Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 33914
total bases: 5121014
Q20 bases: 4370446(85.3434%)
Q30 bases: 3212915(62.7398%)

Read2 before filtering:
total reads: 33914
total bases: 5121014
Q20 bases: 4902644(95.7358%)
Q30 bases: 3915386(76.4572%)

Read1 after filtering:
total reads: 841
total bases: 90847
Q20 bases: 85830(94.4775%)
Q30 bases: 77117(84.8867%)

Read2 after filtering:
total reads: 841
total bases: 92083
Q20 bases: 90629(98.421%)
Q30 bases: 84826(92.1191%)

Filtering result:
reads passed filter: 1682
reads failed due to low quality: 2204
reads failed due to too many N: 0
reads failed due to too short: 63942
reads with adapter trimmed: 33982
bases trimmed due to adapters: 4907762

Duplication rate: 44.029%

Insert size peak (evaluated by paired-end reads): 35

JSON report: NTC_0001_0001_A23MVY2LT4_1.fastp.json
HTML report: NTC_0001_0001_A23MVY2LT4_1.fastp.html

fastp --in1 NTC_0001_0001_A23MVY2LT4_1_1.fastq.gz --in2 NTC_0001_0001_A23MVY2LT4_1_2.fastq.gz --out1 NTC_0001_0001_A23MVY2LT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_A23MVY2LT4_1_2.fastp.fastq.gz --json NTC_0001_0001_A23MVY2LT4_1.fastp.json --html NTC_0001_0001_A23MVY2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1 seconds