Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 61416934
total bases: 9273957034
Q20 bases: 9015139068(97.2092%)
Q30 bases: 8663112316(93.4133%)

Read2 before filtering:
total reads: 61416934
total bases: 9273957034
Q20 bases: 9061539082(97.7095%)
Q30 bases: 8642092460(93.1867%)

Read1 after filtering:
total reads: 60075557
total bases: 7060779611
Q20 bases: 7029111299(99.5515%)
Q30 bases: 6885230325(97.5137%)

Read2 after filtering:
total reads: 60075557
total bases: 7074568353
Q20 bases: 7030693243(99.3798%)
Q30 bases: 6874540040(97.1726%)

Filtering result:
reads passed filter: 120151114
reads failed due to low quality: 1942802
reads failed due to too many N: 21470
reads failed due to too short: 718482
reads with adapter trimmed: 95360165
bases trimmed due to adapters: 4057633694

Duplication rate: 53.2857%

Insert size peak (evaluated by paired-end reads): 108

JSON report: 659_dcz-T1-TRNA-1_A23MVY2LT4_2.fastp.json
HTML report: 659_dcz-T1-TRNA-1_A23MVY2LT4_2.fastp.html

fastp --in1 659_dcz-T1-TRNA-1_A23MVY2LT4_2_1.fastq.gz --in2 659_dcz-T1-TRNA-1_A23MVY2LT4_2_2.fastq.gz --out1 659_dcz-T1-TRNA-1_A23MVY2LT4_2_1.fastp.fastq.gz --out2 659_dcz-T1-TRNA-1_A23MVY2LT4_2_2.fastp.fastq.gz --json 659_dcz-T1-TRNA-1_A23MVY2LT4_2.fastp.json --html 659_dcz-T1-TRNA-1_A23MVY2LT4_2.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 170 seconds