MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-08, 14:27 UTC based on data in: /tmp/nxf.WK4XBsXKV7

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₁ columns.

Sample Name	RNA contaminated	RNA contamination %	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	ChrY Signature Score	Unique Reads	Frac Antisense	Total Reads	Expected Distinct	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Frag Length	% Aligned	M Aligned	Duplication	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
659_6i-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	137.9bp	131.0bp	0.01%	1.22%	0.39%	0.00%	0.02%	3.76%	0.61%	0.00%	6.57	356783159	0.9078	9999000000	122711241	369722048	0.01%	0.62%	139413426	0.90%	0.94%	0.08%	0.06%	126048684	63426395	10714150	4387071	218.68	111.00	0.70%	0.52%	0.98	0.000				62.7%	88.6%	95.2%	176.1M	44.3%	97.4%	46200.5Mb	369.7M	53.8%	98.5%	63.1%
659_6i-T1-TRNA-1_A23MVY2LT4_1_1																																				137.9bp	97.4%	180.0M												80.8%	53%	151bp	151bp	18%	187.8M
659_6i-T1-TRNA-1_A23MVY2LT4_1_2																																																		79.8%	54%	151bp	151bp	18%	187.8M
659_6i-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		80.8%	53%	128bp	137bp	9%	184.9M	80.8%	53%	128bp	137bp	9%	184.9M
659_6i-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		81.0%	54%	128bp	137bp	9%	184.9M	81.0%	54%	128bp	137bp	9%	184.9M
659_6i-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	135.7bp	128.0bp	0.01%	1.35%	0.44%	0.00%	0.01%	4.16%	0.69%	0.00%	6.50	390297955	0.9085	9999000000	86764997	405102760	0.01%	0.78%	90984870	0.86%	0.90%	0.11%	0.10%	78384794	39425832	9691029	4141264	131.76	63.00	0.63%	0.39%	0.98	0.000				78.1%	88.2%	95.2%	192.8M	59.3%	97.5%	50196.5Mb	405.1M	54.5%	98.4%	64.5%
659_6i-T1-TRNA-1_A23MVY2LT4_2_1																																				135.7bp	97.3%	197.1M												86.0%	53%	151bp	151bp	18%	205.8M
659_6i-T1-TRNA-1_A23MVY2LT4_2_2																																																		84.8%	54%	151bp	151bp	18%	205.8M
659_6i-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.1%	54%	127bp	132bp	9%	202.6M	86.1%	54%	127bp	132bp	9%	202.6M
659_6i-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.0%	54%	127bp	132bp	9%	202.6M	86.0%	54%	127bp	132bp	9%	202.6M
659_Dl-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	140.9bp	133.0bp	0.01%	1.32%	0.43%	0.00%	0.02%	4.34%	0.72%	0.00%	0.01	430309860	0.8955	9999000000	99602868	451678338	0.01%	0.76%	106347390	0.87%	0.92%	0.10%	0.08%	92399065	46517372	10264871	4249166	161.30	71.00	0.64%	0.43%	0.97	0.000				77.1%	85.7%	94.3%	213.0M	56.0%	97.3%	56780.9Mb	451.7M	54.8%	98.4%	60.5%
659_Dl-T1-TRNA-1_A23MVY2LT4_1_1																																				140.9bp	97.3%	219.7M												86.1%	54%	151bp	151bp	18%	229.4M
659_Dl-T1-TRNA-1_A23MVY2LT4_1_2																																																		85.0%	54%	151bp	151bp	18%	229.4M
659_Dl-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		86.2%	54%	129bp	137bp	9%	225.8M	86.2%	54%	129bp	137bp	9%	225.8M
659_Dl-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		86.2%	55%	129bp	137bp	9%	225.8M	86.2%	55%	129bp	137bp	9%	225.8M
659_Dl-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	144.0bp	134.0bp	0.01%	1.41%	0.46%	0.00%	0.02%	4.66%	0.76%	0.00%	0.04	320944920	0.9227	9999000000	56455296	337284940	0.01%	0.85%	50675435	0.81%	0.88%	0.13%	0.12%	41174847	20720143	6712554	2867885	72.23	30.00	0.50%	0.21%	0.97	0.000				85.7%	85.4%	94.2%	158.9M	64.4%	97.3%	42635.9Mb	337.3M	55.3%	98.1%	58.4%
659_Dl-T1-TRNA-1_A23MVY2LT4_2_1																																				144.0bp	97.0%	163.5M												88.9%	54%	151bp	151bp	18%	171.9M
659_Dl-T1-TRNA-1_A23MVY2LT4_2_2																																																		87.2%	55%	151bp	151bp	18%	171.9M
659_Dl-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		89.0%	54%	130bp	142bp	9%	168.6M	89.0%	54%	130bp	142bp	9%	168.6M
659_Dl-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		88.5%	55%	130bp	142bp	9%	168.6M	88.5%	55%	130bp	142bp	9%	168.6M
659_Lx-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	138.7bp	130.0bp	0.01%	1.04%	0.35%	0.00%	0.02%	3.34%	0.56%	0.00%	0.02	459440873	0.9471	9999000000	197751475	472731300	0.01%	0.57%	204924135	0.93%	0.96%	0.06%	0.04%	190724878	95997343	11557004	4354587	346.65	158.00	0.71%	0.58%	0.98	0.000				57.0%	90.5%	95.9%	226.7M	38.7%	97.5%	58573.3Mb	472.7M	53.5%	98.5%	63.5%
659_Lx-T1-TRNA-1_A23MVY2LT4_1_1																																				138.7bp	98.2%	232.2M												82.3%	52%	151bp	151bp	18%	240.1M
659_Lx-T1-TRNA-1_A23MVY2LT4_1_2																																																		81.4%	53%	151bp	151bp	18%	240.1M
659_Lx-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		82.3%	53%	127bp	132bp	9%	236.4M	82.3%	53%	127bp	132bp	9%	236.4M
659_Lx-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		82.6%	53%	127bp	132bp	9%	236.4M	82.6%	53%	127bp	132bp	9%	236.4M
659_Lx-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	139.8bp	131.0bp	0.01%	1.01%	0.35%	0.00%	0.01%	3.27%	0.57%	0.00%	0.01	511212005	0.9523	9999000000	134657805	525908288	0.01%	0.68%	169536169	0.92%	0.95%	0.07%	0.05%	155446647	78245827	11221158	4345904	280.84	125.00	0.69%	0.54%	0.98	0.000				68.1%	90.6%	96.0%	252.3M	47.7%	97.5%	65528.2Mb	525.9M	53.7%	98.5%	62.5%
659_Lx-T1-TRNA-1_A23MVY2LT4_2_1																																				139.8bp	98.2%	258.2M												85.2%	53%	151bp	151bp	18%	267.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_2_2																																																		84.1%	54%	151bp	151bp	18%	267.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		85.3%	53%	128bp	137bp	9%	263.0M	85.3%	53%	128bp	137bp	9%	263.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		85.4%	53%	128bp	137bp	9%	263.0M	85.4%	53%	128bp	137bp	9%	263.0M
659_Mt-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	151.2bp	142.0bp	0.01%	0.73%	0.29%	0.00%	0.02%	2.38%	0.47%	0.00%	0.05	394035222	0.9213	9999000000	175254736	410870718	0.01%	0.57%	174687175	0.92%	0.95%	0.07%	0.05%	160396784	80959307	11534912	4329733	312.74	142.00	0.70%	0.56%	0.98	0.000				57.9%	87.2%	94.9%	194.9M	42.8%	97.4%	53690.7Mb	410.9M	54.1%	98.5%	51.2%
659_Mt-T1-TRNA-1_A23MVY2LT4_1_1																																				151.2bp	97.4%	200.1M												82.0%	53%	151bp	151bp	27%	208.5M
659_Mt-T1-TRNA-1_A23MVY2LT4_1_2																																																		81.3%	54%	151bp	151bp	27%	208.5M
659_Mt-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		82.1%	53%	134bp	147bp	18%	205.4M	82.1%	53%	134bp	147bp	18%	205.4M
659_Mt-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		82.4%	54%	134bp	147bp	18%	205.4M	82.4%	54%	134bp	147bp	18%	205.4M
659_Mt-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	147.7bp	138.0bp	0.01%	0.84%	0.32%	0.00%	0.01%	2.76%	0.53%	0.00%	0.05	467015552	0.9121	9999000000	108569758	487609194	0.01%	0.76%	116490707	0.88%	0.92%	0.09%	0.08%	102301002	51593736	10944439	4405970	190.10	81.00	0.65%	0.46%	0.97	0.000				76.6%	86.8%	94.8%	231.1M	56.8%	97.3%	62457.6Mb	487.6M	54.6%	98.4%	55.3%
659_Mt-T1-TRNA-1_A23MVY2LT4_2_1																																				147.7bp	97.4%	237.5M												87.4%	53%	151bp	151bp	27%	247.7M
659_Mt-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.8%	54%	151bp	151bp	18%	247.7M
659_Mt-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		87.4%	54%	132bp	142bp	9%	243.8M	87.4%	54%	132bp	142bp	9%	243.8M
659_Mt-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		87.1%	54%	132bp	142bp	18%	243.8M	87.1%	54%	132bp	142bp	18%	243.8M
659_bCu-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	133.7bp	127.0bp	0.00%	0.55%	0.24%	0.00%	0.00%	1.86%	0.40%	0.00%	0.32	463266356	0.9286	9999000000	84571576	482784100	0.01%	0.83%	83820050	0.82%	0.88%	0.13%	0.12%	69120750	34727617	10640692	4618681	115.57	29.00	0.50%	0.27%	0.97	0.000				83.3%	87.0%	94.9%	229.1M	57.8%	97.2%	58875.4Mb	482.8M	59.7%	98.2%	65.9%
659_bCu-T1-TRNA-1_A23MVY2LT4_1_1																																				133.7bp	97.1%	234.5M												88.8%	58%	151bp	151bp	18%	245.9M
659_bCu-T1-TRNA-1_A23MVY2LT4_1_2																																																		87.1%	58%	151bp	151bp	18%	245.9M
659_bCu-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		88.9%	59%	125bp	132bp	9%	241.4M	88.9%	59%	125bp	132bp	9%	241.4M
659_bCu-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		88.6%	59%	126bp	132bp	9%	241.4M	88.6%	59%	126bp	132bp	9%	241.4M
659_bCu-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	140.1bp	132.0bp	0.00%	0.57%	0.25%	0.00%	0.00%	1.97%	0.42%	0.00%	0.42	205887794	0.9409	9999000000	40766331	214549178	0.01%	0.83%	35987478	0.81%	0.87%	0.14%	0.13%	29210747	14670108	4930256	2148507	49.14	11.00	0.33%	0.12%	0.97	0.000				83.9%	87.1%	94.9%	101.8M	60.9%	97.1%	26844.9Mb	214.5M	60.1%	98.0%	61.2%
659_bCu-T1-TRNA-1_A23MVY2LT4_2_1																																				140.1bp	97.0%	104.0M												87.7%	58%	151bp	151bp	18%	109.5M
659_bCu-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.9%	59%	151bp	151bp	18%	109.5M
659_bCu-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		87.8%	59%	129bp	137bp	9%	107.3M	87.8%	59%	129bp	137bp	9%	107.3M
659_bCu-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		87.4%	60%	129bp	137bp	9%	107.3M	87.4%	60%	129bp	137bp	9%	107.3M
659_bGW-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	154.9bp	144.0bp	0.01%	1.24%	0.66%	0.00%	0.03%	4.08%	0.96%	0.00%	0.01	570400744	0.9567	9999000000	345398806	590734220	0.01%	0.49%	298701388	0.94%	0.97%	0.04%	0.03%	281819518	142420171	13401422	4055967	576.86	261.00	0.75%	0.64%	0.98	0.000				49.7%	89.3%	95.4%	281.9M	36.4%	97.4%	77566.0Mb	590.7M	55.1%	98.5%	49.0%
659_bGW-T1-TRNA-1_A23MVY2LT4_1_1																																				154.9bp	98.4%	290.6M												87.1%	54%	151bp	151bp	18%	471.6M
659_bGW-T1-TRNA-1_A23MVY2LT4_1_2																																																		86.1%	55%	151bp	151bp	18%	471.6M
659_bGW-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.1%	54%	135bp	151bp	9%	295.4M	84.1%	54%	135bp	151bp	9%	295.4M
659_bGW-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.4%	55%	135bp	151bp	9%	295.4M	84.4%	55%	135bp	151bp	9%	295.4M
659_bGW-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	154.1bp	142.0bp	0.01%	1.31%	0.71%	0.00%	0.03%	4.34%	1.06%	0.00%	0.01	570099417	0.9583	9999000000	227942108	590934936	0.01%	0.58%	247915447	0.94%	0.97%	0.05%	0.03%	231916914	117278077	12417069	3863761	468.95	201.00	0.73%	0.61%	0.98	0.000				58.4%	89.0%	95.4%	281.8M	42.4%	97.4%	77174.5Mb	590.9M	55.9%	98.5%	49.3%
659_bGW-T1-TRNA-1_A23MVY2LT4_2_1																																				154.1bp	98.3%	290.4M												89.2%	55%	151bp	151bp	18%	532.5M
659_bGW-T1-TRNA-1_A23MVY2LT4_2_2																																																		88.0%	55%	151bp	151bp	18%	532.5M
659_bGW-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		85.3%	55%	134bp	151bp	9%	295.5M	85.3%	55%	134bp	151bp	9%	295.5M
659_bGW-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		85.6%	56%	134bp	151bp	9%	295.5M	85.6%	56%	134bp	151bp	9%	295.5M
659_bGc-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	146.8bp	137.0bp	0.01%	0.92%	0.38%	0.00%	0.01%	2.82%	0.57%	0.00%	0.06	572849346	0.9303	9999000000	199988826	590332314	0.01%	0.62%	225716259	0.92%	0.96%	0.06%	0.04%	208249956	105086166	13647082	4889525	392.92	186.00	0.74%	0.61%	0.98	0.000				62.2%	90.6%	95.9%	283.1M	44.6%	97.4%	75317.3Mb	590.3M	55.7%	98.4%	56.4%
659_bGc-T1-TRNA-1_A23MVY2LT4_1_1																																				146.8bp	98.1%	289.5M												85.3%	54%	151bp	151bp	18%	319.2M
659_bGc-T1-TRNA-1_A23MVY2LT4_1_2																																																		84.1%	55%	151bp	151bp	18%	319.2M
659_bGc-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.8%	55%	131bp	142bp	9%	295.2M	84.8%	55%	131bp	142bp	9%	295.2M
659_bGc-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.9%	56%	131bp	142bp	9%	295.2M	84.9%	56%	131bp	142bp	9%	295.2M
659_bGc-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	151.6bp	140.0bp	0.01%	0.96%	0.41%	0.00%	0.01%	3.00%	0.61%	0.00%	0.09	573578720	0.9515	9999000000	128767900	590723464	0.01%	0.74%	151012900	0.90%	0.94%	0.08%	0.06%	135890678	68626140	11359371	4213559	256.94	117.00	0.70%	0.53%	0.98	0.000				74.9%	90.9%	96.0%	283.6M	58.9%	97.4%	76528.9Mb	590.7M	55.6%	98.5%	52.8%
659_bGc-T1-TRNA-1_A23MVY2LT4_2_1																																				151.6bp	98.0%	289.3M												89.0%	54%	151bp	151bp	18%	361.7M
659_bGc-T1-TRNA-1_A23MVY2LT4_2_2																																																		87.7%	55%	151bp	151bp	18%	361.7M
659_bGc-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		87.8%	55%	133bp	147bp	9%	295.4M	87.8%	55%	133bp	147bp	9%	295.4M
659_bGc-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		87.8%	55%	133bp	147bp	9%	295.4M	87.8%	55%	133bp	147bp	9%	295.4M
659_bNS-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	157.9bp	145.0bp	0.01%	1.34%	0.55%	0.00%	0.02%	4.04%	0.83%	0.00%	5.94	571282087	0.9583	9999000000	227881958	589900732	0.01%	0.58%	245535797	0.93%	0.97%	0.06%	0.03%	228179853	115650625	13681768	4171253	469.97	207.00	0.74%	0.62%	0.97	0.000				58.7%	90.3%	95.8%	282.4M	43.4%	97.3%	77597.9Mb	589.9M	56.0%	98.3%	46.8%
659_bNS-T1-TRNA-1_A23MVY2LT4_1_1																																				157.9bp	98.2%	289.7M												86.7%	55%	151bp	151bp	18%	331.5M
659_bNS-T1-TRNA-1_A23MVY2LT4_1_2																																																		85.4%	56%	151bp	151bp	18%	331.5M
659_bNS-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		86.1%	55%	135bp	151bp	9%	295.0M	86.1%	55%	135bp	151bp	9%	295.0M
659_bNS-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		86.1%	56%	135bp	151bp	9%	295.0M	86.1%	56%	135bp	151bp	9%	295.0M
659_bNS-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	160.5bp	147.0bp	0.01%	1.38%	0.56%	0.00%	0.02%	4.20%	0.84%	0.00%	6.00	572226029	0.9514	9999000000	177569711	590475754	0.01%	0.64%	213039642	0.92%	0.96%	0.06%	0.04%	196934017	99799233	12606727	3944530	406.18	184.00	0.73%	0.60%	0.98	0.000				64.3%	90.6%	95.9%	283.1M	49.5%	97.4%	77878.3Mb	590.5M	55.3%	98.4%	45.9%
659_bNS-T1-TRNA-1_A23MVY2LT4_2_1																																				160.5bp	98.2%	289.9M												87.0%	54%	151bp	151bp	18%	323.1M
659_bNS-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.9%	55%	151bp	151bp	18%	323.1M
659_bNS-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.5%	54%	135bp	151bp	9%	295.2M	86.5%	54%	135bp	151bp	9%	295.2M
659_bNS-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.6%	55%	135bp	151bp	9%	295.2M	86.6%	55%	135bp	151bp	9%	295.2M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	158.6bp	148.0bp	0.01%	1.34%	0.57%	0.00%	0.01%	4.10%	0.86%	0.00%	0.01	519665225	0.9472	9999000000	194376101	540201404	0.01%	0.59%	220470439	0.92%	0.96%	0.06%	0.04%	203475014	102962826	12401222	4032472	415.35	187.00	0.73%	0.60%	0.97	0.000				59.7%	88.9%	95.2%	257.1M	44.7%	97.4%	71731.3Mb	540.2M	56.2%	98.5%	45.8%
659_bQZ-T1-TRNA-1_A23MVY2LT4_1_1																																				158.6bp	97.8%	264.0M												84.4%	55%	151bp	151bp	18%	274.2M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1_2																																																		83.6%	56%	151bp	151bp	18%	274.2M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.4%	55%	136bp	151bp	18%	270.1M	84.4%	55%	136bp	151bp	18%	270.1M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.8%	56%	136bp	151bp	9%	270.1M	84.8%	56%	136bp	151bp	9%	270.1M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	162.7bp	151.0bp	0.01%	1.42%	0.61%	0.00%	0.01%	4.39%	0.94%	0.00%	0.01	568576354	0.9608	9999000000	135251509	590296934	0.01%	0.74%	155076253	0.90%	0.95%	0.07%	0.05%	139659935	70708479	10976387	3755952	279.96	118.00	0.69%	0.53%	0.97	0.000				74.3%	89.1%	95.3%	281.3M	58.6%	97.3%	79118.4Mb	590.3M	56.7%	98.4%	43.0%
659_bQZ-T1-TRNA-1_A23MVY2LT4_2_1																																				162.7bp	97.6%	288.2M												89.7%	55%	151bp	151bp	18%	398.9M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2_2																																																		88.2%	56%	151bp	151bp	18%	398.9M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		88.0%	56%	138bp	151bp	9%	295.1M	88.0%	56%	138bp	151bp	9%	295.1M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		88.0%	57%	138bp	151bp	9%	295.1M	88.0%	57%	138bp	151bp	9%	295.1M
659_bTo-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	165.5bp	151.0bp	0.01%	0.72%	0.68%	0.00%	0.01%	2.33%	1.01%	0.00%	0.00	577067115	0.9565	9990000000	374133468	591364202	0.00%	0.49%	304458924	0.95%	0.98%	0.04%	0.02%	288454101	146035982	13071748	3535531	624.44	240.00	0.72%	0.62%	0.98	0.000				48.8%	92.5%	96.6%	285.6M	36.4%	97.5%	78956.8Mb	591.4M	54.8%	98.6%	42.7%
659_bTo-T1-TRNA-1_A23MVY2LT4_1_1																																				165.5bp	98.5%	291.2M												88.0%	54%	151bp	151bp	18%	454.9M
659_bTo-T1-TRNA-1_A23MVY2LT4_1_2																																																		87.2%	55%	151bp	151bp	18%	454.9M
659_bTo-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		85.4%	54%	137bp	151bp	9%	295.7M	85.4%	54%	137bp	151bp	9%	295.7M
659_bTo-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		86.0%	55%	137bp	151bp	9%	295.7M	86.0%	55%	137bp	151bp	9%	295.7M
659_bTo-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	164.2bp	149.0bp	0.01%	0.78%	0.75%	0.00%	0.01%	2.56%	1.11%	0.00%	0.01	574272681	0.9722	9999000000	184525173	589194292	0.01%	0.63%	215265956	0.94%	0.97%	0.05%	0.03%	201343337	101866759	10776055	3068583	421.69	150.00	0.68%	0.56%	0.98	0.000				63.8%	92.2%	96.5%	284.2M	49.9%	97.5%	78125.4Mb	589.2M	55.2%	98.2%	43.6%
659_bTo-T1-TRNA-1_A23MVY2LT4_2_1																																				164.2bp	98.5%	290.2M												90.6%	54%	151bp	151bp	18%	484.5M
659_bTo-T1-TRNA-1_A23MVY2LT4_2_2																																																		89.0%	55%	151bp	151bp	18%	484.5M
659_bTo-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		87.8%	54%	136bp	151bp	9%	294.6M	87.8%	54%	136bp	151bp	9%	294.6M
659_bTo-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		88.0%	55%	136bp	151bp	9%	294.6M	88.0%	55%	136bp	151bp	9%	294.6M
659_bUW-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	171.5bp	156.0bp	0.01%	1.51%	0.62%	0.00%	0.03%	4.74%	0.94%	0.00%	0.01	295005005	0.9773	9999000000	407394333	312959954	0.01%	0.35%	203584985	0.95%	0.98%	0.04%	0.02%	193386305	97954843	8232716	2122647	430.25	155.00	0.67%	0.56%	0.98	0.000				35.2%	84.4%	93.4%	146.1M	25.1%	97.4%	41992.8Mb	313.0M	53.4%	98.5%	40.7%
659_bUW-T1-TRNA-1_A23MVY2LT4_1_1																																				171.5bp	98.5%	154.1M												80.6%	52%	151bp	151bp	18%	158.8M
659_bUW-T1-TRNA-1_A23MVY2LT4_1_2																																																		79.9%	53%	151bp	151bp	18%	158.8M
659_bUW-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		80.6%	52%	138bp	151bp	9%	156.5M	80.6%	52%	138bp	151bp	9%	156.5M
659_bUW-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		81.1%	53%	138bp	151bp	9%	156.5M	81.1%	53%	138bp	151bp	9%	156.5M
659_bUW-T1-TRNA-1_A23MVY2LT4_2	Yes	0.00%	170.9bp	155.0bp	0.01%	1.48%	0.62%	0.00%	0.03%	4.65%	0.95%	0.00%	0.01	558793160	0.9665	9999000000	321257289	591734578	0.01%	0.51%	289907338	0.94%	0.98%	0.05%	0.02%	273251834	138501436	13153569	3476415	603.66	229.00	0.70%	0.60%	0.97	0.000				51.3%	84.8%	93.5%	276.8M	38.3%	97.4%	79460.9Mb	591.7M	53.5%	98.6%	40.6%
659_bUW-T1-TRNA-1_A23MVY2LT4_2_1																																				170.9bp	98.5%	291.4M												85.7%	53%	151bp	151bp	18%	310.0M
659_bUW-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.0%	53%	151bp	151bp	18%	310.0M
659_bUW-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		85.6%	53%	138bp	151bp	9%	295.9M	85.6%	53%	138bp	151bp	9%	295.9M
659_bUW-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		85.9%	53%	138bp	151bp	9%	295.9M	85.9%	53%	138bp	151bp	9%	295.9M
659_bhK-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	165.6bp	152.0bp	0.00%	0.63%	0.38%	0.00%	0.01%	2.36%	0.66%	0.00%	5.99	575265894	0.9506	9999000000	248973800	590658864	0.01%	0.59%	239604682	0.93%	0.97%	0.06%	0.03%	222893644	112994510	13189900	3987840	476.86	210.00	0.73%	0.62%	0.98	0.000				59.8%	92.2%	96.5%	285.0M	45.2%	97.4%	78733.1Mb	590.7M	55.5%	98.4%	42.9%
659_bhK-T1-TRNA-1_A23MVY2LT4_1_1																																				165.6bp	98.2%	290.1M												86.6%	54%	151bp	151bp	18%	331.9M
659_bhK-T1-TRNA-1_A23MVY2LT4_1_2																																																		85.5%	55%	151bp	151bp	18%	331.9M
659_bhK-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		85.9%	55%	137bp	151bp	9%	295.3M	85.9%	55%	137bp	151bp	9%	295.3M
659_bhK-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		86.1%	55%	137bp	151bp	9%	295.3M	86.1%	55%	137bp	151bp	9%	295.3M
659_bhK-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	174.6bp	160.0bp	0.00%	0.61%	0.36%	0.00%	0.01%	2.32%	0.63%	0.00%	6.06	575576118	0.9617	9999000000	160200912	590732160	0.01%	0.71%	172678231	0.91%	0.96%	0.07%	0.04%	157895980	80212205	11290089	3448496	341.67	142.00	0.70%	0.56%	0.97	0.000				71.2%	92.4%	96.6%	285.2M	56.3%	97.4%	80387.2Mb	590.7M	55.6%	98.5%	37.1%
659_bhK-T1-TRNA-1_A23MVY2LT4_2_1																																				174.6bp	98.2%	289.9M												89.5%	54%	151bp	151bp	18%	388.4M
659_bhK-T1-TRNA-1_A23MVY2LT4_2_2																																																		88.2%	55%	151bp	151bp	18%	388.4M
659_bhK-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		87.9%	55%	140bp	151bp	9%	295.4M	87.9%	55%	140bp	151bp	9%	295.4M
659_bhK-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		88.0%	55%	140bp	151bp	9%	295.4M	88.0%	55%	140bp	151bp	9%	295.4M
659_buD-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	150.5bp	139.0bp	0.01%	1.08%	0.59%	0.00%	0.03%	3.39%	0.88%	0.00%	0.01	572501446	0.9542	9999000000	297076222	590992730	0.01%	0.52%	284895984	0.93%	0.96%	0.05%	0.04%	265535144	134208739	15423467	5160667	526.50	270.00	0.76%	0.66%	0.97	0.000				52.1%	90.1%	95.8%	283.0M	37.7%	97.4%	76063.9Mb	591.0M	53.7%	98.5%	52.9%
659_buD-T1-TRNA-1_A23MVY2LT4_1_1																																				150.5bp	98.1%	289.8M												84.8%	53%	151bp	151bp	18%	315.6M
659_buD-T1-TRNA-1_A23MVY2LT4_1_2																																																		83.6%	54%	151bp	151bp	18%	315.6M
659_buD-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.4%	53%	132bp	147bp	9%	295.5M	84.4%	53%	132bp	147bp	9%	295.5M
659_buD-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.3%	54%	132bp	147bp	9%	295.5M	84.3%	54%	132bp	147bp	9%	295.5M
659_buD-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	152.8bp	140.0bp	0.01%	1.06%	0.58%	0.00%	0.02%	3.36%	0.87%	0.00%	0.01	433713583	0.9635	9999000000	179416459	447523764	0.01%	0.57%	191699362	0.93%	0.96%	0.06%	0.04%	177815969	89879896	11016359	3716047	353.07	174.00	0.73%	0.60%	0.98	0.000				57.5%	90.3%	95.8%	214.4M	41.7%	97.5%	58194.4Mb	447.5M	53.4%	98.5%	51.1%
659_buD-T1-TRNA-1_A23MVY2LT4_2_1																																				152.8bp	98.1%	219.5M												83.7%	52%	151bp	151bp	18%	227.1M
659_buD-T1-TRNA-1_A23MVY2LT4_2_2																																																		83.0%	53%	151bp	151bp	18%	227.1M
659_buD-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		83.7%	53%	133bp	147bp	9%	223.8M	83.7%	53%	133bp	147bp	9%	223.8M
659_buD-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		84.2%	53%	133bp	147bp	9%	223.8M	84.2%	53%	133bp	147bp	9%	223.8M
659_bua-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	151.4bp	140.0bp	0.01%	0.69%	0.55%	0.00%	0.01%	2.26%	0.80%	0.00%	0.01	575191553	0.9253	9999000000	293789021	591443002	0.01%	0.53%	276838943	0.93%	0.96%	0.06%	0.04%	258290652	130565035	15302344	5152386	517.21	206.00	0.69%	0.59%	0.98	0.000				53.5%	91.4%	96.2%	284.6M	38.1%	97.4%	76520.5Mb	591.4M	54.1%	98.6%	51.5%
659_bua-T1-TRNA-1_A23MVY2LT4_1_1																																				151.4bp	98.0%	289.8M												85.1%	53%	151bp	151bp	18%	384.4M
659_bua-T1-TRNA-1_A23MVY2LT4_1_2																																																		84.4%	54%	151bp	151bp	18%	384.4M
659_bua-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		83.3%	53%	133bp	147bp	9%	295.7M	83.3%	53%	133bp	147bp	9%	295.7M
659_bua-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		83.8%	54%	133bp	147bp	9%	295.7M	83.8%	54%	133bp	147bp	9%	295.7M
659_bua-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	154.2bp	142.0bp	0.01%	0.73%	0.58%	0.00%	0.01%	2.42%	0.87%	0.00%	0.01	574690473	0.9392	9999000000	162938209	591106054	0.01%	0.67%	192671660	0.92%	0.95%	0.07%	0.05%	176465119	89221798	12873137	4472764	349.96	130.00	0.66%	0.54%	0.97	0.000				67.8%	91.4%	96.2%	284.5M	50.1%	97.4%	77082.4Mb	591.1M	54.6%	98.5%	49.9%
659_bua-T1-TRNA-1_A23MVY2LT4_2_1																																				154.2bp	98.0%	289.7M												87.0%	54%	151bp	151bp	18%	325.1M
659_bua-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.9%	54%	151bp	151bp	18%	325.1M
659_bua-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.5%	54%	134bp	151bp	9%	295.6M	86.5%	54%	134bp	151bp	9%	295.6M
659_bua-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.5%	54%	134bp	151bp	9%	295.6M	86.5%	54%	134bp	151bp	9%	295.6M
659_c95-T1-TRNA-1_A23MVY2LT4_1	Yes	0.16%	161.9bp	148.0bp	0.01%	1.00%	0.45%	0.00%	0.03%	3.17%	0.67%	0.00%	0.13	571719703	0.9146	9999000000	404214448	591382276	0.01%	0.47%	315544214	0.94%	0.97%	0.05%	0.03%	295405991	149682535	16511945	5096627	623.08	306.00	0.75%	0.66%	0.98	0.000				46.9%	89.4%	95.7%	283.0M	34.2%	97.5%	77969.2Mb	591.4M	53.9%	98.6%	45.5%
659_c95-T1-TRNA-1_A23MVY2LT4_1_1																																				161.9bp	97.8%	289.2M												85.0%	53%	151bp	151bp	27%	348.1M
659_c95-T1-TRNA-1_A23MVY2LT4_1_2																																																		84.2%	54%	151bp	151bp	18%	348.1M
659_c95-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.0%	53%	135bp	151bp	9%	295.7M	84.0%	53%	135bp	151bp	9%	295.7M
659_c95-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.3%	54%	135bp	151bp	9%	295.7M	84.3%	54%	135bp	151bp	9%	295.7M
659_c95-T1-TRNA-1_A23MVY2LT4_2	Yes	0.13%	166.6bp	152.0bp	0.01%	0.96%	0.44%	0.00%	0.03%	3.10%	0.66%	0.00%	0.16	560571925	0.9167	9999000000	281529652	579786172	0.01%	0.53%	272903925	0.93%	0.96%	0.06%	0.04%	254106575	128856226	15232534	4674033	540.83	261.00	0.74%	0.64%	0.98	0.000				53.3%	89.4%	95.7%	277.5M	40.1%	97.4%	77331.0Mb	579.8M	54.0%	98.5%	42.7%
659_c95-T1-TRNA-1_A23MVY2LT4_2_1																																				166.6bp	97.8%	283.4M												84.4%	53%	151bp	151bp	27%	294.4M
659_c95-T1-TRNA-1_A23MVY2LT4_2_2																																																		83.8%	54%	151bp	151bp	18%	294.4M
659_c95-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		84.4%	53%	137bp	151bp	9%	289.9M	84.4%	53%	137bp	151bp	9%	289.9M
659_c95-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		85.0%	54%	137bp	151bp	9%	289.9M	85.0%	54%	137bp	151bp	9%	289.9M
659_cAd-T1-TRNA-1_A23MVY2LT4_1	Yes	0.03%	139.8bp	132.0bp	0.01%	1.08%	0.71%	0.00%	0.03%	3.34%	1.05%	0.00%	0.01	515978931	0.9297	9999000000	264556305	534805094	0.01%	0.52%	255211176	0.93%	0.96%	0.06%	0.04%	237019062	119425222	14133255	5169679	440.81	191.00	0.72%	0.60%	0.97	0.000				52.7%	88.9%	95.3%	254.9M	35.9%	97.4%	67113.6Mb	534.8M	55.0%	98.5%	60.6%
659_cAd-T1-TRNA-1_A23MVY2LT4_1_1																																				139.8bp	97.9%	261.9M												82.5%	54%	151bp	151bp	18%	271.5M
659_cAd-T1-TRNA-1_A23MVY2LT4_1_2																																																		81.8%	55%	151bp	151bp	18%	271.5M
659_cAd-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		82.5%	54%	129bp	137bp	9%	267.4M	82.5%	54%	129bp	137bp	9%	267.4M
659_cAd-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		82.9%	55%	129bp	137bp	9%	267.4M	82.9%	55%	129bp	137bp	9%	267.4M
659_cAd-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	140.2bp	131.0bp	0.01%	1.18%	0.76%	0.00%	0.03%	3.68%	1.15%	0.00%	0.01	568633756	0.9419	9999000000	169849818	589788500	0.01%	0.67%	194899678	0.91%	0.95%	0.07%	0.05%	177026578	89188732	13274988	5031427	322.78	133.00	0.69%	0.55%	0.98	0.000				67.5%	88.9%	95.3%	281.0M	48.7%	97.5%	74019.5Mb	589.8M	55.3%	98.3%	60.1%
659_cAd-T1-TRNA-1_A23MVY2LT4_2_1																																				140.2bp	97.8%	288.5M												87.2%	54%	151bp	151bp	18%	337.7M
659_cAd-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.9%	55%	151bp	151bp	18%	337.7M
659_cAd-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.4%	55%	129bp	137bp	9%	294.9M	86.4%	55%	129bp	137bp	9%	294.9M
659_cAd-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.5%	55%	129bp	137bp	9%	294.9M	86.5%	55%	129bp	137bp	9%	294.9M
659_cIX-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	163.2bp	150.0bp	0.01%	0.91%	0.53%	0.00%	0.01%	3.10%	0.81%	0.00%	0.01	570077279	0.9598	9990000000	299722251	585007414	0.01%	0.52%	280140651	0.94%	0.97%	0.05%	0.03%	262477458	132859029	14619710	4554000	555.64	235.00	0.72%	0.62%	0.97	0.000				52.4%	91.8%	96.4%	282.1M	37.7%	97.3%	77598.7Mb	585.0M	54.1%	98.4%	44.2%
659_cIX-T1-TRNA-1_A23MVY2LT4_1_1																																				163.2bp	98.1%	287.0M												84.0%	53%	151bp	151bp	18%	297.2M
659_cIX-T1-TRNA-1_A23MVY2LT4_1_2																																																		83.3%	54%	151bp	151bp	18%	297.2M
659_cIX-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.1%	53%	136bp	151bp	9%	292.5M	84.1%	53%	136bp	151bp	9%	292.5M
659_cIX-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.5%	54%	136bp	151bp	9%	292.5M	84.5%	54%	136bp	151bp	9%	292.5M
659_cIX-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	162.6bp	149.0bp	0.01%	1.00%	0.59%	0.00%	0.01%	3.41%	0.90%	0.00%	0.01	575489737	0.9648	9999000000	190572974	590843712	0.01%	0.63%	219838119	0.93%	0.96%	0.06%	0.04%	203665350	103106181	13111985	4267998	423.05	171.00	0.70%	0.58%	0.98	0.000				63.1%	91.7%	96.4%	284.9M	47.7%	97.5%	78200.6Mb	590.8M	54.7%	98.5%	44.7%
659_cIX-T1-TRNA-1_A23MVY2LT4_2_1																																				162.6bp	98.1%	289.8M												87.4%	54%	151bp	151bp	18%	370.1M
659_cIX-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.6%	54%	151bp	151bp	18%	370.1M
659_cIX-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		85.9%	54%	136bp	151bp	9%	295.4M	85.9%	54%	136bp	151bp	9%	295.4M
659_cIX-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.4%	55%	136bp	151bp	9%	295.4M	86.4%	55%	136bp	151bp	9%	295.4M
659_cRB-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	127.4bp	122.0bp	0.01%	0.99%	0.62%	0.00%	0.03%	3.24%	0.96%	0.00%	6.21	462751938	0.9447	9999000000	148045895	477824582	0.01%	0.67%	158606692	0.91%	0.94%	0.07%	0.06%	144351545	72522803	10925019	4433840	243.20	115.00	0.69%	0.53%	0.97	0.000				67.3%	89.4%	95.5%	228.2M	43.9%	97.3%	57419.8Mb	477.8M	54.8%	98.5%	70.2%
659_cRB-T1-TRNA-1_A23MVY2LT4_1_1																																				127.4bp	98.1%	234.3M												84.4%	54%	151bp	151bp	18%	242.7M
659_cRB-T1-TRNA-1_A23MVY2LT4_1_2																																																		83.2%	54%	151bp	151bp	18%	242.7M
659_cRB-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.4%	54%	123bp	127bp	9%	238.9M	84.4%	54%	123bp	127bp	9%	238.9M
659_cRB-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.4%	55%	124bp	127bp	9%	238.9M	84.4%	55%	124bp	127bp	9%	238.9M
659_cRB-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	129.2bp	122.0bp	0.01%	1.07%	0.67%	0.00%	0.02%	3.54%	1.06%	0.00%	6.22	549676535	0.9591	9999000000	111403143	567211638	0.01%	0.78%	123639576	0.88%	0.93%	0.08%	0.07%	109412618	54950163	10392931	4306725	182.87	82.00	0.65%	0.46%	0.98	0.000				78.7%	89.6%	95.6%	271.1M	55.3%	97.5%	68756.6Mb	567.2M	55.1%	98.4%	68.5%
659_cRB-T1-TRNA-1_A23MVY2LT4_2_1																																				129.2bp	98.1%	278.3M												88.2%	54%	151bp	151bp	18%	288.1M
659_cRB-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.7%	54%	151bp	151bp	18%	288.1M
659_cRB-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		88.3%	54%	124bp	127bp	9%	283.6M	88.3%	54%	124bp	127bp	9%	283.6M
659_cRB-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		88.0%	55%	124bp	127bp	9%	283.6M	88.0%	55%	124bp	127bp	9%	283.6M
659_cRa-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	160.6bp	147.0bp	0.01%	0.83%	0.50%	0.00%	0.01%	3.00%	0.80%	0.00%	0.00	574900919	0.9159	9999000000	281427144	591186764	0.01%	0.55%	263307903	0.93%	0.97%	0.05%	0.03%	246123469	124541791	13618775	4252306	525.03	254.00	0.75%	0.65%	0.98	0.000				55.8%	91.3%	96.2%	284.4M	41.5%	97.5%	78302.7Mb	591.2M	55.8%	98.5%	44.9%
659_cRa-T1-TRNA-1_A23MVY2LT4_1_1																																				160.6bp	98.2%	290.4M												87.9%	54%	151bp	151bp	27%	440.0M
659_cRa-T1-TRNA-1_A23MVY2LT4_1_2																																																		87.2%	55%	151bp	151bp	27%	440.0M
659_cRa-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		85.4%	55%	136bp	151bp	18%	295.6M	85.4%	55%	136bp	151bp	18%	295.6M
659_cRa-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		86.0%	56%	136bp	151bp	18%	295.6M	86.0%	56%	136bp	151bp	18%	295.6M
659_cRa-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	160.7bp	147.0bp	0.00%	0.88%	0.53%	0.00%	0.01%	3.24%	0.88%	0.00%	0.01	573777293	0.9323	9999000000	171480540	590312336	0.01%	0.66%	200059688	0.92%	0.96%	0.06%	0.04%	184702535	93456100	11635987	3725043	390.06	179.00	0.73%	0.60%	0.97	0.000				66.5%	91.3%	96.2%	283.9M	50.9%	97.4%	78313.4Mb	590.3M	56.3%	98.4%	44.2%
659_cRa-T1-TRNA-1_A23MVY2LT4_2_1																																				160.7bp	98.2%	289.9M												90.2%	55%	151bp	151bp	27%	483.4M
659_cRa-T1-TRNA-1_A23MVY2LT4_2_2																																																		89.1%	56%	151bp	151bp	27%	483.4M
659_cRa-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		87.3%	55%	136bp	151bp	18%	295.2M	87.3%	55%	136bp	151bp	18%	295.2M
659_cRa-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		87.8%	56%	136bp	151bp	18%	295.2M	87.8%	56%	136bp	151bp	18%	295.2M
659_cTi-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	151.0bp	139.0bp	0.01%	0.89%	0.52%	0.00%	0.02%	2.79%	0.78%	0.00%	0.01	572574616	0.9336	9999000000	336122172	591108460	0.01%	0.50%	297642205	0.94%	0.97%	0.05%	0.03%	278811913	140868288	14870253	4810720	561.81	294.00	0.78%	0.68%	0.97	0.000				50.0%	90.4%	95.7%	283.0M	35.6%	97.4%	76175.8Mb	591.1M	54.5%	98.5%	52.2%
659_cTi-T1-TRNA-1_A23MVY2LT4_1_1																																				151.0bp	98.0%	289.7M												86.1%	54%	151bp	151bp	18%	391.1M
659_cTi-T1-TRNA-1_A23MVY2LT4_1_2																																																		85.1%	54%	151bp	151bp	18%	391.1M
659_cTi-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.2%	54%	132bp	147bp	9%	295.6M	84.2%	54%	132bp	147bp	9%	295.6M
659_cTi-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.4%	54%	132bp	147bp	9%	295.6M	84.4%	54%	132bp	147bp	9%	295.6M
659_cTi-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	164.4bp	152.0bp	0.01%	0.88%	0.55%	0.00%	0.02%	2.82%	0.83%	0.00%	0.01	573291921	0.9603	9999000000	208425752	591113488	0.01%	0.62%	227041045	0.93%	0.96%	0.05%	0.04%	210324443	106464965	12459865	3938942	437.14	219.00	0.76%	0.64%	0.98	0.000				62.0%	90.9%	95.8%	283.3M	48.1%	97.5%	79274.7Mb	591.1M	54.5%	98.5%	42.6%
659_cTi-T1-TRNA-1_A23MVY2LT4_2_1																																				164.4bp	97.8%	289.1M												88.0%	53%	151bp	151bp	18%	384.2M
659_cTi-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.8%	54%	151bp	151bp	18%	384.2M
659_cTi-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.3%	54%	138bp	151bp	9%	295.6M	86.3%	54%	138bp	151bp	9%	295.6M
659_cTi-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.5%	54%	138bp	151bp	9%	295.6M	86.5%	54%	138bp	151bp	9%	295.6M
659_cVw-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	171.6bp	155.0bp	0.01%	1.13%	0.47%	0.00%	0.02%	3.70%	0.76%	0.00%	5.22	567651021	0.9277	9999000000	326136504	590880154	0.01%	0.49%	300971827	0.93%	0.97%	0.05%	0.03%	281234857	142579339	15860835	4691193	617.35	287.00	0.75%	0.65%	0.97	0.000				49.4%	88.6%	95.3%	281.4M	37.5%	97.4%	79248.7Mb	590.9M	55.8%	98.5%	39.7%
659_cVw-T1-TRNA-1_A23MVY2LT4_1_1																																				171.6bp	98.0%	289.4M												85.4%	55%	151bp	151bp	18%	327.2M
659_cVw-T1-TRNA-1_A23MVY2LT4_1_2																																																		84.6%	56%	151bp	151bp	18%	327.2M
659_cVw-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.8%	55%	138bp	151bp	9%	295.4M	84.8%	55%	138bp	151bp	9%	295.4M
659_cVw-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		85.2%	56%	138bp	151bp	9%	295.4M	85.2%	56%	138bp	151bp	9%	295.4M
659_cVw-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	178.6bp	163.0bp	0.01%	1.21%	0.51%	0.00%	0.01%	4.00%	0.83%	0.00%	5.18	567361975	0.9333	9999000000	204801479	590490072	0.01%	0.62%	226206162	0.92%	0.96%	0.06%	0.04%	208347605	105809303	13960967	4178364	461.94	202.00	0.73%	0.61%	0.97	0.000				62.1%	88.7%	95.3%	281.3M	49.5%	97.4%	80305.9Mb	590.5M	56.3%	98.4%	35.7%
659_cVw-T1-TRNA-1_A23MVY2LT4_2_1																																				178.6bp	97.8%	288.8M												88.9%	55%	151bp	151bp	18%	412.4M
659_cVw-T1-TRNA-1_A23MVY2LT4_2_2																																																		87.8%	56%	151bp	151bp	18%	412.4M
659_cVw-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.8%	55%	140bp	151bp	9%	295.2M	86.8%	55%	140bp	151bp	9%	295.2M
659_cVw-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		87.2%	56%	140bp	151bp	9%	295.2M	87.2%	56%	140bp	151bp	9%	295.2M
659_cWx-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	156.2bp	143.0bp	0.01%	1.15%	0.46%	0.00%	0.03%	3.61%	0.74%	0.00%	0.00	563669410	0.9437	9999000000	191294313	588177704	0.01%	0.62%	223398902	0.92%	0.95%	0.07%	0.05%	204446965	103468876	14796465	4903568	408.91	152.00	0.71%	0.57%	0.97	0.000				62.5%	87.1%	94.9%	279.0M	46.3%	97.1%	76546.2Mb	588.2M	59.4%	98.0%	48.0%
659_cWx-T1-TRNA-1_A23MVY2LT4_1_1																																				156.2bp	97.4%	286.6M												87.7%	58%	151bp	151bp	18%	371.9M
659_cWx-T1-TRNA-1_A23MVY2LT4_1_2																																																		86.2%	59%	151bp	151bp	18%	371.9M
659_cWx-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		86.2%	59%	134bp	151bp	9%	294.1M	86.2%	59%	134bp	151bp	9%	294.1M
659_cWx-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		86.3%	59%	134bp	151bp	9%	294.1M	86.3%	59%	134bp	151bp	9%	294.1M
659_cWx-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	166.2bp	153.0bp	0.01%	1.17%	0.48%	0.00%	0.02%	3.73%	0.79%	0.00%	0.01	536879781	0.9518	9999000000	150763487	559540888	0.01%	0.70%	169385768	0.90%	0.95%	0.07%	0.05%	153194173	77693542	12249717	4053646	312.55	110.00	0.68%	0.52%	0.97	0.000				70.2%	87.6%	95.0%	265.8M	55.3%	97.2%	75085.9Mb	559.5M	59.8%	98.2%	40.7%
659_cWx-T1-TRNA-1_A23MVY2LT4_2_1																																				166.2bp	97.2%	271.9M												87.5%	58%	151bp	151bp	18%	284.8M
659_cWx-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.2%	59%	151bp	151bp	18%	284.8M
659_cWx-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		87.5%	59%	138bp	151bp	9%	279.8M	87.5%	59%	138bp	151bp	9%	279.8M
659_cWx-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		87.6%	60%	138bp	151bp	9%	279.8M	87.6%	60%	138bp	151bp	9%	279.8M
659_cfy-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	162.4bp	149.0bp	0.02%	0.95%	0.64%	0.00%	0.04%	2.93%	0.92%	0.00%	0.01	575428262	0.9418	9999000000	310010505	590921430	0.00%	0.51%	291087382	0.94%	0.97%	0.05%	0.03%	274196307	138798940	14005581	4109203	581.09	248.00	0.73%	0.62%	0.98	0.000				51.0%	91.6%	96.3%	284.6M	38.2%	97.4%	78619.1Mb	590.9M	55.5%	98.5%	44.2%
659_cfy-T1-TRNA-1_A23MVY2LT4_1_1																																				162.4bp	98.2%	290.2M												86.6%	54%	151bp	151bp	18%	379.5M
659_cfy-T1-TRNA-1_A23MVY2LT4_1_2																																																		85.7%	55%	151bp	151bp	18%	379.5M
659_cfy-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		85.0%	55%	136bp	151bp	9%	295.5M	85.0%	55%	136bp	151bp	9%	295.5M
659_cfy-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		85.4%	55%	137bp	151bp	9%	295.5M	85.4%	55%	137bp	151bp	9%	295.5M
659_cfy-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	160.7bp	147.0bp	0.02%	1.07%	0.71%	0.00%	0.03%	3.29%	1.02%	0.00%	0.01	572144908	0.9542	9999000000	167000467	588700016	0.01%	0.68%	188554638	0.92%	0.96%	0.06%	0.04%	174133296	88067983	11294989	3567225	352.82	139.00	0.68%	0.55%	0.97	0.000				68.3%	91.2%	96.2%	283.1M	52.0%	97.3%	77365.6Mb	588.7M	55.9%	98.1%	45.8%
659_cfy-T1-TRNA-1_A23MVY2LT4_2_1																																				160.7bp	98.2%	289.1M												89.7%	55%	151bp	151bp	18%	425.6M
659_cfy-T1-TRNA-1_A23MVY2LT4_2_2																																																		87.9%	56%	151bp	151bp	18%	425.6M
659_cfy-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		87.5%	55%	135bp	151bp	9%	294.4M	87.5%	55%	135bp	151bp	9%	294.4M
659_cfy-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		87.4%	56%	135bp	151bp	9%	294.4M	87.4%	56%	135bp	151bp	9%	294.4M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	165.9bp	151.0bp	0.01%	0.82%	0.41%	0.00%	0.01%	2.60%	0.62%	0.00%	0.01	571664995	0.9203	9999000000	357849226	590621600	0.01%	0.48%	309475172	0.93%	0.97%	0.05%	0.03%	288660786	146449171	16851375	5059194	610.82	300.00	0.78%	0.67%	0.98	0.000				47.9%	90.2%	95.8%	282.9M	36.9%	97.4%	78764.6Mb	590.6M	56.3%	98.4%	42.4%
659_ciJ-T1-TRNA-1_A23MVY2LT4_1_1																																				165.9bp	97.6%	288.3M												85.6%	55%	151bp	151bp	18%	379.9M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1_2																																																		84.8%	56%	151bp	151bp	18%	379.9M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		83.8%	55%	137bp	151bp	9%	295.3M	83.8%	55%	137bp	151bp	9%	295.3M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.4%	56%	137bp	151bp	9%	295.3M	84.4%	56%	137bp	151bp	9%	295.3M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	174.6bp	160.0bp	0.01%	0.81%	0.40%	0.00%	0.01%	2.57%	0.61%	0.00%	0.00	572042436	0.9399	9999000000	239516631	590601524	0.01%	0.56%	259576108	0.92%	0.96%	0.06%	0.04%	239694498	121862273	16020956	4808451	516.39	252.00	0.77%	0.65%	0.98	0.000				56.4%	90.5%	95.9%	283.2M	44.1%	97.4%	79991.6Mb	590.6M	56.0%	98.4%	38.4%
659_ciJ-T1-TRNA-1_A23MVY2LT4_2_1																																				174.6bp	97.5%	287.8M												86.4%	55%	151bp	151bp	18%	345.2M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.5%	56%	151bp	151bp	18%	345.2M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		85.3%	55%	139bp	151bp	9%	295.3M	85.3%	55%	139bp	151bp	9%	295.3M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		85.6%	56%	139bp	151bp	9%	295.3M	85.6%	56%	139bp	151bp	9%	295.3M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1	Yes	0.00%	136.3bp	130.0bp	0.01%	1.71%	0.66%	0.00%	0.02%	4.97%	0.95%	0.00%	4.61	570104184	0.9508	9999000000	259275111	590998276	0.01%	0.63%	220248127	0.92%	0.95%	0.06%	0.05%	203210660	102296831	13277488	5041612	359.12	161.00	0.70%	0.58%	0.97	0.000				63.1%	88.7%	95.2%	281.3M	42.9%	97.2%	73068.5Mb	591.0M	53.0%	98.5%	64.8%
659_ciZ-T1-TRNA-1_A23MVY2LT4_1_1																																				136.3bp	98.1%	289.9M												84.9%	52%	151bp	151bp	18%	305.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1_2																																																		83.8%	53%	151bp	151bp	18%	305.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.9%	52%	127bp	132bp	9%	295.5M	84.9%	52%	127bp	132bp	9%	295.5M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.9%	53%	127bp	132bp	9%	295.5M	84.9%	53%	127bp	132bp	9%	295.5M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	132.2bp	125.0bp	0.01%	1.88%	0.74%	0.00%	0.02%	5.40%	1.08%	0.00%	4.45	568719811	0.9611	9999000000	136499209	590612280	0.01%	0.77%	137643535	0.89%	0.93%	0.08%	0.07%	122959370	61841813	10990284	4406209	208.32	86.00	0.65%	0.47%	0.97	0.000				77.2%	88.4%	95.1%	280.8M	52.0%	97.3%	71388.7Mb	590.6M	53.9%	98.4%	67.7%
659_ciZ-T1-TRNA-1_A23MVY2LT4_2_1																																				132.2bp	98.1%	289.7M												88.9%	53%	151bp	151bp	18%	327.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2_2																																																		87.5%	54%	151bp	151bp	18%	327.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		88.3%	53%	124bp	127bp	9%	295.3M	88.3%	53%	124bp	127bp	9%	295.3M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		88.0%	54%	124bp	127bp	9%	295.3M	88.0%	54%	124bp	127bp	9%	295.3M
659_d01-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	155.2bp	143.0bp	0.01%	0.92%	0.37%	0.00%	0.01%	3.00%	0.57%	0.00%	0.01	531312778	0.9121	9999000000	233990666	550091604	0.01%	0.55%	247002771	0.92%	0.95%	0.06%	0.05%	227723128	115225578	15816702	5537956	446.80	234.00	0.75%	0.64%	0.98	0.000				55.4%	89.5%	95.6%	263.0M	40.4%	97.4%	71796.1Mb	550.1M	55.2%	98.4%	49.6%
659_d01-T1-TRNA-1_A23MVY2LT4_1_1																																				155.2bp	97.4%	267.9M												81.2%	54%	151bp	151bp	18%	279.4M
659_d01-T1-TRNA-1_A23MVY2LT4_1_2																																																		80.6%	55%	151bp	151bp	18%	279.4M
659_d01-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		81.2%	54%	134bp	151bp	9%	275.0M	81.2%	54%	134bp	151bp	9%	275.0M
659_d01-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		81.8%	55%	134bp	151bp	9%	275.0M	81.8%	55%	134bp	151bp	9%	275.0M
659_d01-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	160.9bp	148.0bp	0.00%	0.89%	0.34%	0.00%	0.01%	2.93%	0.54%	0.00%	0.01	406536977	0.9462	9999000000	142680172	420786928	0.01%	0.63%	155122232	0.91%	0.95%	0.07%	0.05%	141354299	71585979	11180911	3932966	279.63	142.00	0.71%	0.56%	0.97	0.000				63.5%	89.6%	95.7%	201.3M	48.6%	97.3%	55927.8Mb	420.8M	55.1%	98.4%	44.9%
659_d01-T1-TRNA-1_A23MVY2LT4_2_1																																				160.9bp	97.3%	204.8M												82.2%	54%	151bp	151bp	18%	213.8M
659_d01-T1-TRNA-1_A23MVY2LT4_2_2																																																		81.2%	55%	151bp	151bp	18%	213.8M
659_d01-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		82.3%	54%	137bp	151bp	9%	210.4M	82.3%	54%	137bp	151bp	9%	210.4M
659_d01-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		82.4%	55%	137bp	151bp	9%	210.4M	82.4%	55%	137bp	151bp	9%	210.4M
659_dES-T1-TRNA-1_A23MVY2LT4_1	Yes	0.00%	153.9bp	144.0bp	0.01%	1.22%	0.38%	0.00%	0.03%	3.84%	0.63%	0.00%	0.03	570539609	0.9240	9999000000	332256656	591688644	0.01%	0.50%	298287097	0.93%	0.96%	0.06%	0.04%	276885191	139870173	17535357	6260766	555.86	278.00	0.76%	0.65%	0.98	0.000				49.9%	88.7%	95.3%	282.1M	38.2%	97.5%	77454.5Mb	591.7M	52.8%	98.6%	49.8%
659_dES-T1-TRNA-1_A23MVY2LT4_1_1																																				153.9bp	97.8%	289.5M												84.1%	52%	151bp	151bp	18%	324.4M
659_dES-T1-TRNA-1_A23MVY2LT4_1_2																																																		83.5%	53%	151bp	151bp	18%	324.4M
659_dES-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		83.6%	52%	134bp	151bp	9%	295.8M	83.6%	52%	134bp	151bp	9%	295.8M
659_dES-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.1%	53%	134bp	151bp	9%	295.8M	84.1%	53%	134bp	151bp	9%	295.8M
659_dES-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	154.6bp	143.0bp	0.01%	1.33%	0.42%	0.00%	0.02%	4.20%	0.70%	0.00%	0.01	495412558	0.9473	9999000000	183489136	514089484	0.01%	0.59%	208384394	0.92%	0.95%	0.07%	0.05%	191043305	96527234	13912806	5090510	379.05	181.00	0.72%	0.60%	0.98	0.000				59.9%	88.7%	95.3%	245.1M	45.5%	97.4%	67152.9Mb	514.1M	53.3%	98.4%	49.9%
659_dES-T1-TRNA-1_A23MVY2LT4_2_1																																				154.6bp	97.8%	251.4M												84.7%	52%	151bp	151bp	18%	261.2M
659_dES-T1-TRNA-1_A23MVY2LT4_2_2																																																		84.0%	53%	151bp	151bp	18%	261.2M
659_dES-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		84.8%	52%	134bp	151bp	9%	257.0M	84.8%	52%	134bp	151bp	9%	257.0M
659_dES-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		85.3%	53%	134bp	151bp	9%	257.0M	85.3%	53%	134bp	151bp	9%	257.0M
659_dc8-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	162.2bp	149.0bp	0.02%	1.53%	0.47%	0.00%	0.05%	4.65%	0.73%	0.00%	5.12	570466449	0.9454	9999000000	292211343	590599312	0.01%	0.52%	285670411	0.93%	0.96%	0.06%	0.04%	265807654	134707758	16242296	5145642	553.76	287.00	0.76%	0.66%	0.98	0.000				51.9%	89.5%	95.5%	282.1M	38.9%	97.4%	78312.4Mb	590.6M	55.1%	98.4%	44.2%
659_dc8-T1-TRNA-1_A23MVY2LT4_1_1																																				162.2bp	97.6%	288.2M												84.8%	54%	151bp	151bp	18%	327.6M
659_dc8-T1-TRNA-1_A23MVY2LT4_1_2																																																		83.9%	55%	151bp	151bp	18%	327.6M
659_dc8-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.2%	54%	136bp	151bp	9%	295.3M	84.2%	54%	136bp	151bp	9%	295.3M
659_dc8-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.5%	55%	136bp	151bp	9%	295.3M	84.5%	55%	136bp	151bp	9%	295.3M
659_dc8-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	163.8bp	151.0bp	0.02%	1.64%	0.51%	0.00%	0.04%	5.00%	0.81%	0.00%	4.99	569677742	0.9607	9990000000	179769744	590689878	0.01%	0.64%	213163852	0.92%	0.96%	0.07%	0.04%	195322195	99057624	14181970	4654809	402.81	198.00	0.73%	0.61%	0.97	0.000				64.3%	89.2%	95.4%	281.8M	49.3%	97.4%	78529.8Mb	590.7M	55.7%	98.4%	43.4%
659_dc8-T1-TRNA-1_A23MVY2LT4_2_1																																				163.8bp	97.3%	287.5M												87.5%	54%	151bp	151bp	18%	346.2M
659_dc8-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.2%	55%	151bp	151bp	18%	346.2M
659_dc8-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.4%	55%	136bp	151bp	9%	295.3M	86.4%	55%	136bp	151bp	9%	295.3M
659_dc8-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.5%	56%	137bp	151bp	9%	295.3M	86.5%	56%	137bp	151bp	9%	295.3M
659_dcz-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	124.6bp	120.0bp	0.01%	1.09%	0.27%	0.00%	0.02%	3.38%	0.46%	0.00%	6.33	171484063	0.9151	9999000000	46192447	180081228	0.01%	0.78%	39024059	0.81%	0.86%	0.14%	0.14%	31727290	15895236	5598751	2561351	46.97	19.00	0.41%	0.12%	0.97	0.000				79.1%	85.0%	94.0%	84.7M	53.4%	97.3%	21071.8Mb	180.1M	54.6%	98.3%	75.7%
659_dcz-T1-TRNA-1_A23MVY2LT4_1_1																																				124.6bp	96.6%	87.0M												82.5%	54%	151bp	151bp	18%	91.6M
659_dcz-T1-TRNA-1_A23MVY2LT4_1_2																																																		80.9%	54%	151bp	151bp	18%	91.6M
659_dcz-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		82.5%	54%	120bp	122bp	9%	90.0M	82.5%	54%	120bp	122bp	9%	90.0M
659_dcz-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		82.0%	54%	120bp	122bp	9%	90.0M	82.0%	54%	120bp	122bp	9%	90.0M
659_dcz-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	121.6bp	117.0bp	0.01%	1.23%	0.29%	0.00%	0.02%	3.80%	0.51%	0.00%	6.28	114256194	0.8677	9999000000	26698224	120151114	0.01%	0.83%	20679065	0.77%	0.82%	0.18%	0.18%	15836368	7931071	3733691	1738217	23.18	9.00	0.23%	0.04%	0.97	0.000				83.6%	84.8%	94.0%	56.5M	53.3%	97.3%	13759.8Mb	120.2M	54.7%	97.8%	77.6%
659_dcz-T1-TRNA-1_A23MVY2LT4_2_1																																				121.6bp	96.3%	57.8M												84.5%	54%	151bp	151bp	18%	61.4M
659_dcz-T1-TRNA-1_A23MVY2LT4_2_2																																																		83.1%	54%	151bp	151bp	27%	61.4M
659_dcz-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		84.4%	54%	118bp	117bp	9%	60.1M	84.4%	54%	118bp	117bp	9%	60.1M
659_dcz-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		84.3%	54%	118bp	117bp	9%	60.1M	84.3%	54%	118bp	117bp	9%	60.1M
659_djb-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	145.5bp	136.0bp	0.02%	1.60%	0.56%	0.00%	0.04%	4.85%	0.86%	0.00%	0.03	510359414	0.9336	9999000000	236554736	527166558	0.01%	0.55%	238227941	0.93%	0.96%	0.06%	0.04%	220989926	111414575	13901882	5151834	418.83	183.00	0.71%	0.59%	0.98	0.000				55.2%	89.6%	95.7%	252.1M	39.6%	97.5%	67379.8Mb	527.2M	53.4%	98.6%	57.2%
659_djb-T1-TRNA-1_A23MVY2LT4_1_1																																				145.5bp	98.0%	258.4M												82.9%	52%	151bp	151bp	18%	267.4M
659_djb-T1-TRNA-1_A23MVY2LT4_1_2																																																		82.4%	53%	151bp	151bp	18%	267.4M
659_djb-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		82.9%	53%	131bp	142bp	9%	263.6M	82.9%	53%	131bp	142bp	9%	263.6M
659_djb-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		83.6%	53%	131bp	142bp	9%	263.6M	83.6%	53%	131bp	142bp	9%	263.6M
659_djb-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	136.3bp	127.0bp	0.01%	1.86%	0.63%	0.00%	0.03%	5.58%	1.00%	0.00%	0.03	569532470	0.9402	9999000000	145334186	589735726	0.01%	0.69%	180558576	0.91%	0.94%	0.07%	0.06%	163429949	82223547	13303614	5222696	290.04	120.00	0.67%	0.53%	0.98	0.000				69.8%	89.0%	95.5%	281.6M	49.3%	97.4%	72432.5Mb	589.7M	53.8%	98.3%	63.8%
659_djb-T1-TRNA-1_A23MVY2LT4_2_1																																				136.3bp	98.0%	289.0M												87.5%	53%	151bp	151bp	18%	336.1M
659_djb-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.1%	54%	151bp	151bp	18%	336.1M
659_djb-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.7%	53%	126bp	132bp	9%	294.9M	86.7%	53%	126bp	132bp	9%	294.9M
659_djb-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.7%	54%	126bp	132bp	9%	294.9M	86.7%	54%	126bp	132bp	9%	294.9M
659_dm4-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	131.9bp	126.0bp	0.01%	1.12%	0.27%	0.00%	0.03%	3.46%	0.46%	0.00%	6.38	321377341	0.8971	9999000000	82623177	336261552	0.01%	0.76%	80762386	0.86%	0.90%	0.11%	0.10%	69076845	34684624	9034736	3971426	111.50	49.00	0.59%	0.33%	0.98	0.000				76.6%	86.0%	94.3%	158.6M	55.6%	97.4%	41017.4Mb	336.3M	54.5%	98.4%	68.4%
659_dm4-T1-TRNA-1_A23MVY2LT4_1_1																																				131.9bp	97.0%	163.1M												83.8%	53%	151bp	151bp	18%	170.9M
659_dm4-T1-TRNA-1_A23MVY2LT4_1_2																																																		82.2%	54%	151bp	151bp	18%	170.9M
659_dm4-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		83.8%	54%	125bp	132bp	9%	168.1M	83.8%	54%	125bp	132bp	9%	168.1M
659_dm4-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		83.5%	54%	125bp	132bp	9%	168.1M	83.5%	54%	125bp	132bp	9%	168.1M
659_dm4-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	129.5bp	124.0bp	0.01%	1.27%	0.30%	0.00%	0.03%	3.91%	0.53%	0.00%	6.27	254364182	0.9163	9999000000	52672785	266778546	0.01%	0.83%	44532196	0.80%	0.86%	0.15%	0.14%	35686722	17896654	6721061	3029074	55.96	24.00	0.45%	0.15%	0.97	0.000				84.0%	85.1%	94.2%	125.6M	58.6%	97.3%	31951.4Mb	266.8M	55.4%	98.1%	70.0%
659_dm4-T1-TRNA-1_A23MVY2LT4_2_1																																				129.5bp	96.8%	129.1M												86.7%	54%	151bp	151bp	18%	136.0M
659_dm4-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.1%	55%	151bp	151bp	18%	136.0M
659_dm4-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.7%	55%	123bp	127bp	9%	133.4M	86.7%	55%	123bp	127bp	9%	133.4M
659_dm4-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.3%	55%	123bp	127bp	9%	133.4M	86.3%	55%	123bp	127bp	9%	133.4M
659_dts-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	144.5bp	136.0bp	0.01%	0.81%	0.45%	0.00%	0.01%	2.55%	0.69%	0.00%	6.07	519985963	0.9165	9999000000	193305133	539858052	0.01%	0.60%	217690041	0.92%	0.96%	0.06%	0.04%	200362999	101050932	13067478	4756064	371.80	188.00	0.75%	0.61%	0.97	0.000				60.2%	88.5%	95.2%	256.9M	43.8%	97.4%	68821.0Mb	539.9M	56.1%	98.5%	56.7%
659_dts-T1-TRNA-1_A23MVY2LT4_1_1																																				144.5bp	97.9%	264.3M												84.4%	55%	151bp	151bp	18%	274.0M
659_dts-T1-TRNA-1_A23MVY2LT4_1_2																																																		83.4%	56%	151bp	151bp	18%	274.0M
659_dts-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.4%	55%	131bp	142bp	9%	269.9M	84.4%	55%	131bp	142bp	9%	269.9M
659_dts-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.6%	56%	131bp	142bp	9%	269.9M	84.6%	56%	131bp	142bp	9%	269.9M
659_dts-T1-TRNA-1_A23MVY2LT4_2	Yes	0.12%	148.2bp	139.0bp	0.00%	0.91%	0.49%	0.00%	0.01%	2.88%	0.74%	0.00%	6.11	569286019	0.9375	9999000000	192477064	590586170	0.01%	0.65%	206234705	0.91%	0.95%	0.06%	0.05%	188637280	95233857	13152454	4724590	359.81	184.00	0.74%	0.61%	0.98	0.000				65.6%	88.8%	95.3%	281.3M	49.5%	97.4%	75815.3Mb	590.6M	55.5%	98.4%	54.7%
659_dts-T1-TRNA-1_A23MVY2LT4_2_1																																				148.2bp	97.8%	288.9M												88.2%	54%	151bp	151bp	18%	409.0M
659_dts-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.9%	55%	151bp	151bp	18%	409.0M
659_dts-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.0%	55%	132bp	142bp	9%	295.3M	86.0%	55%	132bp	142bp	9%	295.3M
659_dts-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.1%	55%	132bp	142bp	9%	295.3M	86.1%	55%	132bp	142bp	9%	295.3M
659_eHw-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	159.5bp	148.0bp	0.00%	0.47%	0.61%	0.00%	0.01%	1.69%	0.99%	0.00%	0.01	572403161	0.9487	9999000000	165349972	589586534	0.01%	0.69%	185676258	0.92%	0.96%	0.06%	0.04%	171470935	86564878	10715141	3526461	348.73	90.00	0.66%	0.48%	0.97	0.000				68.9%	90.4%	96.0%	283.1M	51.9%	97.1%	78171.2Mb	589.6M	60.9%	98.3%	45.0%
659_eHw-T1-TRNA-1_A23MVY2LT4_1_1																																				159.5bp	98.3%	289.8M												90.8%	59%	151bp	151bp	18%	483.1M
659_eHw-T1-TRNA-1_A23MVY2LT4_1_2																																																		89.1%	60%	151bp	151bp	18%	483.1M
659_eHw-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		88.1%	60%	136bp	151bp	9%	294.8M	88.1%	60%	136bp	151bp	9%	294.8M
659_eHw-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		88.1%	61%	137bp	151bp	9%	294.8M	88.1%	61%	137bp	151bp	9%	294.8M
659_eHw-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	154.2bp	142.0bp	0.00%	0.53%	0.68%	0.00%	0.01%	1.91%	1.12%	0.00%	0.00	571447303	0.9503	9990000000	121890925	589469544	0.01%	0.77%	137151646	0.91%	0.95%	0.07%	0.05%	124337406	62700526	9347350	3274852	244.98	61.00	0.61%	0.41%	0.97	0.000				77.2%	89.9%	95.9%	282.6M	58.1%	97.2%	76833.4Mb	589.5M	61.3%	98.2%	49.1%
659_eHw-T1-TRNA-1_A23MVY2LT4_2_1																																				154.2bp	98.3%	289.6M												91.7%	59%	151bp	151bp	18%	426.6M
659_eHw-T1-TRNA-1_A23MVY2LT4_2_2																																																		90.0%	60%	151bp	151bp	18%	426.6M
659_eHw-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		89.9%	60%	134bp	151bp	9%	294.7M	89.9%	60%	134bp	151bp	9%	294.7M
659_eHw-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		89.8%	61%	134bp	151bp	9%	294.7M	89.8%	61%	134bp	151bp	9%	294.7M
659_ecd-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	162.6bp	149.0bp	0.01%	0.73%	0.34%	0.00%	0.03%	2.33%	0.52%	0.00%	6.18	523163259	0.9007	9999000000	355461595	540181198	0.01%	0.45%	295726141	0.94%	0.97%	0.05%	0.03%	276890083	140292117	15918237	4970689	588.23	281.00	0.76%	0.65%	0.98	0.000				45.5%	90.1%	95.9%	259.0M	34.0%	97.5%	71736.0Mb	540.2M	54.4%	98.6%	43.9%
659_ecd-T1-TRNA-1_A23MVY2LT4_1_1																																				162.6bp	97.9%	264.5M												83.2%	53%	151bp	151bp	18%	273.9M
659_ecd-T1-TRNA-1_A23MVY2LT4_1_2																																																		82.6%	54%	151bp	151bp	18%	273.9M
659_ecd-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		83.2%	54%	136bp	151bp	9%	270.1M	83.2%	54%	136bp	151bp	9%	270.1M
659_ecd-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		83.7%	54%	136bp	151bp	9%	270.1M	83.7%	54%	136bp	151bp	9%	270.1M
659_ecd-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	177.5bp	161.0bp	0.01%	0.80%	0.38%	0.00%	0.02%	2.61%	0.59%	0.00%	6.14	441435255	0.9100	9999000000	308195964	455111232	0.01%	0.44%	253945574	0.94%	0.97%	0.05%	0.03%	237890511	120824118	13608953	3870026	533.15	245.00	0.75%	0.63%	0.97	0.000				44.4%	90.5%	96.0%	218.5M	33.9%	97.4%	61985.3Mb	455.1M	54.4%	98.5%	35.7%
659_ecd-T1-TRNA-1_A23MVY2LT4_2_1																																				177.5bp	97.8%	222.7M												82.1%	53%	151bp	151bp	18%	231.0M
659_ecd-T1-TRNA-1_A23MVY2LT4_2_2																																																		81.5%	54%	151bp	151bp	18%	231.0M
659_ecd-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		82.1%	53%	140bp	151bp	9%	227.6M	82.1%	53%	140bp	151bp	9%	227.6M
659_ecd-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		82.7%	54%	140bp	151bp	9%	227.6M	82.7%	54%	140bp	151bp	9%	227.6M
659_epP-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	166.3bp	154.0bp	0.00%	0.66%	0.34%	0.00%	0.01%	2.18%	0.55%	0.00%	0.01	563614865	0.9303	9999000000	206110032	589163522	0.01%	0.61%	228355632	0.92%	0.96%	0.06%	0.04%	209892378	106401802	14472177	4613840	438.69	205.00	0.73%	0.61%	0.97	0.000				61.7%	86.8%	94.6%	278.7M	47.6%	97.3%	79380.6Mb	589.2M	56.7%	98.2%	40.5%
659_epP-T1-TRNA-1_A23MVY2LT4_1_1																																				166.3bp	97.6%	287.5M												87.9%	55%	151bp	151bp	18%	420.8M
659_epP-T1-TRNA-1_A23MVY2LT4_1_2																																																		86.4%	56%	151bp	151bp	18%	420.8M
659_epP-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		85.4%	56%	138bp	151bp	9%	294.6M	85.4%	56%	138bp	151bp	9%	294.6M
659_epP-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		85.5%	57%	139bp	151bp	9%	294.6M	85.5%	57%	139bp	151bp	9%	294.6M
659_epP-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	167.1bp	154.0bp	0.00%	0.71%	0.37%	0.00%	0.01%	2.36%	0.59%	0.00%	0.01	561333539	0.9282	9999000000	144132200	588127636	0.01%	0.74%	153630121	0.90%	0.95%	0.08%	0.05%	137818016	69814260	11651960	3841612	282.29	123.00	0.68%	0.54%	0.97	0.000				74.4%	86.2%	94.4%	277.6M	59.5%	97.2%	79100.7Mb	588.1M	57.6%	98.0%	40.5%
659_epP-T1-TRNA-1_A23MVY2LT4_2_1																																				167.1bp	97.6%	287.0M												88.9%	56%	151bp	151bp	18%	336.9M
659_epP-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.9%	57%	151bp	151bp	18%	336.9M
659_epP-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		88.1%	57%	138bp	151bp	9%	294.1M	88.1%	57%	138bp	151bp	9%	294.1M
659_epP-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		87.7%	57%	138bp	151bp	9%	294.1M	87.7%	57%	138bp	151bp	9%	294.1M
659_ezg-T1-TRNA-1_A23MVY2LT4_1	Yes	0.00%	150.1bp	139.0bp	0.01%	1.50%	0.63%	0.00%	0.02%	4.57%	0.94%	0.00%	0.01	571713349	0.9424	9999000000	355721389	591792276	0.01%	0.48%	307247791	0.94%	0.97%	0.05%	0.03%	287935979	145489772	15634444	5154111	576.00	277.00	0.75%	0.64%	0.98	0.000				48.4%	89.0%	95.5%	282.6M	33.9%	97.4%	76309.0Mb	591.8M	54.9%	98.6%	52.4%
659_ezg-T1-TRNA-1_A23MVY2LT4_1_1																																				150.1bp	97.8%	289.5M												84.6%	54%	151bp	151bp	18%	362.0M
659_ezg-T1-TRNA-1_A23MVY2LT4_1_2																																																		84.0%	54%	151bp	151bp	18%	362.0M
659_ezg-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		83.2%	54%	132bp	147bp	9%	295.9M	83.2%	54%	132bp	147bp	9%	295.9M
659_ezg-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		83.8%	55%	132bp	147bp	9%	295.9M	83.8%	55%	132bp	147bp	9%	295.9M
659_ezg-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	157.2bp	146.0bp	0.01%	1.58%	0.67%	0.00%	0.02%	4.87%	1.01%	0.00%	0.01	570948814	0.9599	9999000000	234797500	590935182	0.01%	0.57%	254510161	0.93%	0.96%	0.06%	0.04%	236449202	119600400	14175938	4651053	480.08	223.00	0.73%	0.62%	0.98	0.000				57.3%	89.2%	95.5%	282.3M	43.0%	97.5%	77793.4Mb	590.9M	55.1%	98.5%	47.9%
659_ezg-T1-TRNA-1_A23MVY2LT4_2_1																																				157.2bp	97.7%	288.5M												87.9%	54%	151bp	151bp	18%	453.4M
659_ezg-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.7%	55%	151bp	151bp	18%	453.4M
659_ezg-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		85.0%	54%	135bp	151bp	9%	295.5M	85.0%	54%	135bp	151bp	9%	295.5M
659_ezg-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		85.3%	55%	135bp	151bp	9%	295.5M	85.3%	55%	135bp	151bp	9%	295.5M
659_gK-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	172.7bp	158.0bp	0.02%	1.27%	0.46%	0.00%	0.04%	4.08%	0.73%	0.00%	0.01	566244818	0.9494	9990000000	309133788	591381796	0.01%	0.51%	291517809	0.93%	0.97%	0.06%	0.03%	271720937	137984544	16304555	4776525	594.40	258.00	0.72%	0.62%	0.97	0.000				51.0%	88.0%	94.9%	280.6M	39.4%	97.4%	80166.6Mb	591.4M	54.3%	98.6%	38.1%
659_gK-T1-TRNA-1_A23MVY2LT4_1_1																																				172.7bp	97.9%	289.5M												85.8%	53%	151bp	151bp	18%	375.3M
659_gK-T1-TRNA-1_A23MVY2LT4_1_2																																																		85.2%	54%	151bp	151bp	18%	375.3M
659_gK-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		84.1%	53%	139bp	151bp	9%	295.7M	84.1%	53%	139bp	151bp	9%	295.7M
659_gK-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		84.8%	54%	139bp	151bp	9%	295.7M	84.8%	54%	139bp	151bp	9%	295.7M
659_gK-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	167.0bp	153.0bp	0.02%	1.46%	0.53%	0.00%	0.03%	4.61%	0.82%	0.00%	0.01	565890921	0.9609	9999000000	190851317	590827012	0.01%	0.62%	223857515	0.92%	0.96%	0.06%	0.04%	206134356	104675775	14152066	4426371	435.63	181.00	0.70%	0.58%	0.98	0.000				62.5%	88.0%	94.9%	280.5M	48.3%	97.4%	78906.1Mb	590.8M	54.7%	98.5%	42.0%
659_gK-T1-TRNA-1_A23MVY2LT4_2_1																																				167.0bp	97.9%	289.2M												87.8%	53%	151bp	151bp	18%	368.0M
659_gK-T1-TRNA-1_A23MVY2LT4_2_2																																																		86.6%	54%	151bp	151bp	18%	368.0M
659_gK-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		86.3%	54%	137bp	151bp	9%	295.4M	86.3%	54%	137bp	151bp	9%	295.4M
659_gK-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		86.4%	55%	137bp	151bp	9%	295.4M	86.4%	55%	137bp	151bp	9%	295.4M
659_rd-T1-TRNA-1_A23MVY2LT4_1	No	0.00%	171.2bp	157.0bp	0.00%	1.08%	0.28%	0.00%	0.01%	3.70%	0.48%	0.00%	6.69	461905879	0.9558	9999000000	385722251	473600946	0.01%	0.42%	272938635	0.94%	0.97%	0.05%	0.03%	255988191	129824715	14413839	4323955	560.55	244.00	0.75%	0.63%	0.98	0.000				42.6%	91.8%	96.3%	228.1M	32.2%	97.5%	63711.9Mb	473.6M	53.5%	98.6%	39.9%
659_rd-T1-TRNA-1_A23MVY2LT4_1_1																																				171.2bp	97.9%	231.7M												82.7%	52%	151bp	151bp	18%	240.1M
659_rd-T1-TRNA-1_A23MVY2LT4_1_2																																																		81.8%	53%	151bp	151bp	18%	240.1M
659_rd-T1-TRNA-1_A23MVY2LT4_1_trimmed_1																																																		82.7%	53%	138bp	151bp	9%	236.8M	82.7%	53%	138bp	151bp	9%	236.8M
659_rd-T1-TRNA-1_A23MVY2LT4_1_trimmed_2																																																		83.0%	53%	138bp	151bp	9%	236.8M	83.0%	53%	138bp	151bp	9%	236.8M
659_rd-T1-TRNA-1_A23MVY2LT4_2	No	0.00%	171.9bp	157.0bp	0.00%	1.19%	0.31%	0.00%	0.01%	4.11%	0.54%	0.00%	6.62	576581161	0.9656	9999000000	246877463	591224538	0.01%	0.56%	261621958	0.93%	0.96%	0.06%	0.04%	242516064	123193680	15870480	4878640	530.38	228.00	0.74%	0.63%	0.98	0.000				56.1%	91.9%	96.3%	284.8M	43.7%	97.5%	79778.4Mb	591.2M	54.0%	98.5%	38.7%
659_rd-T1-TRNA-1_A23MVY2LT4_2_1																																				171.9bp	97.8%	289.1M												86.9%	53%	151bp	151bp	18%	361.4M
659_rd-T1-TRNA-1_A23MVY2LT4_2_2																																																		85.9%	54%	151bp	151bp	18%	361.4M
659_rd-T1-TRNA-1_A23MVY2LT4_2_trimmed_1																																																		85.7%	53%	138bp	151bp	9%	295.6M	85.7%	53%	138bp	151bp	9%	295.6M
659_rd-T1-TRNA-1_A23MVY2LT4_2_trimmed_2																																																		85.7%	54%	138bp	151bp	9%	295.6M	85.7%	54%	138bp	151bp	9%	295.6M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1	Yes	62.22%	187.0bp	169.0bp	0.01%	1.69%	0.76%	0.00%	0.02%	4.97%	1.08%	0.00%	3.95	496266010	0.9604	9999000000	493532943	512573856	0.01%	0.39%	313257078	0.94%	0.98%	0.05%	0.02%	295440108	150143084	15002380	3733130	685.33	274.00	0.71%	0.62%	0.97	0.000				39.1%	90.6%	96.1%	246.2M	29.6%	97.3%	70181.3Mb	512.6M	54.8%	98.6%	32.5%
FFPE_HD789_01_RNA_13_A23MVY2LT4_1_1																																				187.0bp	98.0%	251.1M												83.7%	54%	151bp	151bp	18%	260.0M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1_2																																																		83.0%	55%	151bp	151bp	18%	260.0M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1_trimmed_1																																																		83.8%	54%	141bp	151bp	9%	256.3M	83.8%	54%	141bp	151bp	9%	256.3M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1_trimmed_2																																																		84.0%	55%	141bp	151bp	9%	256.3M	84.0%	55%	141bp	151bp	9%	256.3M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1	No	0.00%	177.8bp	163.0bp	0.01%	1.47%	0.98%	0.00%	0.02%	4.19%	1.36%	0.00%	6.83	570492025	0.9669	9999000000	314567026	590505074	0.01%	0.51%	286589377	0.93%	0.97%	0.06%	0.03%	265759634	135269748	16769580	4743714	590.46	151.00	0.61%	0.53%	0.97	0.000				51.8%	89.9%	95.8%	282.8M	39.8%	97.3%	80720.6Mb	590.5M	54.3%	98.4%	34.4%
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1_1																																				177.8bp	96.8%	285.9M												86.5%	53%	151bp	151bp	18%	346.8M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1_2																																																		86.0%	54%	151bp	151bp	18%	346.8M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1_trimmed_1																																																		85.6%	53%	140bp	151bp	9%	295.3M	85.6%	53%	140bp	151bp	9%	295.3M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1_trimmed_2																																																		86.2%	54%	141bp	151bp	9%	295.3M	86.2%	54%	141bp	151bp	9%	295.3M
NTC_0001_0001_A23MVY2LT4_1	Skipped	N/A%	81.2bp	72.0bp	0.00%	3.80%	3.80%	0.00%	0.00%	9.89%	9.89%	0.00%	0.00	179	0.4059	9999000000	1993	1682	0.63%	0.15%	1432	0.04%	0.19%	0.22%	0.81%	63	34	315	149	0.00	0.00	0.00%	0.00%	0.93	0.000				39.8%	2.9%	9.4%	0.0M	44.0%	88.5%	0.2Mb	0.0M	71.3%	2.5%	50.1%
NTC_0001_0001_A23MVY2LT4_1_1																																				81.2bp	9.5%	0.0M												97.0%	76%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23MVY2LT4_1_2																																																		95.4%	98%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23MVY2LT4_1_trimmed_1																																																		35.0%	67%	108bp	137bp	45%	0.0M	35.0%	67%	108bp	137bp	45%	0.0M
NTC_0001_0001_A23MVY2LT4_1_trimmed_2																																																		42.9%	75%	110bp	142bp	45%	0.0M	42.9%	75%	110bp	142bp	45%	0.0M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1	No	0.00%	143.4bp	135.0bp	0.01%	1.32%	0.61%	0.00%	0.02%	4.18%	0.90%	0.00%	0.01	575608766	0.9527	9999000000	267930339	591596850	0.01%	0.55%	267293152	0.94%	0.96%	0.05%	0.04%	250362333	126279743	13813898	4787892	474.66	197.00	0.71%	0.60%	0.98	0.000				55.1%	90.6%	96.0%	284.0M	38.3%	97.6%	75019.9Mb	591.6M	54.3%	98.6%	57.8%
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1_1																																				143.4bp	98.3%	290.7M												86.5%	53%	151bp	151bp	18%	391.3M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1_2																																																		85.2%	54%	151bp	151bp	18%	391.3M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																		84.6%	53%	130bp	142bp	9%	295.8M	84.6%	53%	130bp	142bp	9%	295.8M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																		84.4%	54%	130bp	142bp	9%	295.8M	84.4%	54%	130bp	142bp	9%	295.8M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1	No	0.00%	130.1bp	124.0bp	0.01%	0.98%	0.80%	0.00%	0.03%	3.09%	1.15%	0.00%	6.28	564511035	0.9585	9999000000	140801160	581201710	0.01%	0.72%	162166354	0.91%	0.95%	0.07%	0.05%	147754102	74203312	10697616	4249465	247.81	92.00	0.64%	0.49%	0.98	0.000				72.6%	89.8%	95.7%	278.0M	49.0%	97.4%	70271.8Mb	581.2M	54.7%	98.3%	69.1%
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1_1																																				130.1bp	98.2%	285.3M												86.4%	53%	151bp	151bp	18%	295.6M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1_2																																																		85.2%	54%	151bp	151bp	18%	295.6M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																		86.4%	54%	124bp	127bp	9%	290.6M	86.4%	54%	124bp	127bp	9%	290.6M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																		86.5%	54%	124bp	127bp	9%	290.6M	86.5%	54%	124bp	127bp	9%	290.6M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1	No	0.00%	145.1bp	136.0bp	0.01%	1.11%	0.64%	0.00%	0.02%	3.55%	0.95%	0.00%	6.48	573931179	0.9588	9999000000	209072602	590790674	0.01%	0.61%	232609886	0.93%	0.96%	0.06%	0.04%	215751774	108837206	13361963	4763109	411.00	167.00	0.70%	0.58%	0.98	0.000				61.0%	90.3%	95.9%	283.3M	43.8%	97.5%	75569.2Mb	590.8M	54.4%	98.5%	55.9%
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1_1																																				145.1bp	98.1%	289.7M												87.2%	53%	151bp	151bp	18%	396.1M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1_2																																																		85.8%	54%	151bp	151bp	18%	396.1M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1_trimmed_1																																																		85.2%	54%	131bp	142bp	9%	295.4M	85.2%	54%	131bp	142bp	9%	295.4M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1_trimmed_2																																																		85.1%	54%	131bp	142bp	9%	295.4M	85.1%	54%	131bp	142bp	9%	295.4M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1	No	0.00%	136.2bp	130.0bp	0.01%	1.11%	0.70%	0.00%	0.02%	3.55%	1.04%	0.00%	0.08	573020049	0.9399	9999000000	143099493	590118030	0.01%	0.73%	156936191	0.91%	0.95%	0.07%	0.05%	143058327	71905242	10325682	3957900	251.12	106.00	0.67%	0.51%	0.97	0.000				73.9%	90.2%	95.9%	282.9M	51.9%	97.2%	73084.4Mb	590.1M	54.7%	98.4%	63.7%
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1_1																																				136.2bp	98.3%	290.1M												89.2%	54%	151bp	151bp	18%	376.0M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1_2																																																		87.5%	54%	151bp	151bp	18%	376.0M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1_trimmed_1																																																		87.8%	54%	127bp	132bp	9%	295.1M	87.8%	54%	127bp	132bp	9%	295.1M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1_trimmed_2																																																		87.3%	55%	127bp	132bp	9%	295.1M	87.3%	55%	127bp	132bp	9%	295.1M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1	No	0.00%	131.8bp	125.0bp	0.04%	0.93%	0.48%	0.00%	0.08%	2.71%	0.70%	0.00%	5.93	570115094	0.9260	9999000000	110205394	589218222	0.01%	0.77%	136378033	0.90%	0.94%	0.07%	0.06%	123089127	61843372	9383360	3672672	208.92	92.00	0.67%	0.48%	0.98	0.000				77.4%	89.4%	95.4%	281.2M	57.0%	97.4%	71708.3Mb	589.2M	54.4%	98.2%	66.9%
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1_1																																				131.8bp	98.2%	289.3M												88.7%	53%	151bp	151bp	18%	343.3M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1_2																																																		87.1%	54%	151bp	151bp	18%	343.3M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																		87.8%	54%	125bp	132bp	9%	294.6M	87.8%	54%	125bp	132bp	9%	294.6M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																		87.6%	54%	125bp	132bp	9%	294.6M	87.6%	54%	125bp	132bp	9%	294.6M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1	No	0.00%	140.5bp	133.0bp	0.01%	0.62%	0.35%	0.00%	0.02%	2.11%	0.57%	0.00%	0.09	500611230	0.9697	9999000000	188477457	523873694	0.01%	0.60%	210725942	0.93%	0.96%	0.06%	0.04%	195136194	98249155	11936768	4396448	360.45	181.00	0.74%	0.61%	0.98	0.000				60.2%	87.0%	94.5%	247.5M	43.4%	97.4%	66216.9Mb	523.9M	55.4%	98.4%	59.4%
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1_1																																				140.5bp	98.2%	257.2M												84.5%	54%	151bp	151bp	18%	266.2M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1_2																																																		82.9%	55%	151bp	151bp	18%	266.2M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																		84.5%	55%	130bp	137bp	9%	261.9M	84.5%	55%	130bp	137bp	9%	261.9M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																		84.2%	55%	130bp	137bp	9%	261.9M	84.2%	55%	130bp	137bp	9%	261.9M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1	No	0.00%	143.5bp	135.0bp	0.01%	0.46%	0.33%	0.00%	0.01%	1.62%	0.56%	0.00%	0.01	556411964	0.9564	9999000000	151989892	589261720	0.01%	0.70%	177284433	0.90%	0.95%	0.07%	0.05%	159804364	80515073	11635446	4298157	297.74	143.00	0.72%	0.57%	0.97	0.000				70.6%	84.7%	93.4%	275.3M	51.3%	97.3%	74954.7Mb	589.3M	57.5%	98.2%	56.5%
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1_1																																				143.5bp	97.9%	288.6M												88.5%	56%	151bp	151bp	18%	364.0M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1_2																																																		86.8%	57%	151bp	151bp	27%	364.0M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																		87.1%	57%	131bp	142bp	18%	294.6M	87.1%	57%	131bp	142bp	18%	294.6M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																		86.9%	57%	131bp	142bp	18%	294.6M	86.9%	57%	131bp	142bp	18%	294.6M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1	No	0.00%	117.4bp	114.0bp	0.07%	0.67%	0.31%	0.00%	0.14%	1.91%	0.44%	0.00%	6.06	211965309	0.9641	9999000000	41069821	220127548	0.01%	0.82%	40042751	0.85%	0.90%	0.11%	0.10%	34100284	17068194	4348347	1912315	48.95	21.00	0.43%	0.13%	0.97	0.000				82.4%	87.2%	95.0%	104.5M	51.1%	97.3%	24771.9Mb	220.1M	54.9%	98.0%	80.5%
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1_1																																				117.4bp	97.7%	107.5M												86.0%	54%	151bp	151bp	18%	112.3M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1_2																																																		84.6%	55%	151bp	151bp	27%	112.3M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																		86.0%	54%	115bp	117bp	9%	110.1M	86.0%	54%	115bp	117bp	9%	110.1M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																		85.9%	55%	116bp	117bp	9%	110.1M	85.9%	55%	116bp	117bp	9%	110.1M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1	No	0.00%	125.3bp	120.0bp	0.02%	0.46%	0.55%	0.00%	0.03%	1.29%	0.79%	0.00%	5.09	532874860	0.9454	9999000000	74604231	557404190	0.01%	0.86%	78246677	0.82%	0.89%	0.12%	0.11%	63859710	32029863	9593228	4136212	99.02	25.00	0.47%	0.24%	0.97	0.000				86.7%	85.9%	94.5%	263.4M	58.4%	97.1%	65633.8Mb	557.4M	60.7%	97.9%	72.3%
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1_1																																				125.3bp	97.4%	271.4M												90.4%	58%	151bp	151bp	18%	284.6M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1_2																																																		88.6%	59%	151bp	151bp	18%	284.6M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																		90.5%	60%	121bp	122bp	9%	278.7M	90.5%	60%	121bp	122bp	9%	278.7M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																		90.1%	60%	121bp	127bp	9%	278.7M	90.1%	60%	121bp	127bp	9%	278.7M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1	No	0.00%	107.7bp	105.0bp	0.04%	0.70%	0.44%	0.00%	0.08%	1.90%	0.62%	0.00%	5.85	29035580	0.9541	9999000000	6221904	30609244	0.01%	0.82%	5595717	0.82%	0.88%	0.13%	0.12%	4609235	2303496	704224	315636	5.99	1.00	0.04%	0.01%	0.97	0.000				82.5%	82.9%	93.5%	14.3M	45.2%	97.1%	3208.1Mb	30.6M	58.3%	95.0%	86.0%
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_1																																				107.7bp	97.0%	14.8M												83.0%	57%	151bp	151bp	36%	16.1M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_2																																																		81.0%	58%	151bp	151bp	36%	16.1M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_trimmed_1																																																		82.5%	58%	108bp	107bp	9%	15.3M	82.5%	58%	108bp	107bp	9%	15.3M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1_trimmed_2																																																		82.0%	58%	108bp	107bp	9%	15.3M	82.0%	58%	108bp	107bp	9%	15.3M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1	No	0.00%	133.9bp	127.0bp	0.02%	1.61%	0.28%	0.00%	0.03%	3.57%	0.38%	0.00%	0.01	429920456	0.9739	9999000000	58644573	461742130	0.01%	0.86%	64824812	0.84%	0.91%	0.10%	0.09%	54653854	27445528	6669365	2790304	92.22	29.00	0.50%	0.23%	0.97	0.000				86.6%	81.5%	92.0%	212.5M	60.3%	97.3%	56452.5Mb	461.7M	53.9%	98.2%	66.4%
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1_1																																				133.9bp	97.1%	224.2M												90.7%	53%	151bp	151bp	27%	235.1M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1_2																																																		88.8%	54%	151bp	151bp	18%	235.1M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																		90.7%	53%	126bp	132bp	9%	230.9M	90.7%	53%	126bp	132bp	9%	230.9M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																		90.2%	54%	126bp	132bp	9%	230.9M	90.2%	54%	126bp	132bp	9%	230.9M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1	No	0.00%	125.6bp	120.0bp	0.02%	1.15%	0.23%	0.00%	0.04%	2.71%	0.31%	0.00%	5.70	416258179	0.9674	9999000000	60087708	446469968	0.01%	0.86%	61797160	0.81%	0.89%	0.12%	0.11%	50067171	25086417	7425565	3239179	78.37	29.00	0.50%	0.20%	0.97	0.000				87.0%	80.6%	92.0%	205.3M	56.4%	97.1%	52582.9Mb	446.5M	54.6%	98.2%	73.7%
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1_1																																				125.6bp	97.0%	216.6M												90.0%	54%	151bp	151bp	18%	227.3M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1_2																																																		88.2%	54%	151bp	151bp	18%	227.3M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																		90.1%	54%	121bp	122bp	9%	223.2M	90.1%	54%	121bp	122bp	9%	223.2M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																		89.5%	54%	121bp	122bp	9%	223.2M	89.5%	54%	121bp	122bp	9%	223.2M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1	No	0.00%	133.9bp	126.0bp	0.01%	2.13%	0.47%	0.00%	0.01%	5.21%	0.65%	0.00%	5.86	539973790	0.9744	9999000000	145763366	562945688	0.01%	0.68%	181484166	0.92%	0.95%	0.06%	0.05%	166858062	83899157	10818305	4104017	292.57	120.00	0.68%	0.53%	0.98	0.000				68.2%	87.7%	94.8%	266.9M	46.1%	97.4%	68845.7Mb	562.9M	53.7%	98.3%	66.4%
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1_1																																				133.9bp	97.8%	275.3M												85.1%	53%	151bp	151bp	18%	286.2M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1_2																																																		83.6%	53%	151bp	151bp	27%	286.2M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1_trimmed_1																																																		85.1%	53%	125bp	132bp	9%	281.5M	85.1%	53%	125bp	132bp	9%	281.5M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1_trimmed_2																																																		84.9%	53%	126bp	132bp	9%	281.5M	84.9%	53%	126bp	132bp	9%	281.5M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1	No	0.00%	127.5bp	121.0bp	0.01%	1.19%	0.45%	0.00%	0.03%	3.61%	0.70%	0.00%	6.31	513973521	0.9393	9999000000	124133890	531990824	0.01%	0.75%	134402616	0.89%	0.92%	0.09%	0.08%	119388667	59935219	11523256	4863982	192.65	99.00	0.69%	0.50%	0.98	0.000				75.2%	88.8%	95.4%	253.7M	53.8%	97.5%	63358.5Mb	532.0M	53.9%	98.2%	71.0%
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1_1																																				127.5bp	97.7%	259.9M												85.7%	53%	151bp	151bp	18%	270.7M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1_2																																																		84.5%	53%	151bp	151bp	18%	270.7M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																		85.8%	53%	122bp	127bp	9%	266.0M	85.8%	53%	122bp	127bp	9%	266.0M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																		85.8%	54%	122bp	127bp	9%	266.0M	85.8%	54%	122bp	127bp	9%	266.0M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1	No	0.00%	146.1bp	138.0bp	0.03%	0.73%	0.27%	0.00%	0.07%	2.14%	0.40%	0.00%	0.04	558676453	0.9520	9999000000	140476655	590423964	0.01%	0.71%	170339723	0.90%	0.95%	0.07%	0.05%	153532138	77400363	11771102	4415414	287.08	132.00	0.70%	0.55%	0.98	0.000				71.8%	85.1%	93.6%	276.2M	52.6%	97.4%	75718.7Mb	590.4M	55.5%	98.4%	55.8%
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1_1																																				146.1bp	97.9%	288.9M												87.0%	54%	151bp	151bp	18%	303.3M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1_2																																																		85.6%	55%	151bp	151bp	18%	303.3M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1_trimmed_1																																																		87.0%	55%	132bp	142bp	9%	295.2M	87.0%	55%	132bp	142bp	9%	295.2M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1_trimmed_2																																																		86.8%	55%	132bp	142bp	9%	295.2M	86.8%	55%	132bp	142bp	9%	295.2M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1	No	0.00%	154.0bp	143.0bp	0.03%	0.77%	0.28%	0.00%	0.06%	2.31%	0.42%	0.00%	6.26	313203563	0.9678	9999000000	134894619	331671720	0.01%	0.57%	143587602	0.92%	0.96%	0.06%	0.04%	132730244	67017579	8046006	2739352	263.82	119.00	0.69%	0.53%	0.97	0.000				57.2%	84.8%	93.5%	155.0M	41.5%	97.3%	43409.9Mb	331.7M	55.3%	98.4%	49.7%
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1_1																																				154.0bp	97.8%	162.1M												81.8%	54%	151bp	151bp	18%	168.6M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1_2																																																		80.5%	55%	151bp	151bp	18%	168.6M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1_trimmed_1																																																		81.8%	55%	134bp	151bp	9%	165.8M	81.8%	55%	134bp	151bp	9%	165.8M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1_trimmed_2																																																		81.7%	55%	135bp	151bp	9%	165.8M	81.7%	55%	135bp	151bp	9%	165.8M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1	No	0.00%	143.4bp	135.0bp	0.03%	0.99%	0.48%	0.00%	0.05%	2.80%	0.66%	0.00%	6.43	565989784	0.9667	9999000000	174431406	589872634	0.01%	0.65%	205976336	0.93%	0.96%	0.06%	0.04%	190656428	96021517	11394865	4044154	353.41	146.00	0.69%	0.56%	0.98	0.000				65.5%	87.9%	94.8%	279.5M	45.8%	97.4%	74765.4Mb	589.9M	53.6%	98.3%	58.5%
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1_1																																				143.4bp	98.1%	289.4M												86.2%	52%	151bp	151bp	18%	334.1M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1_2																																																		84.9%	54%	151bp	151bp	18%	334.1M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1_trimmed_1																																																		85.4%	53%	130bp	142bp	9%	294.9M	85.4%	53%	130bp	142bp	9%	294.9M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1_trimmed_2																																																		85.4%	53%	130bp	142bp	9%	294.9M	85.4%	53%	130bp	142bp	9%	294.9M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Expression QC	ChrY Signature Score	Mean log2(TPM+1) score for chrY signature genes; used for sex verification.	`score_log2tpm1_mean_chry_signature`	None
\|\|	Custom content: RSeQC	Unique Reads	Reads with mapq >= mapq_cut (uniquely mapped)	`unique_reads_rseqc`	None
\|\|	Custom content: RSeQC	Frac Antisense	Fraction of reads explained by antisense orientation (1+-,1-+,2++,2--)	`frac_antisense`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
659_6i-T1-TRNA-1_A23MVY2LT4_1	401.0M	0.0M	0.0M	29.3M	2.7M	356.8M	178.5M	178.3M	178.4M	178.4M	197.9M	158.9M	355.1M	0.0M
659_6i-T1-TRNA-1_A23MVY2LT4_2	440.5M	0.0M	0.0M	33.4M	2.9M	390.3M	195.3M	195.0M	195.2M	195.1M	217.8M	172.5M	388.6M	0.0M
659_Dl-T1-TRNA-1_A23MVY2LT4_1	500.2M	0.0M	0.0M	46.7M	3.7M	430.3M	215.3M	215.0M	215.2M	215.1M	237.8M	192.5M	428.8M	0.0M
659_Dl-T1-TRNA-1_A23MVY2LT4_2	374.3M	0.0M	0.0M	35.7M	2.8M	320.9M	160.6M	160.4M	160.5M	160.4M	177.0M	144.0M	319.8M	0.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_1	505.2M	0.0M	0.0M	30.0M	2.6M	459.4M	229.8M	229.6M	229.8M	229.7M	235.6M	223.9M	457.3M	0.0M
659_Lx-T1-TRNA-1_A23MVY2LT4_2	562.0M	0.0M	0.0M	33.4M	2.9M	511.2M	255.7M	255.5M	255.7M	255.6M	260.5M	250.7M	508.9M	0.0M
659_Mt-T1-TRNA-1_A23MVY2LT4_1	450.3M	0.0M	0.0M	37.7M	2.8M	394.0M	197.2M	196.9M	197.1M	197.0M	209.6M	184.4M	392.5M	0.0M
659_Mt-T1-TRNA-1_A23MVY2LT4_2	536.3M	0.0M	0.0M	46.6M	3.2M	467.0M	233.7M	233.4M	233.6M	233.4M	250.5M	216.5M	465.3M	0.0M
659_bCu-T1-TRNA-1_A23MVY2LT4_1	530.3M	0.0M	0.0M	45.3M	4.1M	463.3M	231.8M	231.4M	231.7M	231.6M	279.5M	183.7M	461.4M	0.0M
659_bCu-T1-TRNA-1_A23MVY2LT4_2	235.5M	0.0M	0.0M	19.9M	1.8M	205.9M	103.0M	102.9M	103.0M	102.9M	121.5M	84.4M	205.1M	0.0M
659_bGW-T1-TRNA-1_A23MVY2LT4_1	636.2M	0.0M	0.0M	42.8M	3.5M	570.4M	285.4M	285.0M	285.3M	285.1M	265.3M	305.1M	568.0M	0.0M
659_bGW-T1-TRNA-1_A23MVY2LT4_2	637.8M	0.0M	0.0M	44.2M	3.6M	570.1M	285.2M	284.9M	285.1M	285.0M	266.7M	303.4M	567.8M	0.0M
659_bGc-T1-TRNA-1_A23MVY2LT4_1	629.8M	0.0M	0.0M	36.8M	3.8M	572.8M	286.6M	286.3M	286.5M	286.4M	293.3M	279.6M	570.5M	0.0M
659_bGc-T1-TRNA-1_A23MVY2LT4_2	628.5M	0.0M	0.0M	35.2M	3.8M	573.6M	286.9M	286.7M	286.9M	286.7M	287.0M	286.6M	571.3M	0.0M
659_bNS-T1-TRNA-1_A23MVY2LT4_1	630.2M	0.0M	0.0M	37.7M	3.7M	571.3M	285.7M	285.6M	285.7M	285.6M	269.0M	302.2M	568.9M	0.0M
659_bNS-T1-TRNA-1_A23MVY2LT4_2	628.9M	0.0M	0.0M	36.0M	3.5M	572.2M	286.2M	286.0M	286.2M	286.0M	268.3M	303.9M	570.0M	0.0M
659_bQZ-T1-TRNA-1_A23MVY2LT4_1	582.6M	0.0M	0.0M	40.1M	4.6M	519.7M	260.0M	259.7M	259.9M	259.8M	253.2M	266.5M	517.7M	0.0M
659_bQZ-T1-TRNA-1_A23MVY2LT4_2	636.0M	0.0M	0.0M	43.2M	4.4M	568.6M	284.4M	284.1M	284.4M	284.2M	272.3M	296.3M	566.4M	0.0M
659_bTo-T1-TRNA-1_A23MVY2LT4_1	621.6M	0.0M	0.0M	27.9M	2.9M	577.1M	288.7M	288.4M	288.6M	288.4M	254.4M	322.7M	574.9M	0.0M
659_bTo-T1-TRNA-1_A23MVY2LT4_2	620.2M	0.0M	0.0M	28.7M	3.1M	574.3M	287.3M	287.0M	287.2M	287.0M	253.4M	320.8M	572.1M	0.0M
659_bUW-T1-TRNA-1_A23MVY2LT4_1	348.3M	0.0M	0.0M	34.2M	2.0M	295.0M	147.6M	147.4M	147.5M	147.5M	131.8M	163.2M	293.9M	0.0M
659_bUW-T1-TRNA-1_A23MVY2LT4_2	656.8M	0.0M	0.0M	62.8M	3.5M	558.8M	279.5M	279.3M	279.4M	279.4M	249.1M	309.7M	556.8M	0.0M
659_bhK-T1-TRNA-1_A23MVY2LT4_1	621.7M	0.0M	0.0M	29.0M	3.5M	575.3M	287.8M	287.5M	287.8M	287.5M	259.6M	315.6M	573.3M	0.0M
659_bhK-T1-TRNA-1_A23MVY2LT4_2	621.0M	0.0M	0.0M	28.3M	3.5M	575.6M	287.9M	287.7M	287.9M	287.7M	251.9M	323.6M	573.7M	0.0M
659_buD-T1-TRNA-1_A23MVY2LT4_1	632.4M	0.0M	0.0M	38.7M	3.9M	572.5M	286.4M	286.1M	286.3M	286.2M	273.8M	298.7M	570.1M	0.0M
659_buD-T1-TRNA-1_A23MVY2LT4_2	478.3M	0.0M	0.0M	28.8M	2.9M	433.7M	217.0M	216.8M	216.9M	216.8M	205.2M	228.5M	432.0M	0.0M
659_bua-T1-TRNA-1_A23MVY2LT4_1	626.8M	0.0M	0.0M	32.9M	3.2M	575.2M	287.8M	287.4M	287.7M	287.5M	284.1M	291.1M	573.0M	0.0M
659_bua-T1-TRNA-1_A23MVY2LT4_2	626.6M	0.0M	0.0M	33.2M	3.3M	574.7M	287.5M	287.2M	287.4M	287.3M	278.0M	296.7M	572.6M	0.0M
659_c95-T1-TRNA-1_A23MVY2LT4_1	637.3M	0.0M	0.0M	43.6M	3.6M	571.7M	286.0M	285.7M	285.9M	285.8M	268.2M	303.6M	569.6M	0.0M
659_c95-T1-TRNA-1_A23MVY2LT4_2	624.9M	0.0M	0.0M	42.8M	3.6M	560.6M	280.4M	280.2M	280.3M	280.2M	260.5M	300.1M	558.5M	0.0M
659_cAd-T1-TRNA-1_A23MVY2LT4_1	578.0M	0.0M	0.0M	40.6M	4.1M	516.0M	258.2M	257.8M	258.1M	257.9M	267.8M	248.1M	513.8M	0.0M
659_cAd-T1-TRNA-1_A23MVY2LT4_2	637.3M	0.0M	0.0M	44.7M	4.6M	568.6M	284.5M	284.1M	284.4M	284.2M	293.9M	274.7M	566.3M	0.0M
659_cIX-T1-TRNA-1_A23MVY2LT4_1	618.7M	0.0M	0.0M	31.4M	3.0M	570.1M	285.2M	284.9M	285.1M	285.0M	271.9M	298.1M	567.9M	0.0M
659_cIX-T1-TRNA-1_A23MVY2LT4_2	625.0M	0.0M	0.0M	31.9M	3.1M	575.5M	287.9M	287.6M	287.8M	287.7M	275.9M	299.6M	573.4M	0.0M
659_cRB-T1-TRNA-1_A23MVY2LT4_1	515.3M	0.0M	0.0M	34.9M	3.3M	462.8M	231.6M	231.2M	231.5M	231.3M	234.3M	228.5M	460.5M	0.0M
659_cRB-T1-TRNA-1_A23MVY2LT4_2	610.7M	0.0M	0.0M	40.4M	3.8M	549.7M	275.0M	274.6M	275.0M	274.7M	270.3M	279.4M	547.1M	0.0M
659_cRa-T1-TRNA-1_A23MVY2LT4_1	627.1M	0.0M	0.0M	33.5M	3.6M	574.9M	287.6M	287.3M	287.6M	287.3M	245.6M	329.3M	572.7M	0.0M
659_cRa-T1-TRNA-1_A23MVY2LT4_2	626.3M	0.0M	0.0M	33.6M	3.7M	573.8M	287.1M	286.7M	287.0M	286.7M	237.9M	335.9M	571.6M	0.0M
659_cTi-T1-TRNA-1_A23MVY2LT4_1	631.1M	0.0M	0.0M	37.2M	4.0M	572.6M	286.4M	286.2M	286.4M	286.2M	270.2M	302.3M	570.2M	0.0M
659_cTi-T1-TRNA-1_A23MVY2LT4_2	628.1M	0.0M	0.0M	34.3M	4.3M	573.3M	286.7M	286.5M	286.7M	286.6M	257.7M	315.6M	570.9M	0.0M
659_cVw-T1-TRNA-1_A23MVY2LT4_1	638.5M	0.0M	0.0M	45.6M	3.9M	567.7M	283.9M	283.7M	283.9M	283.8M	279.1M	288.5M	565.8M	0.0M
659_cVw-T1-TRNA-1_A23MVY2LT4_2	637.4M	0.0M	0.0M	45.0M	3.9M	567.4M	283.8M	283.6M	283.7M	283.7M	275.7M	291.7M	565.6M	0.0M
659_cWx-T1-TRNA-1_A23MVY2LT4_1	644.6M	0.0M	0.0M	54.0M	4.2M	563.7M	282.0M	281.7M	281.9M	281.8M	297.6M	266.1M	561.6M	0.0M
659_cWx-T1-TRNA-1_A23MVY2LT4_2	610.6M	0.0M	0.0M	48.9M	3.9M	536.9M	268.6M	268.3M	268.5M	268.4M	275.7M	261.1M	534.9M	0.0M
659_cfy-T1-TRNA-1_A23MVY2LT4_1	625.5M	0.0M	0.0M	32.1M	2.9M	575.4M	287.8M	287.6M	287.8M	287.6M	265.0M	310.5M	573.1M	0.0M
659_cfy-T1-TRNA-1_A23MVY2LT4_2	625.0M	0.0M	0.0M	33.9M	3.1M	572.1M	286.2M	286.0M	286.1M	286.0M	266.2M	305.9M	569.9M	0.0M
659_ciJ-T1-TRNA-1_A23MVY2LT4_1	631.0M	0.0M	0.0M	38.0M	4.0M	571.7M	286.0M	285.7M	285.9M	285.8M	287.8M	283.9M	569.5M	0.0M
659_ciJ-T1-TRNA-1_A23MVY2LT4_2	629.5M	0.0M	0.0M	36.6M	3.9M	572.0M	286.1M	285.9M	286.1M	286.0M	282.5M	289.6M	569.9M	0.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_1	639.6M	0.0M	0.0M	45.4M	3.8M	570.1M	285.2M	284.9M	285.1M	285.0M	287.9M	282.2M	567.5M	0.0M
659_ciZ-T1-TRNA-1_A23MVY2LT4_2	640.8M	0.0M	0.0M	47.2M	3.7M	568.7M	284.5M	284.2M	284.4M	284.3M	295.2M	273.5M	566.2M	0.0M
659_d01-T1-TRNA-1_A23MVY2LT4_1	591.6M	0.0M	0.0M	39.3M	3.5M	531.3M	265.8M	265.5M	265.7M	265.6M	294.7M	236.6M	529.4M	0.0M
659_d01-T1-TRNA-1_A23MVY2LT4_2	452.0M	0.0M	0.0M	29.6M	2.6M	406.5M	203.4M	203.2M	203.3M	203.2M	221.5M	185.1M	405.1M	0.0M
659_dES-T1-TRNA-1_A23MVY2LT4_1	640.5M	0.0M	0.0M	46.2M	3.9M	570.5M	285.5M	285.1M	285.3M	285.2M	282.2M	288.3M	568.2M	0.0M
659_dES-T1-TRNA-1_A23MVY2LT4_2	556.7M	0.0M	0.0M	40.4M	3.4M	495.4M	247.9M	247.6M	247.7M	247.7M	246.3M	249.1M	493.5M	0.0M
659_dc8-T1-TRNA-1_A23MVY2LT4_1	634.7M	0.0M	0.0M	41.6M	3.6M	570.5M	285.4M	285.1M	285.3M	285.2M	279.6M	290.8M	568.2M	0.0M
659_dc8-T1-TRNA-1_A23MVY2LT4_2	636.2M	0.0M	0.0M	43.1M	3.7M	569.7M	285.0M	284.7M	284.9M	284.8M	279.6M	290.1M	567.5M	0.0M
659_dcz-T1-TRNA-1_A23MVY2LT4_1	200.9M	0.0M	0.0M	19.9M	1.7M	171.5M	85.8M	85.7M	85.8M	85.7M	107.5M	64.0M	170.7M	0.0M
659_dcz-T1-TRNA-1_A23MVY2LT4_2	134.2M	0.0M	0.0M	13.5M	1.1M	114.3M	57.2M	57.1M	57.1M	57.1M	72.3M	42.0M	113.8M	0.0M
659_djb-T1-TRNA-1_A23MVY2LT4_1	567.1M	0.0M	0.0M	37.4M	3.3M	510.4M	255.3M	255.0M	255.2M	255.1M	249.3M	261.1M	508.2M	0.0M
659_djb-T1-TRNA-1_A23MVY2LT4_2	637.2M	0.0M	0.0M	44.8M	3.8M	569.5M	284.9M	284.6M	284.9M	284.7M	285.1M	284.4M	567.2M	0.0M
659_dm4-T1-TRNA-1_A23MVY2LT4_1	372.2M	0.0M	0.0M	34.1M	2.7M	321.4M	160.8M	160.5M	160.7M	160.7M	194.9M	126.5M	319.9M	0.0M
659_dm4-T1-TRNA-1_A23MVY2LT4_2	297.5M	0.0M	0.0M	29.3M	2.1M	254.4M	127.3M	127.1M	127.2M	127.2M	156.4M	98.0M	253.3M	0.0M
659_dts-T1-TRNA-1_A23MVY2LT4_1	584.8M	0.0M	0.0M	42.4M	4.3M	520.0M	260.1M	259.9M	260.1M	259.9M	268.3M	251.7M	517.8M	0.0M
659_dts-T1-TRNA-1_A23MVY2LT4_2	638.2M	0.0M	0.0M	44.8M	4.4M	569.3M	284.8M	284.5M	284.7M	284.6M	287.1M	282.2M	566.9M	0.0M
659_eHw-T1-TRNA-1_A23MVY2LT4_1	630.9M	0.0M	0.0M	38.8M	3.5M	572.4M	286.4M	286.0M	286.3M	286.1M	272.1M	300.3M	570.1M	0.0M
659_eHw-T1-TRNA-1_A23MVY2LT4_2	633.5M	0.0M	0.0M	41.6M	3.5M	571.4M	285.9M	285.5M	285.8M	285.6M	273.4M	298.1M	569.2M	0.0M
659_ecd-T1-TRNA-1_A23MVY2LT4_1	578.6M	0.0M	0.0M	36.4M	2.9M	523.2M	261.7M	261.4M	261.6M	261.5M	253.8M	269.4M	521.3M	0.0M
659_ecd-T1-TRNA-1_A23MVY2LT4_2	485.7M	0.0M	0.0M	28.9M	2.4M	441.4M	220.8M	220.6M	220.8M	220.7M	205.5M	235.9M	439.7M	0.0M
659_epP-T1-TRNA-1_A23MVY2LT4_1	646.7M	0.0M	0.0M	55.0M	4.0M	563.6M	282.0M	281.6M	281.9M	281.7M	286.6M	277.0M	561.3M	0.0M
659_epP-T1-TRNA-1_A23MVY2LT4_2	648.4M	0.0M	0.0M	57.8M	4.2M	561.3M	280.8M	280.5M	280.7M	280.6M	285.8M	275.5M	559.0M	0.0M
659_ezg-T1-TRNA-1_A23MVY2LT4_1	639.4M	0.0M	0.0M	44.9M	3.7M	571.7M	286.0M	285.7M	285.9M	285.8M	279.3M	292.4M	569.4M	0.0M
659_ezg-T1-TRNA-1_A23MVY2LT4_2	637.4M	0.0M	0.0M	43.8M	3.9M	570.9M	285.6M	285.3M	285.6M	285.4M	271.6M	299.3M	568.6M	0.0M
659_gK-T1-TRNA-1_A23MVY2LT4_1	641.6M	0.0M	0.0M	48.1M	3.5M	566.2M	283.3M	283.0M	283.1M	283.1M	275.8M	290.4M	564.4M	0.0M
659_gK-T1-TRNA-1_A23MVY2LT4_2	640.8M	0.0M	0.0M	47.9M	3.6M	565.9M	283.1M	282.8M	283.0M	282.9M	279.3M	286.6M	564.1M	0.0M
659_rd-T1-TRNA-1_A23MVY2LT4_1	500.6M	0.0M	0.0M	24.8M	2.5M	461.9M	231.1M	230.8M	231.0M	230.9M	221.5M	240.4M	459.8M	0.0M
659_rd-T1-TRNA-1_A23MVY2LT4_2	624.6M	0.0M	0.0M	30.7M	3.2M	576.6M	288.4M	288.2M	288.3M	288.2M	275.3M	301.3M	574.0M	0.0M
FFPE_HD789_01_RNA_13_A23MVY2LT4_1	546.0M	0.0M	0.0M	31.9M	2.8M	496.3M	248.2M	248.0M	248.2M	248.1M	221.0M	275.3M	494.8M	0.0M
FFPE_V4_0002_RNA_0006_A23MVY2LT4_1	632.5M	0.0M	0.0M	39.9M	4.1M	570.5M	285.4M	285.1M	285.3M	285.2M	269.4M	301.1M	568.6M	0.0M
NTC_0001_0001_A23MVY2LT4_1	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
PX_FFPE_bld_TRNA_nat_01_A23MVY2LT4_1	632.1M	0.0M	0.0M	37.4M	3.1M	575.6M	288.0M	287.6M	287.9M	287.7M	297.0M	278.6M	572.9M	0.0M
PX_FFPE_bld_TRNA_nat_02_A23MVY2LT4_1	625.2M	0.0M	0.0M	40.5M	3.7M	564.5M	282.5M	282.0M	282.3M	282.2M	317.0M	247.5M	561.6M	0.0M
PX_FFPE_bld_TRNA_nat_03_A23MVY2LT4_1	632.8M	0.0M	0.0M	39.1M	3.5M	573.9M	287.2M	286.8M	287.0M	286.9M	302.5M	271.4M	571.3M	0.0M
PX_FFPE_bld_TRNA_nat_04_A23MVY2LT4_1	632.5M	0.0M	0.0M	39.4M	3.6M	573.0M	286.8M	286.3M	286.6M	286.4M	304.1M	268.9M	570.5M	0.0M
PX_FFPE_esp_TRNA_nat_02_A23MVY2LT4_1	634.4M	0.0M	0.0M	42.0M	3.9M	570.1M	285.2M	284.9M	285.2M	285.0M	315.3M	254.8M	567.4M	0.0M
PX_FFPE_gb_TRNA_nat_01_A23MVY2LT4_1	572.9M	0.0M	0.0M	46.6M	3.7M	500.6M	250.5M	250.1M	250.3M	250.3M	275.5M	225.2M	498.6M	0.0M
PX_FFPE_gb_TRNA_nat_02_A23MVY2LT4_1	654.2M	0.0M	0.0M	62.3M	5.8M	556.4M	278.5M	277.9M	278.2M	278.2M	317.5M	238.9M	554.3M	0.0M
PX_FFPE_kid_TRNA_nat_01_A23MVY2LT4_1	241.9M	0.0M	0.0M	20.5M	1.6M	212.0M	106.1M	105.9M	106.0M	106.0M	123.1M	88.8M	210.9M	0.0M
PX_FFPE_kid_TRNA_nat_02_A23MVY2LT4_1	617.7M	0.0M	0.0M	57.6M	4.8M	532.9M	266.7M	266.2M	266.5M	266.4M	322.2M	210.6M	530.7M	0.0M
PX_FFPE_kid_TRNA_nat_03_A23MVY2LT4_1	34.8M	0.0M	0.0M	4.0M	0.3M	29.0M	14.5M	14.5M	14.5M	14.5M	18.7M	10.3M	28.9M	0.0M
PX_FFPE_pan_TRNA_nat_01_A23MVY2LT4_1	525.3M	0.0M	0.0M	61.2M	3.5M	429.9M	215.1M	214.9M	215.0M	214.9M	211.8M	218.2M	428.2M	0.0M
PX_FFPE_pan_TRNA_nat_02_A23MVY2LT4_1	514.2M	0.0M	0.0M	65.0M	4.3M	416.3M	208.3M	208.0M	208.2M	208.1M	227.1M	189.1M	414.3M	0.0M
PX_FFPE_pan_TRNA_nat_03_A23MVY2LT4_1	613.1M	0.0M	0.0M	47.4M	3.8M	540.0M	270.2M	269.8M	270.0M	269.9M	270.1M	269.9M	537.8M	0.0M
PX_FFPE_pst_TRNA_nat_02_A23MVY2LT4_1	576.1M	0.0M	0.0M	41.4M	3.5M	514.0M	257.2M	256.8M	257.1M	256.9M	292.9M	221.1M	511.7M	0.0M
PX_FFPE_stm_TRNA_nat_01_A23MVY2LT4_1	654.2M	0.0M	0.0M	61.1M	5.0M	558.7M	279.5M	279.2M	279.4M	279.3M	288.3M	270.4M	556.5M	0.0M
PX_FFPE_stm_TRNA_nat_02_A23MVY2LT4_1	367.9M	0.0M	0.0M	34.9M	2.8M	313.2M	156.7M	156.5M	156.6M	156.6M	161.1M	152.1M	312.1M	0.0M
PX_FFPE_stm_TRNA_nat_03_A23MVY2LT4_1	641.2M	0.0M	0.0M	48.3M	3.9M	566.0M	283.1M	282.8M	283.0M	282.9M	285.7M	280.3M	563.5M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	369622179	0.3410%
GATCGGAGAGCACACGTCTGAACTCCAGTCACTGAGTGTACAATCTGGGG	2	92	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	25	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	33	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	10	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	4	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	3	0.0000%
CGAATGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	3	0.0000%
GGCGTGCGTCTCTCCTCCAGCGGCCCCGCCTTGCTCGCCGGCCTCGTGAG	2	2	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGCATTCG	2	3	0.0000%
GGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	2	70	0.0000%
GGGAACTCCCATAGTGGGTCGAGAGGTAGATCTAGACTCACGAGGCCGGC	2	2	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	13	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	3	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	4	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGG	2	2	0.0000%
GGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	2	104	0.0000%
CCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAATACTCGATCTGGG	1	412837	0.0004%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAATACTCGATCTAGG	1	28845	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	160586481	0.3228%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	25	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	33	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	10	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	4	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	3	0.0000%
CGAATGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	3	0.0000%
GGCGTGCGTCTCTCCTCCAGCGGCCCCGCCTTGCTCGCCGGCCTCGTGAG	2	2	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGCATTCG	2	3	0.0000%
GGGAACTCCCATAGTGGGTCGAGAGGTAGATCTAGACTCACGAGGCCGGC	2	2	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	13	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	3	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	4	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGG	2	2	0.0000%
CCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2	0.0000%
GCTGCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	1	27	0.0000%
GTGCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	1	7	0.0000%
CAGCATTCCATCAGCTCCTGCCCCTGCCCATCCGCTTCTGGGGCCTGGCC	1	4	0.0000%
CCTGGACCTCAGCGCTCTCAAGAGTAAGGCAGCCCAGAAGGCCCCCAGCA	1	4	0.0000%
GGTGGTGGTGGCAGTGGCGGCGGGGCTGGCAGTGGCGGGGCCGGCGGAAC	1	4	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
RSEQC_TO_MULTIQC	python	`3.11.14`
	rseqc_to_multiqc	`1.0.0`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.14`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0014_0015/A23MVY2LT4/nfcore_rnafusion__73d51683--20260607-225254' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0014_exp0015-73d51683 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260417_LH00995_0030_A23MVY2LT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260417_LH00995_0030_A23MVY2LT4/bclconvert_samplesheet.csv' --flowcell_id 20260417_LH00995_0030_A23MVY2LT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0014_0015/A23MVY2LT4/nfcore_rnafusion__73d51683--20260607-225254'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0014_exp0015-73d51683
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Skip steps

skip_picard_qc: true

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0014_0015/A23MVY2LT4/nfcore_rnafusion__73d51683--20260607-225254
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260417_LH00995_0030_A23MVY2LT4/
flowcell_id: 20260417_LH00995_0030_A23MVY2LT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260417_LH00995_0030_A23MVY2LT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Mark Duplicates Help

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks