_A23MVY2LT4_2	478.3M	0.0M	0.0M	28.8M	2.9M	433.7M	217.0M	216.8M	216.9M	216.8M	205.2M	228.5M	432.0M	0.0M
659_bua-T1-TRNA-1_A23MVY2LT4_1	626.8M	0.0M	0.0M	32.9M	3.2M	575.2M	287.8M	287.4M	287.7M	287.5M	283.9M	291.4M	573.0M	0.0M
659_bua-T1-TRNA-1_A23MVY2LT4_2	626.6M	0.0M	0.0M	33.2M	3.3M	574.7M	287.5M	287.2M	287.4M	287.3M	278.0M	296.7M	572.6M	0.0M
659_c95-T1-TRNA-1_A23MVY2LT4_1	637.3M	0.0M	0.0M	43.6M	3.6M	571.7M	286.0M	285.7M	285.9M	285.8M	268.1M	303.7M	569.7M	0.0M
659_c95-T1-TRNA-1_A23MVY2LT4_2	624.9M	0.0M	0.0M	42.8M	3.6M	560.6M	280.4M	280.2M	280.3M	280.2M	260.5M	300.1M	558.5M	0.0M
659_cAd-T1-TRNA-1_A23MVY2LT4_1	578.0M	0.0M	0.0M	40.6M	4.1M	516.0M	258.2M	257.8M	258.1M	257.9M	267.8M	248.1M	513.8M	0.0M
659_cAd-T1-TRNA-1_A23MVY2LT4_2	637.3M	0.0M	0.0M	44.7M	4.6M	568.6M	284.5M	284.1M	284.4M	284.2M	293.8M	274.8M	566.3M	0.0M
659_cIX-T1-TRNA-1_A23MVY2LT4_1	618.7M	0.0M	0.0M	31.4M	3.0M	570.1M	285.2M	284.9M	285.1M	285.0M	271.9M	298.1M	567.9M	0.0M
659_cIX-T1-TRNA-1_A23MVY2LT4_2	625.0M	0.0M	0.0M	31.9M	3.1M	575.5M	287.9M	287.6M	287.8M	287.7M	275.7M	299.8M	573.4M	0.0M
659_cRB-T1-TRNA-1_A23MVY2LT4_1	515.3M	0.0M	0.0M	34.9M	3.3M	462.8M	231.6M	231.2M	231.5M	231.3M	234.3M	228.5M	460.5M	0.0M
659_cRB-T1-TRNA-1_A23MVY2LT4_2	610.7M	0.0M	0.0M	40.4M	3.8M	549.7M	275.0M	274.6M	275.0M	274.7M	270.3M	279.4M	547.1M	0.0M
659_cRa-T1-TRNA-1_A23MVY2LT4_1	627.0M	0.0M	0.0M	33.4M	3.6M	575.0M	287.7M	287.3M	287.6M	287.4M	245.4M	329.6M	572.8M	0.0M
659_cRa-T1-TRNA-1_A23MVY2LT4_2	626.2M	0.0M	0.0M	33.5M	3.7M	573.9M	287.1M	286.8M	287.1M	286.8M	237.5M	336.3M	571.7M	0.0M
659_cTi-T1-TRNA-1_A23MVY2LT4_1	631.0M	0.0M	0.0M	37.1M	3.9M	572.6M	286.4M	286.2M	286.4M	286.2M	270.0M	302.6M	570.2M	0.0M
659_cTi-T1-TRNA-1_A23MVY2LT4_2	628.0M	0.0M	0.0M	34.2M	4.3M	573.3M	286.8M	286.6M	286.7M	286.6M	257.5M	315.8M	570.9M	0.0M
659_cVw-T1-TRNA-1_A23MVY2LT4_1	638.5M	0.0M	0.0M	45.6M	3.9M	567.7M	283.9M	283.7M	283.9M	283.8M	279.1M	288.5M	565.8M	0.0M
659_cVw-T1-TRNA-1_A23MVY2LT4_2	637.3M	0.0M	0.0M	44.8M	3.9M	567.5M	283.8M	283.6M	283.8M	283.7M	275.4M	292.0M	565.7M	0.0M
659_cWx-T1-TRNA-1_A23MVY2LT4_1	644.5M	0.0M	0.0M	53.9M	4.2M	563.7M	282.0M	281.7M	281.9M	281.8M	297.4M	266.3M	561.6M	0.0M
659_cWx-T1-TRNA-1_A23MVY2LT4_2	610.6M	0.0M	0.0M	48.9M	3.9M	536.9M	268.6M	268.3M	268.5M	268.4M	275.7M	261.1M	534.9M	0.0M
659_cfy-T1-TRNA-1_A23MVY2LT4_1	625.4M	0.0M	0.0M	32.0M	2.9M	575.5M	287.9M	287.6M	287.8M	287.7M	264.8M	310.7M	573.2M	0.0M
659_cfy-T1-TRNA-1_A23MVY2LT4_2	624.9M	0.0M	0.0M	33.8M	3.1M	572.2M	286.2M	286.0M	286.2M	286.0M	265.9M	306.3M	570.0M	0.0M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1	630.9M	0.0M	0.0M	37.9M	4.0M	571.7M	286.0M	285.7M	285.9M	285.8M	287.6M	284.1M	569.5M	0.0M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2	629.5M	0.0M	0.0M	36.6M	3.9M	572.1M	286.1M	285.9M	286.1M	286.0M	282.4M	289.7M	570.0M	0.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1	639.6M	0.0M	0.0M	45.4M	3.8M	570.1M	285.2M	284.9M	285.1M	285.0M	287.9M	282.2M	567.5M	0.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2	640.9M	0.0M	0.0M	47.2M	3.7M	568.7M	284.5M	284.2M	284.4M	284.3M	295.2M	273.5M	566.2M	0.0M
659_d01-T1-TRNA-1_A23MVY2LT4_1	591.6M	0.0M	0.0M	39.3M	3.5M	531.3M	265.8M	265.5M	265.7M	265.6M	294.7M	236.6M	529.4M	0.0M
659_d01-T1-TRNA-1_A23MVY2LT4_2	452.0M	0.0M	0.0M	29.6M	2.6M	406.5M	203.4M	203.2M	203.3M	203.2M	221.5M	185.1M	405.1M	0.0M
659_dES-T1-TRNA-1_A23MVY2LT4_1	640.5M	0.0M	0.0M	46.2M	3.9M	570.5M	285.5M	285.1M	285.3M	285.2M	282.2M	288.3M	568.2M	0.0M
659_dES-T1-TRNA-1_A23MVY2LT4_2	556.7M	0.0M	0.0M	40.4M	3.4M	495.4M	247.9M	247.6M	247.7M	247.7M	246.3M	249.1M	493.5M	0.0M
659_dc8-T1-TRNA-1_A23MVY2LT4_1	634.7M	0.0M	0.0M	41.5M	3.6M	570.5M	285.4M	285.1M	285.3M	285.2M	279.6M	290.8M	568.2M	0.0M
659_dc8-T1-TRNA-1_A23MVY2LT4_2	636.2M	0.0M	0.0M	43.0M	3.7M	569.7M	285.0M	284.7M	284.9M	284.8M	279.5M	290.2M	567.5M	0.0M
659_dcz-T1-TRNA-1_A23MVY2LT4_1	200.9M	0.0M	0.0M	19.9M	1.7M	171.5M	85.8M	85.7M	85.8M	85.7M	107.5M	64.0M	170.7M	0.0M
659_dcz-T1-TRNA-1_A23MVY2LT4_2	134.2M	0.0M	0.0M	13.5M	1.1M	114.3M	57.2M	57.1M	57.1M	57.1M	72.3M	42.0M	113.8M	0.0M
659_djb-T1-TRNA-1_A23MVY2LT4_1	567.1M	0.0M	0.0M	37.4M	3.3M	510.4M	255.3M	255.0M	255.2M	255.1M	249.3M	261.1M	508.2M	0.0M
659_djb-T1-TRNA-1_A23MVY2LT4_2	637.2M	0.0M	0.0M	44.8M	3.8M	569.5M	284.9M	284.6M	284.9M	284.7M	285.1M	284.4M	567.3M	0.0M
659_dm4-T1-TRNA-1_A23MVY2LT4_1	372.2M	0.0M	0.0M	34.1M	2.7M	321.4M	160.8M	160.5M	160.7M	160.7M	194.9M	126.5M	319.9M	0.0M
659_dm4-T1-TRNA-1_A23MVY2LT4_2	297.5M	0.0M	0.0M	29.3M	2.1M	254.4M	127.3M	127.1M	127.2M	127.2M	156.4M	98.0M	253.3M	0.0M
659_dts-T1-TRNA-1_A23MVY2LT4_1	584.8M	0.0M	0.0M	42.4M	4.3M	520.0M	260.1M	259.9M	260.1M	259.9M	268.3M	251.7M	517.8M	0.0M
659_dts-T1-TRNA-1_A23MVY2LT4_2	638.1M	0.0M	0.0M	44.7M	4.4M	569.3M	284.8M	284.6M	284.7M	284.6M	286.9M	282.5M	567.0M	0.0M
659_eHw-T1-TRNA-1_A23MVY2LT4_1	630.7M	0.0M	0.0M	38.6M	3.5M	572.5M	286.4M	286.1M	286.4M	286.2M	271.7M	300.8M	570.2M	0.0M
659_eHw-T1-TRNA-1_A23MVY2LT4_2	633.4M	0.0M	0.0M	41.4M	3.5M	571.5M	285.9M	285.6M	285.9M	285.6M	273.1M	298.4M	569.3M	0.0M
659_ecd-T1-TRNA-1_A23MVY2LT4_1	578.6M	0.0M	0.0M	36.4M	2.9M	523.2M	261.7M	261.4M	261.6M	261.5M	253.8M	269.4M	521.3M	0.0M
659_ecd-T1-TRNA-1_A23MVY2LT4_2	485.7M	0.0M	0.0M	28.9M	2.4M	441.4M	220.8M	220.6M	220.8M	220.7M	205.5M	235.9M	439.7M	0.0M
659_epP-T1-TRNA-1_A23MVY2LT4_1	646.5M	0.0M	0.0M	54.8M	4.0M	563.7M	282.0M	281.7M	281.9M	281.8M	286.4M	277.3M	561.4M	0.0M
659_epP-T1-TRNA-1_A23MVY2LT4_2	648.3M	0.0M	0.0M	57.7M	4.2M	561.3M	280.8M	280.5M	280.8M	280.6M	285.8M	275.6M	559.1M	0.0M
659_ezg-T1-TRNA-1_A23MVY2LT4_1	639.3M	0.0M	0.0M	44.8M	3.7M	571.7M	286.0M	285.7M	286.0M	285.8M	279.2M	292.6M	569.4M	0.0M
659_ezg-T1-TRNA-1_A23MVY2LT4_2	637.2M	0.0M	0.0M	43.5M	3.9M	571.0M	285.7M	285.4M	285.6M	285.4M	271.3M	299.7M	568.7M	0.0M
659_gK-T1-TRNA-1_A23MVY2LT4_1	641.5M	0.0M	0.0M	48.0M	3.5M	566.3M	283.3M	283.0M	283.2M	283.1M	275.7M	290.6M	564.4M	0.0M
659_gK-T1-TRNA-1_A23MVY2LT4_2	640.7M	0.0M	0.0M	47.8M	3.6M	565.9M	283.1M	282.8M	283.0M	282.9M	279.2M	286.7M	564.1M	0.0M
659_rd-T1-TRNA-1_A23MVY2LT4_1	500.6M	0.0M	0.0M	24.8M	2.5M	461.9M	231.1M	230.8M	231.0M	230.9M	221.5M	240.4M	459.8M	0.0M
659_rd-T1-TRNA-1_A23MVY2LT4_2	624.5M	0.0M	0.0M	30.6M	3.2M	576.6M	288.4M	288.2M	288.4M	288.3M	275.1M	301.5M	574.0M	0.0M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1	546.0M	0.0M	0.0M	31.9M	2.8M	496.3M	248.2M	248.0M	248.2M	248.1M	221.0M	275.3M	494.8M	0.0M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1	632.4M	0.0M	0.0M	39.8M	4.1M	570.5M	285.4M	285.1M	285.3M	285.2M	269.4M	301.2M	568.7M	0.0M
NTC_0001_0001_A23MVY2LT4_1	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1	632.1M	0.0M	0.0M	37.4M	3.1M	575.6M	288.0M	287.7M	287.9M	287.8M	296.7M	278.9M	572.9M	0.0M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1	625.2M	0.0M	0.0M	40.5M	3.7M	564.5M	282.5M	282.0M	282.3M	282.2M	317.0M	247.5M	561.6M	0.0M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1	632.8M	0.0M	0.0M	39.1M	3.5M	574.0M	287.2M	286.8M	287.0M	286.9M	302.2M	271.8M	571.4M	0.0M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1	632.5M	0.0M	0.0M	39.4M	3.6M	573.0M	286.8M	286.3M	286.6M	286.5M	303.9M	269.1M	570.5M	0.0M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1	634.4M	0.0M	0.0M	41.9M	3.9M	570.1M	285.3M	284.9M	285.2M	285.0M	315.2M	254.9M	567.4M	0.0M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1	572.9M	0.0M	0.0M	46.6M	3.7M	500.6M	250.5M	250.1M	250.3M	250.3M	275.5M	225.2M	498.6M	0.0M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1	654.1M	0.0M	0.0M	62.2M	5.8M	556.4M	278.5M	278.0M	278.3M	278.2M	317.4M	239.0M	554.3M	0.0M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1	241.9M	0.0M	0.0M	20.5M	1.6M	212.0M	106.1M	105.9M	106.0M	106.0M	123.1M	88.8M	210.9M	0.0M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1	617.7M	0.0M	0.0M	57.6M	4.8M	532.9M	266.7M	266.2M	266.5M	266.4M	322.2M	210.6M	530.7M	0.0M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1	34.8M	0.0M	0.0M	4.0M	0.3M	29.0M	14.5M	14.5M	14.5M	14.5M	18.7M	10.3M	28.9M	0.0M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1	525.3M	0.0M	0.0M	61.2M	3.5M	429.9M	215.1M	214.9M	215.0M	214.9M	211.8M	218.2M	428.2M	0.0M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1	514.2M	0.0M	0.0M	65.0M	4.3M	416.3M	208.3M	208.0M	208.2M	208.1M	227.1M	189.1M	414.3M	0.0M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1	613.1M	0.0M	0.0M	47.4M	3.8M	540.0M	270.2M	269.8M	270.0M	269.9M	270.1M	269.9M	537.8M	0.0M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1	576.1M	0.0M	0.0M	41.4M	3.5M	514.0M	257.2M	256.8M	257.1M	256.9M	292.9M	221.1M	511.7M	0.0M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1	654.2M	0.0M	0.0M	61.1M	5.0M	558.7M	279.5M	279.2M	279.4M	279.3M	288.3M	270.4M	556.5M	0.0M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1	367.9M	0.0M	0.0M	34.9M	2.8M	313.2M	156.7M	156.5M	156.6M	156.6M	161.1M	152.1M	312.1M	0.0M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1	641.2M	0.0M	0.0M	48.3M	3.9M	566.0M	283.1M	282.8M	283.1M	282.9M	285.6M	280.4M	563.5M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	369342913	0.3408%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	25	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	33	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	10	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	4	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	3	0.0000%
CGAATGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	3	0.0000%
GGCGTGCGTCTCTCCTCCAGCGGCCCCGCCTTGCTCGCCGGCCTCGTGAG	2	2	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGCATTCG	2	3	0.0000%
GGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	2	70	0.0000%
GGGAACTCCCATAGTGGGTCGAGAGGTAGATCTAGACTCACGAGGCCGGC	2	2	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	13	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	3	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	4	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGG	2	2	0.0000%
GGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	2	104	0.0000%
CCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACTGAGTGTACAATCTGGGG	2	92	0.0000%
GCTGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	1	27	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	1	7	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	160307215	0.3223%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	25	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	33	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	10	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	4	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	3	0.0000%
CGAATGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	3	0.0000%
GGCGTGCGTCTCTCCTCCAGCGGCCCCGCCTTGCTCGCCGGCCTCGTGAG	2	2	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGCATTCG	2	3	0.0000%
GGGAACTCCCATAGTGGGTCGAGAGGTAGATCTAGACTCACGAGGCCGGC	2	2	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	13	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	3	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	4	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGG	2	2	0.0000%
CCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2	0.0000%
GCTGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	1	27	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	1	7	0.0000%
CAGCATTCCATCAGCTCCTGCCCCTGCCCATCCGCTTCTGGGGCCTGGCC	1	4	0.0000%
CCTGGACCTCAGCGCTCTCAAGAGTAAGGCAGCCCAGAAGGCCCCCAGCA	1	4	0.0000%
GGTGGTGGTGGCAGTGGCGGCGGGGCTGGCAGTGGCGGGGCCGGCGGAAC	1	4	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0014_0015/A23MVY2LT4/nfcore_rnafusion__2cae617--20260515-145204' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0014_exp0015-2cae617 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260417_LH00995_0030_A23MVY2LT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260417_LH00995_0030_A23MVY2LT4/bclconvert_samplesheet.csv' --flowcell_id 20260417_LH00995_0030_A23MVY2LT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0014_0015/A23MVY2LT4/nfcore_rnafusion__2cae617--20260515-145204'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0014_exp0015-2cae617
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0014_0015/A23MVY2LT4/nfcore_rnafusion__2cae617--20260515-145204
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260417_LH00995_0030_A23MVY2LT4/
flowcell_id: 20260417_LH00995_0030_A23MVY2LT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260417_LH00995_0030_A23MVY2LT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks