File Info

Filename
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0014_0015/A23MVY2LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1.fastp.log
Size
1.6 KB
Published
Jun 08, 2026 12:24 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 16106136
total bases: 2432026536
Q20 bases: 2330719290(95.8345%)
Q30 bases: 2195182846(90.2615%)

Read2 before filtering:
total reads: 16106136
total bases: 2432026536
Q20 bases: 2358430540(96.9739%)
Q30 bases: 2213741462(91.0246%)

Read1 after filtering:
total reads: 15304622
total bases: 1648336154
Q20 bases: 1640678270(99.5354%)
Q30 bases: 1605831150(97.4213%)

Read2 after filtering:
total reads: 15304622
total bases: 1654421078
Q20 bases: 1642521619(99.2807%)
Q30 bases: 1602269633(96.8478%)

Filtering result:
reads passed filter: 30609244
reads failed due to low quality: 647666
reads failed due to too many N: 4922
reads failed due to too short: 950440
reads with adapter trimmed: 27690661
bases trimmed due to adapters: 1350899751

Duplication rate: 45.2151%

Insert size peak (evaluated by paired-end reads): 98

JSON report: PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1.fastp.json
HTML report: PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1.fastp.html

fastp --in1 PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_1.fastq.gz --in2 PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_2.fastq.gz --out1 PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_1.fastp.fastq.gz --out2 PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_2.fastp.fastq.gz --json PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1.fastp.json --html PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 55 seconds