MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-16, 19:18 UTC based on data in: /tmp/nxf.9QkyyKg3Fi

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	Total Reads	Expected Distinct	RNA contaminated	RNA contamination %	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
1173_9C_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	387745605	No	0.00%	112.9bp	107.0bp	0.01%	0.76%	0.47%	0.00%	0.02%	2.33%	0.72%	0.00%	588455546	0.01%	0.50%	291507724	0.94%	0.96%	0.05%	0.04%	273629254	137129597	13332187	5022460	424.88	190.00	0.74%	0.61%	0.97	0.000				112bp	155bp	50.9%	0.0%	97.4%	84.6%	94.2%	277.1M	24.7%	97.2%	63785.0Mb	588.5M	57.8%	98.1%	81.3%
1173_9C_T1_RNA_SLD_01_A23T55JLT4_1_1																																	112.9bp	98.2%	289.1M																84.1%	55%	151bp	151bp	27%	351.4M
1173_9C_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			82.2%	56%	151bp	151bp	27%	351.4M
1173_9C_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.1%	57%	111bp	112bp	18%	294.2M	83.1%	57%	111bp	112bp	18%	294.2M
1173_9C_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.6%	58%	112bp	112bp	9%	294.2M	82.6%	58%	112bp	112bp	9%	294.2M
1173_BEE_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	381735119	No	0.00%	111.1bp	105.0bp	0.01%	1.95%	0.42%	0.00%	0.01%	5.59%	0.68%	0.00%	565174502	0.01%	0.51%	277994044	0.93%	0.96%	0.05%	0.04%	258970123	129790076	14552614	5815016	396.63	189.00	0.73%	0.60%	0.97	0.000				106bp	140bp	51.2%	0.0%	97.0%	83.0%	93.3%	263.6M	25.9%	97.4%	60317.9Mb	565.2M	53.5%	98.5%	82.8%
1173_BEE_T1_RNA_SLD_01_A23T55JLT4_1_1																																	111.1bp	97.9%	276.6M																83.0%	52%	151bp	151bp	27%	287.0M
1173_BEE_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			80.9%	53%	151bp	151bp	27%	287.0M
1173_BEE_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.0%	53%	109bp	107bp	18%	282.6M	83.0%	53%	109bp	107bp	18%	282.6M
1173_BEE_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.1%	53%	110bp	107bp	9%	282.6M	82.1%	53%	110bp	107bp	9%	282.6M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_1	9990000000	333266629	No	0.00%	112.4bp	106.0bp	0.03%	1.15%	0.52%	0.00%	0.06%	3.33%	0.77%	0.00%	205524044	0.01%	0.34%	136263251	0.95%	0.97%	0.04%	0.03%	129496959	64947642	5217327	1934853	203.37	82.00	0.65%	0.46%	0.97	0.000				110bp	164bp	34.0%	0.0%	97.6%	85.5%	94.3%	97.0M	13.9%	97.3%	22206.3Mb	205.5M	55.2%	98.5%	80.2%
1173_C31_T1_RNA_SLD_01_A23T55JLT4_1_1																																	112.4bp	98.3%	101.0M																74.1%	53%	151bp	151bp	27%	104.3M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			71.3%	54%	151bp	151bp	27%	104.3M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			74.1%	54%	111bp	112bp	18%	102.8M	74.1%	54%	111bp	112bp	18%	102.8M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			72.3%	55%	111bp	112bp	9%	102.8M	72.3%	55%	111bp	112bp	9%	102.8M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	380684528	No	0.00%	113.5bp	106.0bp	0.02%	1.08%	0.52%	0.00%	0.04%	3.17%	0.78%	0.00%	305780254	0.01%	0.38%	188320050	0.95%	0.97%	0.04%	0.03%	178263193	89366598	7555089	2766660	280.96	119.00	0.69%	0.53%	0.97	0.000				112bp	167bp	38.7%	0.0%	97.5%	85.1%	93.9%	143.6M	16.5%	97.3%	33197.6Mb	305.8M	56.1%	98.2%	79.7%
1173_C31_T1_RNA_SLD_01_A23T55JLT4_2_1																																	113.5bp	98.3%	150.3M																77.1%	54%	151bp	151bp	27%	155.7M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			75.2%	55%	151bp	151bp	27%	155.7M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			77.2%	55%	111bp	112bp	18%	152.9M	77.2%	55%	111bp	112bp	18%	152.9M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			76.5%	56%	112bp	112bp	9%	152.9M	76.5%	56%	112bp	112bp	9%	152.9M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	118783467	No	0.00%	108.5bp	104.0bp	0.00%	0.72%	0.36%	0.00%	0.01%	2.25%	0.58%	0.00%	66507862	0.01%	0.26%	48992977	0.94%	0.96%	0.05%	0.04%	46249438	23159592	2250189	936876	67.41	23.00	0.45%	0.18%	0.97	0.000				105bp	129bp	26.5%	0.0%	97.0%	85.1%	94.4%	31.4M	12.6%	97.3%	6953.0Mb	66.5M	57.0%	98.6%	86.6%
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_1_1																																	108.5bp	97.9%	32.6M																64.2%	54%	151bp	151bp	27%	33.7M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			61.3%	56%	151bp	151bp	27%	33.7M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			64.2%	56%	107bp	107bp	18%	33.3M	64.2%	56%	107bp	107bp	18%	33.3M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			62.1%	57%	108bp	107bp	9%	33.3M	62.1%	57%	108bp	107bp	9%	33.3M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	120488245	No	0.00%	109.0bp	104.0bp	0.00%	0.64%	0.35%	0.00%	0.01%	2.04%	0.59%	0.00%	345689872	0.01%	0.60%	136645184	0.92%	0.95%	0.06%	0.05%	126165247	63123123	7821723	3229116	181.22	69.00	0.63%	0.42%	0.97	0.000				106bp	133bp	60.9%	0.0%	97.1%	84.4%	94.1%	162.7M	32.0%	97.3%	36413.5Mb	345.7M	58.3%	98.4%	85.2%
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_2_1																																	109.0bp	98.1%	169.6M																83.2%	55%	151bp	151bp	27%	175.7M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			81.6%	56%	151bp	151bp	27%	175.7M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			83.2%	58%	108bp	107bp	18%	172.8M	83.2%	58%	108bp	107bp	18%	172.8M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			82.9%	58%	108bp	107bp	9%	172.8M	82.9%	58%	108bp	107bp	9%	172.8M
1173_CI9_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	261764196	No	0.00%	103.1bp	98.0bp	0.01%	0.73%	0.48%	0.00%	0.02%	2.12%	0.71%	0.00%	488992458	0.01%	0.53%	228075343	0.93%	0.96%	0.05%	0.04%	212337074	106265442	11871312	4796147	302.78	134.00	0.70%	0.55%	0.97	0.000				100bp	126bp	53.8%	0.0%	97.4%	85.5%	94.7%	231.4M	22.0%	97.3%	49487.8Mb	489.0M	56.1%	98.4%	87.6%
1173_CI9_T1_RNA_SLD_01_A23T55JLT4_1_1																																	103.1bp	98.1%	239.9M																82.0%	53%	151bp	151bp	27%	248.5M
1173_CI9_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			79.7%	55%	151bp	151bp	27%	248.5M
1173_CI9_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.1%	55%	104bp	102bp	18%	244.5M	82.1%	55%	104bp	102bp	18%	244.5M
1173_CI9_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			80.9%	56%	104bp	102bp	9%	244.5M	80.9%	56%	104bp	102bp	9%	244.5M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	595641379	No	0.00%	116.9bp	109.0bp	0.03%	1.19%	0.48%	0.00%	0.05%	3.36%	0.70%	0.00%	590822936	0.01%	0.45%	324856000	0.94%	0.97%	0.05%	0.03%	305941984	153605772	14875609	5494780	504.56	228.00	0.73%	0.62%	0.97	0.000				114bp	181bp	45.3%	0.0%	97.4%	87.3%	94.9%	280.3M	23.5%	97.3%	65397.4Mb	590.8M	53.5%	98.5%	76.5%
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_1_1																																	116.9bp	98.0%	289.4M																85.0%	52%	151bp	151bp	27%	490.1M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.4%	53%	151bp	151bp	27%	490.1M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.0%	53%	114bp	112bp	18%	295.4M	82.0%	53%	114bp	112bp	18%	295.4M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.5%	53%	114bp	112bp	9%	295.4M	81.5%	53%	114bp	112bp	9%	295.4M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	500714967	No	0.00%	122.7bp	115.0bp	0.01%	1.12%	0.47%	0.00%	0.03%	3.22%	0.70%	0.00%	589335522	0.01%	0.45%	322659394	0.94%	0.97%	0.04%	0.03%	303773531	152531863	14389015	5109674	513.80	238.00	0.73%	0.63%	0.97	0.000				122bp	203bp	45.6%	0.0%	97.4%	87.3%	94.7%	279.2M	25.0%	97.2%	67376.8Mb	589.3M	54.4%	98.2%	73.5%
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_2_1																																	122.7bp	97.9%	288.5M																84.5%	53%	151bp	151bp	27%	415.7M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			82.5%	54%	151bp	151bp	18%	415.7M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			82.3%	54%	117bp	117bp	18%	294.7M	82.3%	54%	117bp	117bp	18%	294.7M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			81.7%	54%	118bp	122bp	9%	294.7M	81.7%	54%	118bp	122bp	9%	294.7M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	74447018	No	0.00%	110.5bp	105.0bp	0.02%	1.56%	0.58%	0.00%	0.05%	4.64%	0.89%	0.00%	22714550	0.01%	0.15%	19231394	0.95%	0.97%	0.04%	0.03%	18333777	9184943	745534	289610	27.62	9.00	0.26%	0.06%	0.97	0.000				108bp	150bp	15.4%	0.0%	97.5%	85.7%	94.7%	10.8M	6.1%	97.2%	2415.9Mb	22.7M	56.0%	98.2%	83.5%
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_1_1																																	110.5bp	98.1%	11.1M																47.7%	53%	151bp	151bp	18%	11.6M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			43.2%	55%	151bp	151bp	18%	11.6M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			47.5%	55%	109bp	107bp	9%	11.4M	47.5%	55%	109bp	107bp	9%	11.4M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			43.9%	56%	110bp	107bp	0%	11.4M	43.9%	56%	110bp	107bp	0%	11.4M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	263662307	No	0.00%	118.5bp	113.0bp	0.01%	1.41%	0.56%	0.00%	0.02%	4.32%	0.91%	0.00%	587312938	0.01%	0.55%	262141442	0.94%	0.96%	0.05%	0.04%	245165013	122765428	12530018	4666695	390.28	168.00	0.70%	0.58%	0.97	0.000				120bp	177bp	55.8%	0.0%	97.4%	85.8%	94.5%	277.6M	30.7%	97.0%	66213.0Mb	587.3M	57.3%	97.9%	77.7%
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_2_1																																	118.5bp	98.3%	288.6M																83.1%	55%	151bp	151bp	27%	336.5M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			81.2%	56%	151bp	151bp	18%	336.5M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			82.2%	56%	116bp	117bp	18%	293.7M	82.2%	56%	116bp	117bp	18%	293.7M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			82.0%	57%	116bp	117bp	9%	293.7M	82.0%	57%	116bp	117bp	9%	293.7M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	619116352	No	0.00%	122.8bp	113.0bp	0.01%	1.26%	0.72%	0.00%	0.03%	3.78%	1.03%	0.00%	590667656	0.01%	0.50%	296604742	0.95%	0.97%	0.04%	0.03%	281345688	141361625	11666333	3932422	492.60	189.00	0.70%	0.59%	0.97	0.000				130bp	291bp	50.1%	0.0%	98.1%	89.7%	95.8%	282.8M	29.0%	97.3%	67686.4Mb	590.7M	53.8%	98.4%	71.2%
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_1_1																																	122.8bp	98.5%	290.9M																88.9%	52%	151bp	151bp	27%	605.2M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			87.2%	53%	151bp	151bp	18%	605.2M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			85.7%	53%	118bp	122bp	18%	295.3M	85.7%	53%	118bp	122bp	18%	295.3M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			85.0%	54%	118bp	122bp	9%	295.3M	85.0%	54%	118bp	122bp	9%	295.3M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	670479403	No	0.00%	130.1bp	121.0bp	0.01%	1.17%	0.71%	0.00%	0.02%	3.59%	1.04%	0.00%	589258688	0.01%	0.48%	308665272	0.95%	0.98%	0.04%	0.02%	292945698	147272782	11813440	3763101	534.11	213.00	0.71%	0.60%	0.97	0.000				148bp	362bp	47.9%	0.0%	98.1%	90.2%	95.8%	282.1M	28.3%	97.2%	69955.5Mb	589.3M	54.3%	98.2%	66.7%
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_2_1																																	130.1bp	98.5%	290.4M																89.7%	53%	151bp	151bp	27%	779.6M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			88.1%	54%	151bp	151bp	18%	779.6M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			85.4%	53%	122bp	127bp	27%	294.6M	85.4%	53%	122bp	127bp	27%	294.6M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			85.0%	54%	122bp	127bp	9%	294.6M	85.0%	54%	122bp	127bp	9%	294.6M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	499237738	No	0.00%	107.2bp	100.0bp	0.03%	1.13%	0.47%	0.00%	0.07%	3.30%	0.73%	0.00%	589665710	0.01%	0.49%	301648174	0.94%	0.96%	0.05%	0.04%	283877748	142268412	13759251	5305179	430.05	172.00	0.72%	0.59%	0.97	0.000				104bp	142bp	49.2%	0.0%	97.6%	78.1%	91.6%	270.2M	20.4%	97.2%	61143.3Mb	589.7M	57.8%	98.3%	83.4%
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_1_1																																	107.2bp	98.2%	289.5M																85.4%	55%	151bp	151bp	27%	605.7M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.4%	56%	151bp	151bp	27%	605.7M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			81.0%	57%	107bp	102bp	18%	294.8M	81.0%	57%	107bp	102bp	18%	294.8M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			80.3%	58%	107bp	107bp	9%	294.8M	80.3%	58%	107bp	107bp	9%	294.8M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	397191951	No	0.00%	118.9bp	112.0bp	0.02%	1.00%	0.46%	0.00%	0.04%	3.00%	0.73%	0.00%	412555804	0.01%	0.43%	233472998	0.94%	0.97%	0.04%	0.03%	220264243	110480300	10035469	3668753	361.12	136.00	0.69%	0.55%	0.97	0.000				119bp	175bp	43.7%	0.0%	97.4%	78.4%	91.4%	188.6M	23.1%	97.2%	46421.0Mb	412.6M	58.2%	98.0%	76.3%
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_2_1																																	118.9bp	98.2%	202.5M																79.0%	56%	151bp	151bp	27%	210.4M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			77.6%	56%	151bp	151bp	27%	210.4M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			79.0%	57%	116bp	117bp	18%	206.3M	79.0%	57%	116bp	117bp	18%	206.3M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			79.0%	58%	116bp	117bp	9%	206.3M	79.0%	58%	116bp	117bp	9%	206.3M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	155202698	No	0.00%	104.2bp	100.0bp	0.06%	1.55%	0.51%	0.00%	0.12%	4.36%	0.78%	0.00%	590333160	0.01%	0.68%	191598689	0.93%	0.96%	0.05%	0.04%	177564779	88855574	10132029	4009895	248.26	102.00	0.67%	0.50%	0.97	0.000				103bp	139bp	68.0%	0.0%	97.6%	79.7%	92.4%	272.8M	35.2%	97.3%	60568.4Mb	590.3M	56.5%	98.4%	87.4%
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_1_1																																	104.2bp	98.3%	290.1M																87.4%	53%	151bp	151bp	27%	383.9M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			85.3%	55%	151bp	151bp	27%	383.9M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			85.7%	56%	105bp	102bp	18%	295.2M	85.7%	56%	105bp	102bp	18%	295.2M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			84.9%	56%	106bp	102bp	9%	295.2M	84.9%	56%	106bp	102bp	9%	295.2M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	105863408	No	0.00%	109.4bp	104.0bp	0.03%	1.38%	0.50%	0.00%	0.06%	3.95%	0.79%	0.00%	573354668	0.01%	0.76%	136583482	0.91%	0.95%	0.06%	0.05%	123629951	61821915	8266698	3203318	175.86	63.00	0.61%	0.41%	0.97	0.000				109bp	153bp	76.8%	0.0%	97.4%	77.9%	91.7%	262.8M	43.3%	97.1%	61064.5Mb	573.4M	58.3%	97.9%	83.9%
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_2_1																																	109.4bp	98.1%	281.1M																87.9%	55%	151bp	151bp	27%	292.9M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			85.9%	56%	151bp	151bp	27%	292.9M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			88.0%	58%	109bp	107bp	18%	286.7M	88.0%	58%	109bp	107bp	18%	286.7M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			87.7%	58%	110bp	107bp	9%	286.7M	87.7%	58%	110bp	107bp	9%	286.7M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	264911845	No	0.00%	100.5bp	96.0bp	0.03%	0.86%	0.57%	0.00%	0.06%	2.49%	0.87%	0.00%	587515956	0.01%	0.65%	205302872	0.92%	0.95%	0.05%	0.05%	189331706	94663450	11235484	4479339	256.45	85.00	0.65%	0.47%	0.97	0.000				102bp	142bp	65.6%	0.0%	97.5%	83.5%	94.2%	276.7M	27.1%	96.6%	58307.0Mb	587.5M	60.4%	97.9%	89.1%
1173_FM_T1_RNA_SLD_01_A23T55JLT4_1_1																																	100.5bp	98.0%	287.8M																86.8%	56%	151bp	151bp	27%	495.7M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			84.5%	57%	151bp	151bp	27%	495.7M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.1%	60%	102bp	102bp	18%	293.8M	83.1%	60%	102bp	102bp	18%	293.8M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.5%	60%	103bp	102bp	9%	293.8M	82.5%	60%	103bp	102bp	9%	293.8M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	156135258	No	0.00%	107.2bp	102.0bp	0.01%	0.72%	0.54%	0.00%	0.03%	2.19%	0.87%	0.00%	585852312	0.01%	0.70%	177857206	0.91%	0.95%	0.06%	0.05%	162247617	81141485	10050689	3933275	228.12	65.00	0.61%	0.43%	0.97	0.000				112bp	166bp	70.3%	0.0%	97.4%	83.0%	93.8%	274.6M	36.2%	97.0%	61506.1Mb	585.9M	61.7%	97.6%	85.3%
1173_FM_T1_RNA_SLD_01_A23T55JLT4_2_1																																	107.2bp	97.9%	286.9M																86.5%	58%	151bp	151bp	27%	371.3M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			84.7%	59%	151bp	151bp	27%	371.3M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			85.0%	61%	108bp	107bp	18%	292.9M	85.0%	61%	108bp	107bp	18%	292.9M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			84.9%	61%	108bp	107bp	9%	292.9M	84.9%	61%	108bp	107bp	9%	292.9M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	325520584	Yes	0.00%	124.1bp	116.0bp	0.02%	1.01%	0.57%	0.00%	0.03%	3.00%	0.88%	0.00%	588300466	0.01%	0.51%	291111463	0.94%	0.97%	0.05%	0.03%	273173034	137044033	13295822	4797486	461.92	216.00	0.73%	0.61%	0.97	0.000				125bp	200bp	50.9%	0.0%	97.7%	84.5%	94.0%	276.4M	27.6%	97.2%	67939.9Mb	588.3M	56.8%	98.1%	72.6%
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_1_1																																	124.1bp	98.2%	289.0M																82.1%	54%	151bp	151bp	18%	394.8M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			80.7%	56%	151bp	151bp	18%	394.8M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			79.7%	56%	119bp	122bp	9%	294.2M	79.7%	56%	119bp	122bp	9%	294.2M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			79.9%	57%	119bp	122bp	9%	294.2M	79.9%	57%	119bp	122bp	9%	294.2M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	11470	Skipped	N/A%	104.9bp	31.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	19646	0.51%	0.36%	12531	0.01%	0.07%	0.19%	0.93%	169	84	2396	1052	0.00	0.00	0.00%	0.00%	0.93	0.000				32bp	33bp	73.5%	0.1%	21.9%	1.9%	7.2%	0.0M	32.6%	85.5%	1.4Mb	0.0M	71.6%	5.9%	50.9%
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_2_1																																	104.9bp	8.2%	0.0M																96.2%	74%	151bp	151bp	45%	0.2M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			93.0%	94%	151bp	151bp	55%	0.2M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			54.5%	67%	71bp	37bp	55%	0.0M	54.5%	67%	71bp	37bp	55%	0.0M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			57.9%	74%	101bp	122bp	55%	0.0M	57.9%	74%	101bp	122bp	55%	0.0M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	171775133	No	0.00%	102.9bp	99.0bp	0.01%	0.87%	0.36%	0.00%	0.01%	2.53%	0.56%	0.00%	587719940	0.01%	0.66%	197601297	0.91%	0.95%	0.06%	0.05%	179839134	89876869	12238021	5053639	245.88	92.00	0.66%	0.49%	0.97	0.000				100bp	122bp	67.0%	0.0%	97.6%	80.8%	93.0%	273.4M	29.6%	97.1%	59177.7Mb	587.7M	59.2%	98.0%	88.6%
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_1_1																																	102.9bp	97.9%	287.6M																85.5%	56%	151bp	151bp	27%	400.4M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.4%	57%	151bp	151bp	27%	400.4M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.2%	58%	103bp	102bp	18%	293.9M	83.2%	58%	103bp	102bp	18%	293.9M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.8%	59%	104bp	102bp	9%	293.9M	82.8%	59%	104bp	102bp	9%	293.9M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	116101252	No	0.00%	106.9bp	102.0bp	0.01%	0.83%	0.35%	0.00%	0.01%	2.46%	0.55%	0.00%	563933476	0.01%	0.74%	146822289	0.90%	0.95%	0.06%	0.05%	131910641	65885943	9172542	3691554	185.15	68.00	0.63%	0.43%	0.97	0.000				104bp	130bp	74.7%	0.0%	97.7%	80.3%	92.7%	261.4M	44.5%	97.2%	58708.7Mb	563.9M	58.8%	97.8%	86.0%
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_2_1																																	106.9bp	98.0%	276.5M																86.4%	55%	151bp	151bp	27%	288.4M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			84.5%	57%	151bp	151bp	27%	288.4M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			86.4%	58%	107bp	107bp	18%	282.0M	86.4%	58%	107bp	107bp	18%	282.0M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			86.2%	59%	107bp	107bp	9%	282.0M	86.2%	59%	107bp	107bp	9%	282.0M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	168810340	No	0.00%	115.8bp	112.0bp	0.01%	0.56%	0.29%	0.00%	0.01%	1.77%	0.47%	0.00%	580907912	0.01%	0.67%	190438066	0.90%	0.95%	0.06%	0.05%	171478951	85820999	11521926	4612964	258.79	117.00	0.71%	0.53%	0.97	0.000				115bp	146bp	68.1%	0.0%	97.1%	82.4%	92.8%	269.7M	38.8%	97.2%	64465.2Mb	580.9M	57.9%	98.0%	80.8%
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_1_1																																	115.8bp	98.1%	285.0M																85.0%	55%	151bp	151bp	27%	296.5M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			82.8%	57%	151bp	151bp	27%	296.5M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			85.1%	57%	114bp	117bp	18%	290.5M	85.1%	57%	114bp	117bp	18%	290.5M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			84.2%	58%	114bp	117bp	9%	290.5M	84.2%	58%	114bp	117bp	9%	290.5M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	122977893	No	0.00%	116.5bp	111.0bp	0.00%	0.53%	0.28%	0.00%	0.01%	1.68%	0.46%	0.00%	483494574	0.01%	0.71%	142051207	0.89%	0.95%	0.06%	0.05%	126236822	63146102	8866096	3530541	189.17	81.00	0.67%	0.45%	0.97	0.000				114bp	147bp	71.6%	0.0%	97.1%	82.0%	92.5%	223.7M	44.1%	97.2%	53808.8Mb	483.5M	58.2%	97.8%	80.3%
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_2_1																																	116.5bp	98.1%	237.2M																85.9%	56%	151bp	151bp	27%	247.1M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			83.4%	57%	151bp	151bp	27%	247.1M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			85.9%	57%	114bp	117bp	18%	241.7M	85.9%	57%	114bp	117bp	18%	241.7M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			85.2%	58%	115bp	117bp	9%	241.7M	85.2%	58%	115bp	117bp	9%	241.7M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	184090292	No	0.00%	106.4bp	101.0bp	0.01%	0.79%	0.41%	0.00%	0.02%	2.35%	0.60%	0.00%	589774004	0.01%	0.63%	215605405	0.92%	0.95%	0.06%	0.05%	199368537	99811998	12103503	4856085	287.27	128.00	0.72%	0.55%	0.97	0.000				103bp	130bp	63.9%	0.0%	97.3%	86.4%	94.9%	279.8M	29.8%	97.2%	61003.6Mb	589.8M	57.6%	98.3%	85.3%
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_1_1																																	106.4bp	98.2%	289.7M																86.2%	55%	151bp	151bp	27%	413.8M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			84.1%	56%	151bp	151bp	27%	413.8M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.8%	57%	106bp	102bp	18%	294.9M	83.8%	57%	106bp	102bp	18%	294.9M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			83.0%	57%	107bp	107bp	9%	294.9M	83.0%	57%	107bp	107bp	9%	294.9M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	136330590	No	0.00%	112.7bp	107.0bp	0.01%	0.74%	0.41%	0.00%	0.01%	2.24%	0.63%	0.00%	565513486	0.01%	0.71%	163378841	0.91%	0.95%	0.06%	0.05%	148869541	74500724	10073759	4003778	215.74	92.00	0.68%	0.48%	0.97	0.000				110bp	146bp	71.7%	0.0%	97.1%	85.7%	94.6%	267.4M	40.2%	97.2%	61298.7Mb	565.5M	57.9%	98.0%	81.7%
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_2_1																																	112.7bp	98.2%	277.6M																86.4%	55%	151bp	151bp	27%	288.5M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			84.0%	56%	151bp	151bp	27%	288.5M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			86.4%	57%	111bp	112bp	18%	282.8M	86.4%	57%	111bp	112bp	18%	282.8M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			85.6%	58%	112bp	112bp	9%	282.8M	85.6%	58%	112bp	112bp	9%	282.8M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	89192228	No	0.00%	112.8bp	106.0bp	0.02%	0.74%	0.35%	0.00%	0.04%	2.30%	0.55%	0.00%	30843242	0.01%	0.18%	25190386	0.95%	0.97%	0.04%	0.03%	23959890	12015220	981257	377820	36.87	15.00	0.34%	0.08%	0.97	0.000				109bp	155bp	18.5%	0.0%	97.4%	85.7%	94.5%	14.6M	7.8%	97.3%	3319.5Mb	30.8M	55.0%	98.5%	81.6%
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_1_1																																	112.8bp	98.4%	15.2M																54.1%	53%	151bp	151bp	27%	15.7M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			48.9%	54%	151bp	151bp	18%	15.7M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			54.0%	54%	110bp	107bp	18%	15.4M	54.0%	54%	110bp	107bp	18%	15.4M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			49.6%	55%	111bp	112bp	0%	15.4M	49.6%	55%	111bp	112bp	0%	15.4M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	230091914	Yes	0.04%	115.1bp	108.0bp	0.01%	0.68%	0.34%	0.00%	0.02%	2.17%	0.54%	0.00%	560658426	0.01%	0.57%	238437358	0.93%	0.96%	0.05%	0.04%	221433753	111059402	11837420	4482171	349.68	187.00	0.77%	0.63%	0.97	0.000				116bp	171bp	58.0%	0.0%	97.4%	85.3%	94.2%	264.0M	32.0%	97.2%	62271.7Mb	560.7M	56.0%	98.2%	78.7%
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_2_1																																	115.1bp	98.4%	275.8M																84.6%	53%	151bp	151bp	27%	285.4M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			82.3%	55%	151bp	151bp	27%	285.4M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			84.6%	55%	114bp	112bp	18%	280.3M	84.6%	55%	114bp	112bp	18%	280.3M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			83.7%	56%	114bp	112bp	9%	280.3M	83.7%	56%	114bp	112bp	9%	280.3M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	559868144	No	0.00%	116.6bp	108.0bp	0.01%	0.85%	0.39%	0.00%	0.03%	2.48%	0.56%	0.00%	588655702	0.01%	0.45%	321587233	0.94%	0.96%	0.05%	0.04%	301622269	151422559	15392771	5667025	490.61	231.00	0.77%	0.64%	0.97	0.000				113bp	173bp	45.7%	0.0%	97.2%	87.0%	95.0%	279.5M	22.3%	97.1%	64661.1Mb	588.7M	56.9%	98.1%	76.5%
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_1_1																																	116.6bp	98.2%	288.9M																87.7%	54%	151bp	151bp	27%	724.1M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			85.4%	56%	151bp	151bp	27%	724.1M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.6%	56%	113bp	112bp	27%	294.3M	82.6%	56%	113bp	112bp	27%	294.3M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.5%	57%	113bp	112bp	9%	294.3M	81.5%	57%	113bp	112bp	9%	294.3M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	485980051	No	0.00%	128.2bp	119.0bp	0.01%	0.76%	0.36%	0.00%	0.02%	2.29%	0.54%	0.00%	588162284	0.01%	0.46%	318970661	0.94%	0.97%	0.05%	0.03%	299054720	150304443	14963985	5216481	522.15	250.00	0.77%	0.66%	0.97	0.000				132bp	224bp	46.2%	0.0%	97.1%	87.6%	95.0%	279.3M	26.4%	97.0%	69291.6Mb	588.2M	56.9%	98.0%	68.8%
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_2_1																																	128.2bp	98.2%	288.7M																85.4%	55%	151bp	151bp	27%	419.0M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			83.0%	56%	151bp	151bp	18%	419.0M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			83.3%	56%	121bp	127bp	18%	294.1M	83.3%	56%	121bp	127bp	18%	294.1M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			82.3%	57%	122bp	127bp	9%	294.1M	82.3%	57%	122bp	127bp	9%	294.1M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	452480665	Yes	0.00%	109.8bp	103.0bp	0.02%	1.36%	0.67%	0.00%	0.04%	3.75%	0.92%	0.00%	589592558	0.01%	0.50%	296539610	0.94%	0.97%	0.05%	0.03%	279001449	139888452	13360149	4992801	428.63	162.00	0.70%	0.58%	0.97	0.000				108bp	158bp	50.1%	0.0%	97.8%	83.3%	93.9%	276.7M	23.3%	97.2%	62492.1Mb	589.6M	58.0%	98.3%	82.3%
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_1_1																																	109.8bp	98.0%	289.0M																87.4%	55%	151bp	151bp	27%	663.3M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			85.7%	56%	151bp	151bp	27%	663.3M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.7%	57%	109bp	107bp	27%	294.8M	82.7%	57%	109bp	107bp	27%	294.8M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.4%	58%	109bp	107bp	9%	294.8M	82.4%	58%	109bp	107bp	9%	294.8M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	348178125	Yes	0.00%	113.1bp	106.0bp	0.01%	1.25%	0.66%	0.00%	0.02%	3.52%	0.94%	0.00%	475785136	0.01%	0.48%	248292868	0.94%	0.97%	0.04%	0.03%	233721536	117174205	10856013	3904241	366.58	126.00	0.68%	0.54%	0.97	0.000				113bp	170bp	48.2%	0.0%	97.7%	82.4%	93.5%	222.3M	22.1%	97.1%	51486.5Mb	475.8M	59.0%	98.0%	80.3%
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_2_1																																	113.1bp	98.0%	233.2M																82.2%	55%	151bp	151bp	27%	242.8M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			80.2%	58%	151bp	151bp	27%	242.8M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			82.2%	58%	111bp	112bp	18%	237.9M	82.2%	58%	111bp	112bp	18%	237.9M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			81.7%	59%	112bp	112bp	9%	237.9M	81.7%	59%	112bp	112bp	9%	237.9M
1173_HRO_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	191835680	Yes	0.00%	105.1bp	100.0bp	0.01%	0.66%	0.30%	0.00%	0.03%	1.87%	0.44%	0.00%	589167450	0.01%	0.64%	209367308	0.93%	0.95%	0.05%	0.05%	193817594	96976115	11364327	4586086	277.90	136.00	0.73%	0.56%	0.97	0.000				104bp	145bp	64.9%	0.0%	97.6%	83.4%	93.6%	275.7M	29.1%	97.2%	60359.5Mb	589.2M	57.1%	98.2%	86.8%
1173_HRO_T1_RNA_SLD_01_A23T55JLT4_1_1																																	105.1bp	98.0%	288.8M																85.4%	54%	151bp	151bp	27%	402.3M
1173_HRO_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.2%	56%	151bp	151bp	27%	402.3M
1173_HRO_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.2%	56%	105bp	102bp	18%	294.6M	83.2%	56%	105bp	102bp	18%	294.6M
1173_HRO_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.3%	57%	106bp	102bp	9%	294.6M	82.3%	57%	106bp	102bp	9%	294.6M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	188526454	No	0.00%	100.0bp	95.0bp	0.04%	0.76%	0.45%	0.00%	0.09%	2.11%	0.62%	0.00%	522531886	0.01%	0.62%	200857801	0.93%	0.95%	0.06%	0.05%	186038418	93093479	11367840	4717404	257.03	98.00	0.65%	0.50%	0.97	0.000				95bp	121bp	62.0%	0.0%	97.2%	82.7%	94.7%	247.5M	25.9%	97.4%	51518.2Mb	522.5M	53.5%	98.6%	89.2%
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_1_1																																	100.0bp	97.8%	255.5M																84.7%	52%	151bp	151bp	27%	264.9M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			82.9%	53%	151bp	151bp	27%	264.9M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			84.8%	53%	101bp	97bp	18%	261.3M	84.8%	53%	101bp	97bp	18%	261.3M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			83.9%	53%	101bp	97bp	9%	261.3M	83.9%	53%	101bp	97bp	9%	261.3M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	191441011	No	0.00%	106.1bp	100.0bp	0.02%	0.73%	0.48%	0.00%	0.04%	2.09%	0.66%	0.00%	300330088	0.01%	0.48%	156292265	0.94%	0.96%	0.05%	0.04%	146856258	73531222	7193500	2798148	212.95	80.00	0.63%	0.46%	0.97	0.000				102bp	135bp	48.3%	0.0%	97.5%	85.1%	94.8%	142.3M	20.5%	97.3%	30908.0Mb	300.3M	55.6%	98.2%	86.3%
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_2_1																																	106.1bp	98.3%	147.6M																80.2%	52%	151bp	151bp	27%	152.9M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			78.0%	55%	151bp	151bp	27%	152.9M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			80.2%	55%	106bp	102bp	18%	150.2M	80.2%	55%	106bp	102bp	18%	150.2M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			79.3%	55%	106bp	102bp	9%	150.2M	79.3%	55%	106bp	102bp	9%	150.2M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	148337795	No	0.00%	91.6bp	88.0bp	0.01%	1.05%	0.39%	0.00%	0.02%	3.18%	0.60%	0.00%	472800642	0.01%	0.65%	165367285	0.91%	0.94%	0.07%	0.06%	150706779	75255626	11325135	4927243	185.37	83.00	0.66%	0.46%	0.97	0.000				88bp	103bp	65.5%	0.0%	97.2%	80.1%	93.2%	220.4M	22.2%	97.3%	42878.4Mb	472.8M	55.5%	98.4%	94.2%
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_1_1																																	91.6bp	97.9%	231.4M																82.1%	52%	151bp	151bp	27%	240.2M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			80.3%	55%	151bp	151bp	27%	240.2M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.1%	55%	93bp	92bp	18%	236.4M	82.1%	55%	93bp	92bp	18%	236.4M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.5%	55%	93bp	92bp	9%	236.4M	81.5%	55%	93bp	92bp	9%	236.4M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	95818199	No	0.00%	99.2bp	95.0bp	0.01%	0.94%	0.37%	0.00%	0.01%	2.98%	0.58%	0.00%	349997100	0.01%	0.66%	118240962	0.91%	0.94%	0.06%	0.06%	107937463	53872653	7469305	3141604	139.61	62.00	0.63%	0.39%	0.97	0.000				97bp	116bp	66.8%	0.0%	97.2%	79.3%	92.7%	162.2M	28.2%	97.2%	34218.0Mb	350.0M	55.3%	97.9%	91.4%
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_2_1																																	99.2bp	98.2%	171.9M																82.7%	52%	151bp	151bp	27%	178.7M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			80.6%	55%	151bp	151bp	27%	178.7M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			82.7%	55%	100bp	97bp	18%	175.0M	82.7%	55%	100bp	97bp	18%	175.0M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			82.2%	55%	101bp	97bp	9%	175.0M	82.2%	55%	101bp	97bp	9%	175.0M
1173_JIG_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	48283151	No	0.00%	89.1bp	82.0bp	0.07%	0.80%	0.29%	0.00%	0.14%	2.16%	0.45%	0.00%	55214792	0.03%	0.52%	26712223	0.86%	0.91%	0.09%	0.09%	22878895	11443081	2334437	1064500	29.22	7.00	0.24%	0.07%	0.97	0.000				68bp	78bp	53.1%	0.4%	78.4%	18.7%	62.9%	17.4M	18.4%	97.0%	4292.3Mb	55.2M	55.4%	98.3%	93.2%
1173_JIG_T1_RNA_SLD_01_A23T55JLT4_1_1																																	89.1bp	69.1%	19.1M																69.3%	55%	151bp	151bp	27%	28.1M
1173_JIG_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			66.3%	56%	151bp	151bp	27%	28.1M
1173_JIG_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			69.6%	55%	80bp	77bp	27%	27.6M	69.6%	55%	80bp	77bp	27%	27.6M
1173_JIG_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			67.6%	55%	81bp	77bp	27%	27.6M	67.6%	55%	81bp	77bp	27%	27.6M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	683574478	No	0.00%	121.9bp	113.0bp	0.01%	1.07%	0.61%	0.00%	0.02%	3.16%	0.87%	0.00%	589749792	0.01%	0.43%	333996736	0.94%	0.97%	0.04%	0.03%	314611136	158067317	14904290	5319601	538.53	250.00	0.75%	0.64%	0.97	0.000				125bp	215bp	43.7%	0.0%	97.4%	86.8%	94.8%	279.5M	24.7%	97.3%	67298.0Mb	589.7M	56.5%	98.3%	71.9%
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_1_1																																	121.9bp	98.0%	289.0M																88.3%	54%	151bp	151bp	27%	745.2M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			86.7%	55%	151bp	151bp	18%	745.2M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.5%	56%	117bp	117bp	27%	294.9M	83.5%	56%	117bp	117bp	27%	294.9M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			83.2%	56%	117bp	122bp	9%	294.9M	83.2%	56%	117bp	122bp	9%	294.9M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	646126443	No	0.00%	130.5bp	121.0bp	0.01%	1.01%	0.58%	0.00%	0.01%	3.03%	0.84%	0.00%	588698014	0.01%	0.42%	341067582	0.94%	0.97%	0.04%	0.03%	321204959	161469706	14924950	5077232	574.58	269.00	0.76%	0.65%	0.97	0.000				138bp	256bp	42.4%	0.0%	97.3%	86.8%	94.6%	278.5M	24.9%	97.2%	69831.5Mb	588.7M	56.8%	98.1%	67.1%
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_2_1																																	130.5bp	97.9%	288.3M																87.2%	55%	151bp	151bp	27%	572.8M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			85.3%	56%	151bp	151bp	18%	572.8M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			83.5%	56%	122bp	127bp	18%	294.3M	83.5%	56%	122bp	127bp	18%	294.3M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			83.1%	57%	122bp	127bp	9%	294.3M	83.1%	57%	122bp	127bp	9%	294.3M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	458852873	No	0.00%	120.3bp	111.0bp	0.09%	1.51%	0.46%	0.00%	0.16%	4.15%	0.66%	0.00%	531893406	0.01%	0.47%	280201962	0.94%	0.97%	0.04%	0.03%	264126449	132542310	12514599	4504027	448.60	143.00	0.65%	0.54%	0.97	0.000				117bp	217bp	47.6%	0.0%	97.5%	81.8%	94.5%	251.2M	26.9%	97.3%	59532.1Mb	531.9M	51.9%	98.4%	73.6%
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_1_1																																	120.3bp	98.0%	260.6M																84.5%	51%	151bp	151bp	27%	270.2M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			82.5%	52%	151bp	151bp	27%	270.2M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			84.6%	51%	115bp	117bp	18%	265.9M	84.6%	51%	115bp	117bp	18%	265.9M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			83.7%	52%	115bp	117bp	18%	265.9M	83.7%	52%	115bp	117bp	18%	265.9M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	546444574	No	0.00%	126.7bp	117.0bp	0.06%	1.43%	0.46%	0.00%	0.10%	4.01%	0.67%	0.00%	589883692	0.01%	0.46%	316818529	0.95%	0.97%	0.04%	0.03%	299693600	150528164	13299319	4536343	527.99	180.00	0.67%	0.57%	0.97	0.000				129bp	256bp	46.6%	0.0%	97.8%	87.5%	95.2%	280.9M	25.9%	97.3%	68416.8Mb	589.9M	52.9%	98.3%	70.4%
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_2_1																																	126.7bp	98.5%	290.4M																86.5%	52%	151bp	151bp	27%	401.2M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			84.4%	53%	151bp	151bp	18%	401.2M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			85.0%	52%	119bp	122bp	18%	294.9M	85.0%	52%	119bp	122bp	18%	294.9M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			84.2%	53%	119bp	122bp	9%	294.9M	84.2%	53%	119bp	122bp	9%	294.9M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	62762443	No	0.00%	94.0bp	90.0bp	0.01%	0.90%	0.30%	0.00%	0.02%	2.59%	0.46%	0.00%	28389066	0.01%	0.21%	22523975	0.94%	0.96%	0.05%	0.04%	21226132	10615412	1066338	459326	26.92	10.00	0.25%	0.05%	0.98	0.000				90bp	103bp	20.8%	0.0%	96.9%	84.1%	94.1%	13.4M	7.8%	97.4%	2634.0Mb	28.4M	56.0%	98.3%	93.5%
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_1_1																																	94.0bp	97.5%	13.8M																44.1%	53%	151bp	151bp	18%	14.4M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			40.5%	55%	151bp	151bp	18%	14.4M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			43.9%	55%	95bp	92bp	9%	14.2M	43.9%	55%	95bp	92bp	9%	14.2M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			41.0%	56%	95bp	92bp	0%	14.2M	41.0%	56%	95bp	92bp	0%	14.2M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	95584731	No	0.00%	100.1bp	97.0bp	0.01%	0.82%	0.30%	0.00%	0.01%	2.43%	0.46%	0.00%	294192922	0.01%	0.62%	110702001	0.91%	0.94%	0.07%	0.06%	100600299	50255735	7230402	3108347	129.87	59.00	0.63%	0.37%	0.97	0.000				97bp	112bp	63.0%	0.0%	96.8%	83.0%	93.6%	137.7M	25.7%	97.2%	28910.8Mb	294.2M	56.5%	98.1%	91.1%
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_2_1																																	100.1bp	97.5%	143.5M																76.6%	53%	151bp	151bp	27%	149.9M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			74.5%	56%	151bp	151bp	27%	149.9M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			76.6%	56%	101bp	97bp	18%	147.1M	76.6%	56%	101bp	97bp	18%	147.1M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			75.8%	56%	101bp	97bp	9%	147.1M	75.8%	56%	101bp	97bp	9%	147.1M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	231236743	Yes	0.00%	100.5bp	95.0bp	0.01%	2.48%	0.59%	0.00%	0.02%	6.54%	0.87%	0.00%	590989950	0.01%	0.62%	227336524	0.93%	0.95%	0.06%	0.05%	210764930	105434479	13035341	5409136	291.03	108.00	0.66%	0.51%	0.97	0.000				96bp	120bp	61.9%	0.0%	97.2%	85.2%	94.6%	279.5M	24.4%	97.4%	58679.7Mb	591.0M	53.6%	98.5%	88.9%
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_1_1																																	100.5bp	97.9%	289.2M																82.1%	52%	151bp	151bp	27%	314.8M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			80.4%	53%	151bp	151bp	27%	314.8M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			81.7%	53%	102bp	97bp	18%	295.5M	81.7%	53%	102bp	97bp	18%	295.5M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.0%	53%	102bp	97bp	9%	295.5M	81.0%	53%	102bp	97bp	9%	295.5M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	207831911	No	0.00%	103.6bp	99.0bp	0.01%	2.39%	0.60%	0.00%	0.01%	6.38%	0.89%	0.00%	430250586	0.01%	0.55%	191680581	0.93%	0.96%	0.05%	0.04%	178672994	89369555	10028999	4024021	252.91	94.00	0.64%	0.49%	0.97	0.000				99bp	126bp	55.8%	0.0%	97.1%	84.6%	94.2%	202.7M	23.7%	97.3%	43687.8Mb	430.3M	54.3%	98.2%	87.6%
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_2_1																																	103.6bp	98.0%	210.7M																79.9%	53%	151bp	151bp	27%	219.1M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			77.6%	53%	151bp	151bp	27%	219.1M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			79.8%	53%	104bp	102bp	18%	215.1M	79.8%	53%	104bp	102bp	18%	215.1M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			78.8%	54%	105bp	102bp	9%	215.1M	78.8%	54%	105bp	102bp	9%	215.1M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	402704147	No	0.00%	114.9bp	106.0bp	0.01%	1.03%	0.36%	0.00%	0.03%	3.28%	0.59%	0.00%	293424850	0.01%	0.38%	180994090	0.95%	0.97%	0.04%	0.03%	172109925	86361409	7256995	2703846	279.55	135.00	0.73%	0.56%	0.97	0.000				116bp	189bp	38.5%	0.0%	97.7%	88.1%	95.5%	140.1M	17.2%	97.2%	32126.5Mb	293.4M	54.3%	98.7%	77.8%
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_1_1																																	114.9bp	98.5%	144.5M																77.6%	52%	151bp	151bp	27%	148.7M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			75.7%	53%	151bp	151bp	18%	148.7M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			77.7%	54%	112bp	112bp	18%	146.7M	77.7%	54%	112bp	112bp	18%	146.7M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			76.7%	54%	113bp	112bp	9%	146.7M	76.7%	54%	113bp	112bp	9%	146.7M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	503730907	Yes	0.00%	122.1bp	114.0bp	0.01%	0.93%	0.35%	0.00%	0.02%	3.09%	0.58%	0.00%	591207666	0.01%	0.47%	314930595	0.95%	0.97%	0.04%	0.03%	297799195	149518250	13438502	4830586	510.10	276.00	0.79%	0.68%	0.97	0.000				129bp	230bp	47.0%	0.0%	97.6%	88.6%	95.4%	282.0M	27.9%	97.2%	67922.8Mb	591.2M	54.7%	98.5%	73.0%
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_2_1																																	122.1bp	98.5%	291.2M																82.9%	53%	151bp	151bp	27%	301.7M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			81.0%	54%	151bp	151bp	18%	301.7M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			82.9%	54%	118bp	122bp	18%	295.6M	82.9%	54%	118bp	122bp	18%	295.6M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			82.1%	54%	118bp	122bp	9%	295.6M	82.1%	54%	118bp	122bp	9%	295.6M
1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	3706642	No	0.00%	105.1bp	98.0bp	0.01%	0.49%	0.28%	0.00%	0.01%	1.57%	0.52%	0.00%	20603440	0.01%	0.82%	3725974	0.81%	0.88%	0.13%	0.12%	3017713	1499405	467894	202906	3.91	1.00	0.02%	0.00%	0.97	0.000				99bp	120bp	82.9%	0.0%	95.8%	70.5%	90.4%	9.3M	39.6%	96.8%	2061.6Mb	20.6M	60.5%	95.8%	85.5%
1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1_1																																	105.1bp	96.2%	9.9M																82.8%	57%	151bp	151bp	36%	10.8M
1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			80.3%	58%	151bp	151bp	36%	10.8M
1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.7%	60%	103bp	102bp	18%	10.3M	82.7%	60%	103bp	102bp	18%	10.3M
1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.3%	60%	104bp	102bp	27%	10.3M	82.3%	60%	104bp	102bp	27%	10.3M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	194266469	No	0.00%	100.5bp	96.0bp	0.03%	0.81%	0.33%	0.00%	0.05%	2.42%	0.51%	0.00%	592305754	0.01%	0.64%	210735746	0.92%	0.95%	0.06%	0.05%	194351804	97239983	12120544	5071462	264.38	115.00	0.69%	0.53%	0.97	0.000				98bp	126bp	64.9%	0.0%	97.6%	86.5%	94.9%	281.1M	27.0%	97.4%	58777.5Mb	592.3M	54.0%	98.7%	89.6%
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_1_1																																	100.5bp	98.2%	290.8M																83.3%	51%	151bp	151bp	27%	347.6M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			81.6%	53%	151bp	151bp	27%	347.6M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.1%	53%	102bp	97bp	18%	296.2M	82.1%	53%	102bp	97bp	18%	296.2M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.2%	54%	102bp	97bp	9%	296.2M	81.2%	54%	102bp	97bp	9%	296.2M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	175772744	No	0.00%	105.7bp	101.0bp	0.01%	0.76%	0.33%	0.00%	0.03%	2.32%	0.51%	0.00%	442110440	0.01%	0.59%	182426653	0.93%	0.96%	0.05%	0.04%	169436934	84802795	9392061	3808598	241.25	107.00	0.68%	0.51%	0.98	0.000				104bp	140bp	59.2%	0.0%	97.6%	86.3%	94.6%	209.2M	29.0%	97.5%	45903.3Mb	442.1M	54.4%	98.4%	87.1%
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_2_1																																	105.7bp	98.3%	217.3M																80.4%	53%	151bp	151bp	27%	224.6M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			78.3%	54%	151bp	151bp	27%	224.6M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			80.3%	54%	106bp	102bp	18%	221.1M	80.3%	54%	106bp	102bp	18%	221.1M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			79.5%	54%	107bp	107bp	9%	221.1M	79.5%	54%	107bp	107bp	9%	221.1M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	35973504	No	0.00%	83.9bp	80.0bp	0.03%	0.72%	0.30%	0.00%	0.06%	2.08%	0.46%	0.00%	91759492	0.02%	0.61%	35979849	0.87%	0.92%	0.09%	0.08%	31470843	15716389	3065383	1393814	35.54	11.00	0.31%	0.09%	0.97	0.000				73bp	81bp	61.8%	0.1%	84.9%	31.7%	75.4%	34.6M	13.8%	97.1%	7177.2Mb	91.8M	56.8%	98.1%	96.3%
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_1_1																																	83.9bp	81.1%	37.2M																75.5%	54%	151bp	151bp	27%	46.8M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			72.6%	56%	151bp	151bp	36%	46.8M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			75.6%	56%	80bp	77bp	27%	45.9M	75.6%	56%	80bp	77bp	27%	45.9M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			73.8%	57%	81bp	77bp	27%	45.9M	73.8%	57%	81bp	77bp	27%	45.9M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	52965574	No	0.00%	90.4bp	87.0bp	0.01%	0.68%	0.32%	0.00%	0.03%	2.02%	0.48%	0.00%	159812694	0.01%	0.65%	56347945	0.89%	0.94%	0.07%	0.06%	50362592	25137104	3932804	1703615	59.93	23.00	0.45%	0.18%	0.97	0.000				81bp	92bp	65.6%	0.0%	88.7%	42.2%	81.4%	65.0M	17.2%	96.8%	13622.8Mb	159.8M	57.7%	97.9%	94.9%
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_2_1																																	90.4bp	87.3%	69.7M																80.0%	55%	151bp	151bp	27%	81.6M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			77.0%	56%	151bp	151bp	27%	81.6M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			80.1%	57%	88bp	87bp	27%	79.9M	80.1%	57%	88bp	87bp	27%	79.9M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			78.5%	58%	88bp	87bp	18%	79.9M	78.5%	58%	88bp	87bp	18%	79.9M
1173_LQD_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	524508706	No	0.00%	118.2bp	111.0bp	0.02%	1.09%	0.45%	0.00%	0.03%	3.09%	0.68%	0.00%	590002200	0.01%	0.46%	318776948	0.94%	0.97%	0.04%	0.03%	300328223	150784522	13807520	4981519	495.12	226.00	0.72%	0.62%	0.97	0.000				116bp	186bp	46.3%	0.0%	97.6%	86.7%	95.0%	280.2M	23.6%	97.2%	65830.1Mb	590.0M	54.3%	98.3%	76.8%
1173_LQD_T1_RNA_SLD_01_A23T55JLT4_1_1																																	118.2bp	98.2%	289.6M																85.8%	53%	151bp	151bp	27%	448.4M
1173_LQD_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.7%	54%	151bp	151bp	27%	448.4M
1173_LQD_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.5%	54%	115bp	117bp	18%	295.0M	83.5%	54%	115bp	117bp	18%	295.0M
1173_LQD_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.5%	54%	115bp	117bp	9%	295.0M	82.5%	54%	115bp	117bp	9%	295.0M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	388258665	No	0.00%	103.9bp	98.0bp	0.01%	0.55%	0.64%	0.00%	0.01%	1.74%	0.96%	0.00%	585569188	0.01%	0.52%	282901793	0.93%	0.96%	0.05%	0.04%	264181677	132084558	14155548	5570964	384.98	157.00	0.68%	0.57%	0.97	0.000				99bp	129bp	52.1%	0.0%	97.4%	85.8%	94.6%	277.0M	21.4%	97.2%	59328.9Mb	585.6M	56.0%	97.6%	86.1%
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_1_1																																	103.9bp	98.3%	287.7M																85.6%	53%	151bp	151bp	27%	546.0M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.7%	55%	151bp	151bp	27%	546.0M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			81.9%	55%	104bp	102bp	18%	292.8M	81.9%	55%	104bp	102bp	18%	292.8M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.6%	56%	104bp	102bp	18%	292.8M	81.6%	56%	104bp	102bp	18%	292.8M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	343127021	No	0.00%	110.8bp	105.0bp	0.00%	0.49%	0.64%	0.00%	0.01%	1.57%	0.95%	0.00%	586600068	0.01%	0.52%	278886771	0.94%	0.96%	0.05%	0.04%	261572318	130879004	12796329	4852946	401.40	160.00	0.69%	0.57%	0.97	0.000				108bp	144bp	52.9%	0.0%	97.6%	86.4%	94.8%	277.9M	25.2%	97.2%	62674.8Mb	586.6M	56.3%	97.8%	82.5%
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_2_1																																	110.8bp	98.5%	288.9M																83.7%	53%	151bp	151bp	27%	339.0M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			82.0%	55%	151bp	151bp	27%	339.0M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			82.9%	55%	110bp	107bp	18%	293.3M	82.9%	55%	110bp	107bp	18%	293.3M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			82.9%	56%	110bp	107bp	9%	293.3M	82.9%	56%	110bp	107bp	9%	293.3M
1173_M2F_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	216262817	No	0.00%	97.7bp	92.0bp	0.03%	0.97%	0.28%	0.00%	0.06%	2.78%	0.44%	0.00%	467330428	0.01%	0.57%	202770699	0.93%	0.95%	0.05%	0.05%	188942467	94565774	10986760	4543894	258.78	116.00	0.70%	0.53%	0.98	0.000				93bp	119bp	57.0%	0.0%	97.2%	86.3%	95.1%	222.1M	19.9%	97.5%	45241.1Mb	467.3M	53.8%	98.8%	89.1%
1173_M2F_T1_RNA_SLD_01_A23T55JLT4_1_1																																	97.7bp	98.2%	229.4M																81.8%	51%	151bp	151bp	27%	236.6M
1173_M2F_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			79.8%	53%	151bp	151bp	27%	236.6M
1173_M2F_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			81.8%	53%	99bp	97bp	18%	233.7M	81.8%	53%	99bp	97bp	18%	233.7M
1173_M2F_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			80.7%	54%	99bp	97bp	9%	233.7M	80.7%	54%	99bp	97bp	9%	233.7M
1173_M4Y_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	65381299	No	0.00%	94.1bp	91.0bp	0.01%	1.09%	0.30%	0.00%	0.01%	3.08%	0.50%	0.00%	295889206	0.01%	0.76%	69815439	0.86%	0.91%	0.10%	0.09%	59737320	29716829	6987108	3042190	69.99	20.00	0.43%	0.19%	0.97	0.000				92bp	105bp	77.2%	0.0%	95.5%	74.9%	91.7%	135.6M	28.4%	96.9%	27453.4Mb	295.9M	61.3%	97.1%	93.0%
1173_M4Y_T1_RNA_SLD_01_A23T55JLT4_1_1																																	94.1bp	96.4%	142.7M																84.9%	56%	151bp	151bp	27%	152.3M
1173_M4Y_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			82.3%	59%	151bp	151bp	36%	152.3M
1173_M4Y_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			85.0%	60%	95bp	92bp	18%	147.9M	85.0%	60%	95bp	92bp	18%	147.9M
1173_M4Y_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			84.4%	61%	96bp	92bp	9%	147.9M	84.4%	61%	96bp	92bp	9%	147.9M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	347228422	No	0.00%	108.9bp	103.0bp	0.02%	0.86%	0.43%	0.00%	0.04%	2.48%	0.65%	0.00%	589805504	0.01%	0.52%	280873270	0.94%	0.96%	0.05%	0.04%	263562106	132048945	13207093	5111913	397.74	186.00	0.73%	0.60%	0.97	0.000				107bp	150bp	52.7%	0.0%	97.4%	84.5%	94.1%	277.6M	24.4%	97.3%	62427.1Mb	589.8M	55.0%	98.3%	83.6%
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_1_1																																	108.9bp	97.9%	288.8M																85.6%	53%	151bp	151bp	27%	459.3M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.9%	54%	151bp	151bp	27%	459.3M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.7%	54%	109bp	107bp	18%	294.9M	82.7%	54%	109bp	107bp	18%	294.9M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.3%	55%	109bp	107bp	9%	294.9M	82.3%	55%	109bp	107bp	9%	294.9M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	228146487	No	0.00%	112.6bp	107.0bp	0.01%	0.80%	0.43%	0.00%	0.02%	2.33%	0.66%	0.00%	572460602	0.01%	0.58%	239783156	0.94%	0.96%	0.05%	0.04%	224209117	112306068	11287289	4248796	343.38	158.00	0.71%	0.58%	0.97	0.000				112bp	161bp	58.6%	0.0%	97.3%	83.6%	93.7%	268.2M	30.6%	97.2%	62281.0Mb	572.5M	55.7%	98.0%	81.3%
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_2_1																																	112.6bp	97.9%	280.2M																84.0%	53%	151bp	151bp	27%	291.9M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			82.5%	54%	151bp	151bp	27%	291.9M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			84.1%	55%	112bp	112bp	18%	286.2M	84.1%	55%	112bp	112bp	18%	286.2M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			84.1%	55%	112bp	112bp	9%	286.2M	84.1%	55%	112bp	112bp	9%	286.2M
1173_MHK_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	360663119	No	0.00%	113.9bp	108.0bp	0.01%	1.00%	0.36%	0.00%	0.03%	3.05%	0.60%	0.00%	588669030	0.01%	0.50%	293638972	0.93%	0.96%	0.05%	0.04%	273111636	136827087	15150308	5973299	424.54	211.00	0.75%	0.63%	0.97	0.000				111bp	152bp	50.6%	0.0%	97.3%	82.8%	93.5%	275.2M	29.7%	97.2%	64183.1Mb	588.7M	55.4%	98.1%	81.4%
1173_MHK_T1_RNA_SLD_01_A23T55JLT4_1_1																																	113.9bp	98.0%	288.5M																85.8%	54%	151bp	151bp	27%	467.0M
1173_MHK_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.9%	55%	151bp	151bp	27%	467.0M
1173_MHK_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.8%	55%	112bp	112bp	18%	294.3M	82.8%	55%	112bp	112bp	18%	294.3M
1173_MHK_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.4%	55%	112bp	112bp	9%	294.3M	82.4%	55%	112bp	112bp	9%	294.3M
1173_N5V_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	238931848	No	0.00%	99.1bp	94.0bp	0.01%	0.90%	0.41%	0.00%	0.02%	2.58%	0.56%	0.00%	402035990	0.01%	0.51%	195765111	0.94%	0.95%	0.05%	0.05%	183192529	91681520	10458857	4395656	250.11	105.00	0.67%	0.51%	0.97	0.000				94bp	115bp	51.6%	0.0%	97.1%	86.4%	94.8%	190.5M	20.4%	97.4%	39273.0Mb	402.0M	52.5%	98.7%	90.0%
1173_N5V_T1_RNA_SLD_01_A23T55JLT4_1_1																																	99.1bp	98.3%	197.5M																81.8%	50%	151bp	151bp	27%	203.7M
1173_N5V_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			80.1%	52%	151bp	151bp	27%	203.7M
1173_N5V_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			81.9%	52%	100bp	97bp	18%	201.0M	81.9%	52%	100bp	97bp	18%	201.0M
1173_N5V_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.1%	52%	100bp	97bp	9%	201.0M	81.1%	52%	100bp	97bp	9%	201.0M
1173_NBF_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	303160188	No	0.00%	105.0bp	99.0bp	0.02%	1.27%	0.50%	0.00%	0.04%	3.48%	0.69%	0.00%	471579430	0.01%	0.51%	232425031	0.94%	0.96%	0.05%	0.04%	217486620	108974062	11138397	4429033	316.01	140.00	0.70%	0.56%	0.98	0.000				100bp	133bp	51.1%	0.0%	97.3%	85.5%	94.5%	222.9M	23.6%	97.4%	48034.0Mb	471.6M	52.4%	98.5%	86.0%
1173_NBF_T1_RNA_SLD_01_A23T55JLT4_1_1																																	105.0bp	98.3%	231.8M																82.3%	51%	151bp	151bp	27%	239.3M
1173_NBF_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			80.4%	53%	151bp	151bp	27%	239.3M
1173_NBF_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.3%	52%	104bp	102bp	18%	235.8M	82.3%	52%	104bp	102bp	18%	235.8M
1173_NBF_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.5%	52%	105bp	102bp	9%	235.8M	81.5%	52%	105bp	102bp	9%	235.8M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	119616085	No	0.00%	99.8bp	95.0bp	0.01%	0.55%	0.26%	0.00%	0.02%	1.73%	0.44%	0.00%	589230716	0.01%	0.76%	140204364	0.88%	0.92%	0.08%	0.08%	123240429	61556153	11671784	5055363	160.08	59.00	0.62%	0.39%	0.97	0.000				97bp	115bp	76.9%	0.0%	96.9%	82.8%	93.9%	276.6M	34.1%	97.2%	58050.1Mb	589.2M	59.3%	98.2%	90.3%
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_1_1																																	99.8bp	97.7%	287.9M																87.7%	55%	151bp	151bp	27%	324.0M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			85.7%	57%	151bp	151bp	27%	324.0M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			87.2%	59%	101bp	97bp	18%	294.6M	87.2%	59%	101bp	97bp	18%	294.6M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			86.6%	59%	102bp	97bp	9%	294.6M	86.6%	59%	102bp	97bp	9%	294.6M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	82458225	No	0.00%	105.2bp	100.0bp	0.01%	0.51%	0.25%	0.00%	0.01%	1.61%	0.43%	0.00%	434487944	0.01%	0.77%	98726812	0.88%	0.93%	0.08%	0.07%	86451150	43152123	8025189	3387362	115.72	42.00	0.57%	0.32%	0.97	0.000				102bp	124bp	78.0%	0.0%	96.7%	81.3%	93.4%	202.9M	47.7%	97.1%	44428.9Mb	434.5M	59.5%	97.7%	87.1%
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_2_1																																	105.2bp	97.6%	212.1M																87.4%	56%	151bp	151bp	27%	222.5M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			85.3%	57%	151bp	151bp	27%	222.5M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			87.5%	59%	105bp	102bp	18%	217.2M	87.5%	59%	105bp	102bp	18%	217.2M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			87.2%	59%	106bp	102bp	9%	217.2M	87.2%	59%	106bp	102bp	9%	217.2M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	365493050	Yes	0.00%	110.2bp	104.0bp	0.01%	1.16%	0.33%	0.00%	0.01%	3.56%	0.56%	0.00%	535830628	0.01%	0.48%	278883915	0.93%	0.96%	0.05%	0.04%	259798634	130015804	14656810	5708534	393.09	197.00	0.75%	0.62%	0.97	0.000				105bp	138bp	48.4%	0.0%	97.0%	83.3%	93.8%	251.2M	22.3%	97.1%	56493.5Mb	535.8M	56.2%	97.9%	82.7%
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_1_1																																	110.2bp	98.1%	262.7M																81.6%	54%	151bp	151bp	27%	273.8M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			79.4%	55%	151bp	151bp	27%	273.8M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			81.6%	55%	108bp	107bp	18%	267.9M	81.6%	55%	108bp	107bp	18%	267.9M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			81.0%	56%	109bp	107bp	9%	267.9M	81.0%	56%	109bp	107bp	9%	267.9M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	278828175	No	0.00%	114.7bp	108.0bp	0.01%	1.02%	0.30%	0.00%	0.01%	3.21%	0.52%	0.00%	515542990	0.01%	0.51%	250240209	0.93%	0.96%	0.05%	0.04%	233206467	116733684	12484451	4698039	362.71	175.00	0.74%	0.60%	0.97	0.000				111bp	147bp	51.9%	0.0%	97.2%	83.5%	93.7%	241.5M	28.3%	97.2%	56144.6Mb	515.5M	56.6%	97.6%	80.2%
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_2_1																																	114.7bp	98.3%	253.4M																83.1%	54%	151bp	151bp	27%	264.0M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			80.7%	56%	151bp	151bp	27%	264.0M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			83.1%	56%	112bp	112bp	18%	257.8M	83.1%	56%	112bp	112bp	18%	257.8M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			82.5%	56%	112bp	112bp	9%	257.8M	82.5%	56%	112bp	112bp	9%	257.8M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	622728202	Yes	0.06%	120.3bp	110.0bp	0.03%	1.56%	0.57%	0.00%	0.05%	4.51%	0.84%	0.00%	591978278	0.01%	0.46%	320990515	0.95%	0.97%	0.04%	0.03%	304202200	152864940	13407217	4728706	523.16	218.00	0.74%	0.62%	0.97	0.000				121bp	226bp	46.0%	0.0%	97.8%	89.0%	95.7%	283.3M	22.7%	97.4%	66643.8Mb	592.0M	53.3%	98.7%	72.7%
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_1_1																																	120.3bp	98.4%	291.3M																87.1%	51%	151bp	151bp	27%	647.6M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			85.5%	53%	151bp	151bp	27%	647.6M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.0%	53%	115bp	117bp	27%	296.0M	83.0%	53%	115bp	117bp	27%	296.0M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.2%	53%	116bp	117bp	9%	296.0M	82.2%	53%	116bp	117bp	9%	296.0M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	630378555	Yes	0.09%	126.7bp	117.0bp	0.01%	1.49%	0.56%	0.00%	0.03%	4.39%	0.85%	0.00%	590787476	0.01%	0.44%	330981188	0.95%	0.97%	0.04%	0.03%	313735638	157707626	13654111	4686734	558.11	244.00	0.74%	0.63%	0.97	0.000				133bp	272bp	44.2%	0.0%	97.8%	89.7%	95.7%	282.7M	25.2%	97.3%	68954.2Mb	590.8M	53.3%	98.5%	69.2%
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_2_1																																	126.7bp	98.4%	290.7M																87.3%	52%	151bp	151bp	27%	609.9M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			85.4%	53%	151bp	151bp	18%	609.9M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			83.3%	52%	120bp	122bp	18%	295.4M	83.3%	52%	120bp	122bp	18%	295.4M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			82.6%	53%	120bp	122bp	9%	295.4M	82.6%	53%	120bp	122bp	9%	295.4M
1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	10154472	Skipped	N/A%	91.9bp	89.0bp	0.01%	0.34%	0.19%	0.00%	0.01%	1.05%	0.29%	0.00%	8725292	0.01%	0.31%	6006273	0.92%	0.94%	0.06%	0.06%	5539565	2769321	367462	164018	6.73	2.00	0.05%	0.01%	0.97	0.000				88bp	98bp	31.5%	0.0%	96.5%	81.5%	93.6%	4.1M	10.8%	97.4%	789.5Mb	8.7M	57.3%	97.9%	94.8%
1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1_1																																	91.9bp	97.0%	4.2M																45.0%	54%	151bp	151bp	18%	4.5M
1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			40.9%	55%	151bp	151bp	27%	4.5M
1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			44.6%	57%	93bp	92bp	9%	4.4M	44.6%	57%	93bp	92bp	9%	4.4M
1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			41.2%	57%	93bp	92bp	0%	4.4M	41.2%	57%	93bp	92bp	0%	4.4M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	268691964	No	0.00%	105.5bp	100.0bp	0.01%	1.18%	0.28%	0.00%	0.03%	3.60%	0.47%	0.00%	210238966	0.01%	0.36%	135598308	0.94%	0.96%	0.05%	0.04%	127926692	64036228	6205100	2546288	184.43	82.00	0.66%	0.46%	0.98	0.000				99bp	125bp	35.8%	0.0%	97.4%	86.4%	94.8%	99.6M	12.7%	97.4%	21370.7Mb	210.2M	53.7%	98.5%	86.8%
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_1_1																																	105.5bp	98.0%	103.0M																68.6%	51%	151bp	151bp	27%	106.8M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			66.3%	53%	151bp	151bp	27%	106.8M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			68.5%	53%	104bp	102bp	18%	105.1M	68.5%	53%	104bp	102bp	18%	105.1M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			67.2%	53%	105bp	102bp	9%	105.1M	67.2%	53%	105bp	102bp	9%	105.1M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	291940231	Yes	0.65%	112.1bp	106.0bp	0.01%	1.06%	0.27%	0.00%	0.01%	3.36%	0.47%	0.00%	461947406	0.01%	0.48%	239685830	0.94%	0.96%	0.05%	0.04%	224187033	112237018	11771296	4693910	340.05	171.00	0.74%	0.60%	0.97	0.000				108bp	140bp	48.5%	0.0%	97.3%	86.2%	94.5%	218.2M	23.4%	97.3%	49590.1Mb	461.9M	54.4%	98.1%	82.7%
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_2_1																																	112.1bp	98.1%	226.7M																76.2%	52%	151bp	151bp	27%	235.3M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			74.8%	54%	151bp	151bp	18%	235.3M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			76.2%	54%	110bp	107bp	18%	231.0M	76.2%	54%	110bp	107bp	18%	231.0M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			76.1%	54%	110bp	107bp	9%	231.0M	76.1%	54%	110bp	107bp	9%	231.0M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	466487892	Yes	0.02%	110.6bp	104.0bp	0.01%	0.96%	0.33%	0.00%	0.01%	2.92%	0.50%	0.00%	588976610	0.01%	0.48%	305942307	0.93%	0.96%	0.05%	0.04%	285324268	142954552	16136348	6468649	443.11	204.00	0.72%	0.61%	0.97	0.000				108bp	148bp	48.4%	0.0%	97.0%	86.8%	94.8%	279.2M	23.0%	97.3%	63114.3Mb	589.0M	53.8%	98.2%	81.3%
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_1_1																																	110.6bp	98.0%	288.7M																85.0%	52%	151bp	151bp	27%	451.2M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.5%	53%	151bp	151bp	27%	451.2M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			82.5%	53%	110bp	107bp	18%	294.5M	82.5%	53%	110bp	107bp	18%	294.5M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.2%	54%	110bp	107bp	9%	294.5M	82.2%	54%	110bp	107bp	9%	294.5M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	369292620	Yes	0.00%	115.5bp	109.0bp	0.00%	0.91%	0.32%	0.00%	0.01%	2.83%	0.48%	0.00%	493511196	0.01%	0.47%	262255556	0.94%	0.96%	0.05%	0.04%	245525383	122929749	12604136	4782767	393.83	180.00	0.71%	0.59%	0.97	0.000				115bp	164bp	47.3%	0.0%	97.1%	86.7%	94.5%	233.3M	24.5%	97.2%	54888.1Mb	493.5M	53.8%	97.9%	78.2%
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_2_1																																	115.5bp	98.3%	242.5M																82.1%	52%	151bp	151bp	27%	252.0M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			80.1%	53%	151bp	151bp	18%	252.0M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			82.1%	53%	114bp	112bp	18%	246.8M	82.1%	53%	114bp	112bp	18%	246.8M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			81.7%	54%	115bp	117bp	9%	246.8M	81.7%	54%	115bp	117bp	9%	246.8M
1173_QEV_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	4302976	Skipped	N/A%	108.4bp	103.0bp	0.00%	0.47%	0.25%	0.00%	0.00%	1.59%	0.51%	0.00%	19648442	0.01%	0.83%	3266824	0.78%	0.86%	0.14%	0.14%	2556621	1269175	467035	205977	3.33	1.00	0.01%	0.00%	0.97	0.000				106bp	130bp	84.4%	0.0%	96.0%	76.3%	91.7%	9.0M	43.6%	96.6%	2038.0Mb	19.6M	61.1%	94.2%	83.8%
1173_QEV_T1_RNA_SLD_01_A23T55JLT4_1_1																																	108.4bp	96.5%	9.5M																83.6%	58%	151bp	151bp	36%	10.4M
1173_QEV_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			81.2%	60%	151bp	151bp	36%	10.4M
1173_QEV_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.2%	60%	107bp	107bp	18%	9.8M	83.2%	60%	107bp	107bp	18%	9.8M
1173_QEV_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.8%	61%	108bp	107bp	18%	9.8M	82.8%	61%	108bp	107bp	18%	9.8M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	273760601	No	0.00%	104.4bp	98.0bp	0.08%	1.30%	0.31%	0.00%	0.16%	3.64%	0.47%	0.00%	309884076	0.01%	0.44%	174638594	0.94%	0.96%	0.05%	0.04%	164460902	82387027	8180976	3254340	238.60	102.00	0.68%	0.50%	0.97	0.000				100bp	132bp	43.9%	0.0%	97.4%	85.1%	94.7%	146.7M	18.4%	97.4%	31492.9Mb	309.9M	54.6%	98.4%	86.2%
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_1_1																																	104.4bp	98.2%	152.2M																77.0%	53%	151bp	151bp	27%	157.4M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			74.6%	54%	151bp	151bp	27%	157.4M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			77.0%	54%	104bp	102bp	18%	154.9M	77.0%	54%	104bp	102bp	18%	154.9M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			75.8%	54%	105bp	102bp	9%	154.9M	75.8%	54%	105bp	102bp	9%	154.9M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	282429261	No	0.00%	108.2bp	102.0bp	0.05%	1.21%	0.31%	0.00%	0.09%	3.47%	0.48%	0.00%	478513910	0.01%	0.51%	236609189	0.94%	0.96%	0.05%	0.04%	221534390	110986634	11573993	4494417	330.54	151.00	0.72%	0.58%	0.98	0.000				105bp	144bp	50.9%	0.0%	97.3%	84.4%	94.3%	225.5M	23.5%	97.4%	50393.8Mb	478.5M	55.8%	98.2%	83.5%
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_2_1																																	108.2bp	98.2%	235.0M																80.8%	53%	151bp	151bp	27%	243.7M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			78.4%	55%	151bp	151bp	27%	243.7M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			80.8%	55%	108bp	107bp	18%	239.3M	80.8%	55%	108bp	107bp	18%	239.3M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			79.7%	56%	108bp	107bp	9%	239.3M	79.7%	56%	108bp	107bp	9%	239.3M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	97887647	No	0.00%	108.2bp	105.0bp	0.01%	0.89%	0.35%	0.00%	0.01%	2.72%	0.60%	0.00%	552270522	0.01%	0.79%	117615979	0.86%	0.92%	0.09%	0.08%	101336332	50591550	10415135	4513879	136.82	48.00	0.59%	0.34%	0.97	0.000				108bp	131bp	79.5%	0.0%	96.7%	82.3%	93.4%	257.8M	43.3%	97.1%	58435.8Mb	552.3M	59.6%	98.0%	86.7%
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_1_1																																	108.2bp	97.5%	269.1M																86.5%	56%	151bp	151bp	27%	281.7M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			84.7%	58%	151bp	151bp	18%	281.7M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			86.6%	59%	109bp	107bp	18%	276.1M	86.6%	59%	109bp	107bp	18%	276.1M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			86.2%	59%	109bp	107bp	9%	276.1M	86.2%	59%	109bp	107bp	9%	276.1M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	56065518	No	0.00%	102.4bp	99.0bp	0.01%	0.87%	0.35%	0.00%	0.01%	2.64%	0.60%	0.00%	274799746	0.01%	0.76%	66574347	0.87%	0.92%	0.09%	0.08%	57602821	28751337	5791518	2517891	74.98	25.00	0.47%	0.20%	0.97	0.000				101bp	121bp	76.7%	0.0%	96.5%	80.7%	92.9%	127.6M	39.7%	97.1%	27679.5Mb	274.8M	59.8%	97.8%	89.2%
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_2_1																																	102.4bp	97.1%	133.5M																84.5%	56%	151bp	151bp	27%	140.4M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			82.4%	57%	151bp	151bp	27%	140.4M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			84.5%	59%	103bp	102bp	18%	137.4M	84.5%	59%	103bp	102bp	18%	137.4M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			84.1%	60%	104bp	102bp	9%	137.4M	84.1%	60%	104bp	102bp	9%	137.4M
1173_RGW_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	32719055	No	0.00%	94.2bp	92.0bp	0.00%	0.37%	0.24%	0.00%	0.00%	1.28%	0.51%	0.00%	215545380	0.02%	0.85%	31903297	0.76%	0.86%	0.13%	0.14%	24266103	12059699	4245914	1910350	28.05	4.00	0.19%	0.06%	0.97	0.000				94bp	107bp	86.6%	0.0%	95.3%	67.2%	88.5%	95.3M	38.5%	96.7%	20064.7Mb	215.5M	65.5%	97.5%	92.9%
1173_RGW_T1_RNA_SLD_01_A23T55JLT4_1_1																																	94.2bp	95.0%	102.4M																87.9%	60%	151bp	151bp	27%	110.5M
1173_RGW_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			85.6%	61%	151bp	151bp	27%	110.5M
1173_RGW_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			88.1%	65%	96bp	92bp	18%	107.8M	88.1%	65%	96bp	92bp	18%	107.8M
1173_RGW_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			87.4%	65%	97bp	97bp	9%	107.8M	87.4%	65%	97bp	97bp	9%	107.8M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	104874615	No	0.00%	99.7bp	95.0bp	0.02%	1.45%	0.60%	0.00%	0.04%	4.02%	0.84%	0.00%	54903478	0.01%	0.28%	39647624	0.95%	0.97%	0.04%	0.03%	37690621	18870104	1599203	647867	51.50	15.00	0.38%	0.14%	0.97	0.000				95bp	123bp	28.0%	0.0%	97.8%	86.8%	95.2%	26.1M	11.7%	97.4%	5361.9Mb	54.9M	53.0%	98.5%	90.4%
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_1_1																																	99.7bp	98.3%	27.0M																60.6%	51%	151bp	151bp	27%	27.9M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			57.0%	53%	151bp	151bp	27%	27.9M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			60.5%	52%	100bp	97bp	18%	27.5M	60.5%	52%	100bp	97bp	18%	27.5M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			57.6%	53%	100bp	97bp	9%	27.5M	57.6%	53%	100bp	97bp	9%	27.5M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	183787634	No	0.00%	102.4bp	97.0bp	0.01%	1.38%	0.62%	0.00%	0.02%	3.94%	0.88%	0.00%	559664924	0.01%	0.63%	206892507	0.93%	0.96%	0.05%	0.04%	192898054	96486050	10041529	3973160	268.78	108.00	0.65%	0.51%	0.98	0.000				99bp	131bp	63.5%	0.0%	97.9%	87.0%	95.0%	265.9M	28.5%	97.4%	56211.9Mb	559.7M	53.7%	98.3%	88.9%
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_2_1																																	102.4bp	98.5%	275.6M																83.7%	51%	151bp	151bp	27%	284.7M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			81.7%	53%	151bp	151bp	27%	284.7M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			83.7%	53%	103bp	102bp	18%	279.8M	83.7%	53%	103bp	102bp	18%	279.8M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			83.0%	53%	103bp	102bp	9%	279.8M	83.0%	53%	103bp	102bp	9%	279.8M
1173_RPX_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	369972839	No	0.00%	111.2bp	106.0bp	0.02%	1.13%	0.50%	0.00%	0.04%	3.31%	0.77%	0.00%	589678722	0.01%	0.51%	285996753	0.94%	0.97%	0.04%	0.03%	269197911	134868330	12635741	4783882	414.42	177.00	0.71%	0.59%	0.97	0.000				111bp	156bp	51.9%	0.0%	97.6%	85.0%	94.3%	278.2M	25.7%	97.2%	63788.4Mb	589.7M	55.4%	98.3%	82.6%
1173_RPX_T1_RNA_SLD_01_A23T55JLT4_1_1																																	111.2bp	98.4%	290.1M																84.1%	53%	151bp	151bp	27%	359.3M
1173_RPX_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			82.2%	55%	151bp	151bp	27%	359.3M
1173_RPX_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.0%	55%	111bp	112bp	18%	294.8M	83.0%	55%	111bp	112bp	18%	294.8M
1173_RPX_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.3%	55%	111bp	112bp	9%	294.8M	82.3%	55%	111bp	112bp	9%	294.8M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	129033287	No	0.00%	101.5bp	97.0bp	0.01%	0.94%	0.56%	0.00%	0.01%	2.89%	0.88%	0.00%	535352092	0.01%	0.72%	147337300	0.89%	0.93%	0.07%	0.07%	131751725	65723092	11045198	4629182	173.60	65.00	0.62%	0.41%	0.97	0.000				102bp	136bp	73.1%	0.0%	96.7%	83.4%	94.0%	251.6M	34.1%	97.2%	53711.9Mb	535.4M	58.5%	97.5%	88.3%
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_1_1																																	101.5bp	97.8%	261.8M																85.8%	54%	151bp	151bp	27%	274.6M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.8%	56%	151bp	151bp	27%	274.6M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			85.8%	58%	103bp	102bp	18%	267.7M	85.8%	58%	103bp	102bp	18%	267.7M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			85.9%	58%	103bp	102bp	18%	267.7M	85.9%	58%	103bp	102bp	18%	267.7M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	77981001	No	0.00%	106.0bp	101.0bp	0.01%	0.87%	0.54%	0.00%	0.01%	2.69%	0.86%	0.00%	381193030	0.01%	0.77%	88468794	0.88%	0.93%	0.08%	0.07%	78082724	38975830	7045580	2970596	106.41	37.00	0.54%	0.29%	0.97	0.000				108bp	147bp	77.5%	0.0%	96.7%	83.7%	94.1%	179.3M	40.1%	97.0%	39658.6Mb	381.2M	58.4%	97.7%	86.3%
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_2_1																																	106.0bp	97.8%	186.4M																86.6%	55%	151bp	151bp	27%	195.0M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			84.5%	57%	151bp	151bp	27%	195.0M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			86.7%	58%	107bp	107bp	18%	190.6M	86.7%	58%	107bp	107bp	18%	190.6M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			86.3%	58%	107bp	107bp	9%	190.6M	86.3%	58%	107bp	107bp	9%	190.6M
1173_S9Q_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	238579475	No	0.00%	114.1bp	109.0bp	0.01%	0.68%	0.38%	0.00%	0.01%	2.13%	0.60%	0.00%	589432784	0.01%	0.58%	246915028	0.93%	0.96%	0.05%	0.04%	229696917	115111961	12183363	4705969	354.68	156.00	0.73%	0.58%	0.97	0.000				114bp	154bp	58.6%	0.0%	97.2%	84.4%	94.1%	277.4M	35.4%	97.1%	64797.2Mb	589.4M	57.8%	98.2%	81.1%
1173_S9Q_T1_RNA_SLD_01_A23T55JLT4_1_1																																	114.1bp	98.1%	289.2M																84.9%	56%	151bp	151bp	27%	303.9M
1173_S9Q_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			82.8%	56%	151bp	151bp	18%	303.9M
1173_S9Q_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			84.9%	57%	113bp	112bp	18%	294.7M	84.9%	57%	113bp	112bp	18%	294.7M
1173_S9Q_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			84.1%	58%	113bp	112bp	9%	294.7M	84.1%	58%	113bp	112bp	9%	294.7M
1173_SDP_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	149938835	No	0.00%	98.8bp	95.0bp	0.01%	0.63%	0.38%	0.00%	0.01%	2.03%	0.61%	0.00%	591418434	0.01%	0.69%	183749541	0.92%	0.95%	0.06%	0.05%	169270249	84613447	10394759	4333210	225.69	95.00	0.68%	0.49%	0.97	0.000				99bp	129bp	69.4%	0.0%	97.7%	86.8%	95.2%	281.6M	30.4%	97.3%	58221.6Mb	591.4M	56.5%	98.6%	91.0%
1173_SDP_T1_RNA_SLD_01_A23T55JLT4_1_1																																	98.8bp	98.5%	291.2M																87.0%	53%	151bp	151bp	27%	363.2M
1173_SDP_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			85.3%	55%	151bp	151bp	27%	363.2M
1173_SDP_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			85.7%	56%	101bp	97bp	18%	295.7M	85.7%	56%	101bp	97bp	18%	295.7M
1173_SDP_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			85.0%	56%	101bp	97bp	9%	295.7M	85.0%	56%	101bp	97bp	9%	295.7M
1173_SFA_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	9380287	No	0.00%	131.7bp	121.0bp	0.01%	0.66%	0.24%	0.00%	0.01%	2.31%	0.48%	0.00%	69311912	0.01%	0.88%	8171081	0.79%	0.87%	0.13%	0.13%	6477432	3228521	1095399	464260	10.28	3.00	0.08%	0.01%	0.97	0.000				127bp	180bp	89.0%	0.0%	96.8%	78.3%	92.1%	31.9M	60.7%	97.0%	8164.5Mb	69.3M	58.6%	97.2%	68.3%
1173_SFA_T1_RNA_SLD_01_A23T55JLT4_1_1																																	131.7bp	97.6%	33.8M																88.6%	56%	151bp	151bp	27%	35.7M
1173_SFA_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			86.3%	58%	151bp	151bp	27%	35.7M
1173_SFA_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			88.7%	58%	121bp	127bp	9%	34.7M	88.7%	58%	121bp	127bp	9%	34.7M
1173_SFA_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			88.1%	58%	122bp	127bp	9%	34.7M	88.1%	58%	122bp	127bp	9%	34.7M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	492615446	No	0.00%	113.5bp	106.0bp	0.03%	1.11%	0.42%	0.00%	0.05%	3.15%	0.64%	0.00%	590162368	0.01%	0.47%	310153306	0.94%	0.96%	0.05%	0.04%	291385394	146158049	14188527	5324636	467.34	239.00	0.78%	0.65%	0.97	0.000				110bp	164bp	47.8%	0.0%	97.3%	83.7%	94.3%	278.3M	22.6%	97.2%	63874.1Mb	590.2M	54.5%	98.4%	78.8%
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_1_1																																	113.5bp	97.9%	288.8M																84.7%	53%	151bp	151bp	27%	372.8M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			82.5%	54%	151bp	151bp	27%	372.8M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			83.4%	54%	111bp	112bp	18%	295.1M	83.4%	54%	111bp	112bp	18%	295.1M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			82.3%	54%	112bp	112bp	9%	295.1M	82.3%	54%	112bp	112bp	9%	295.1M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	410428532	No	0.00%	123.5bp	116.0bp	0.01%	1.02%	0.41%	0.00%	0.03%	2.99%	0.62%	0.00%	408413764	0.01%	0.41%	241890484	0.94%	0.97%	0.04%	0.03%	228387373	114649757	10051521	3513201	390.57	198.00	0.76%	0.63%	0.97	0.000				125bp	204bp	41.1%	0.0%	97.3%	86.1%	94.5%	192.9M	22.7%	97.2%	47239.5Mb	408.4M	55.1%	98.1%	72.3%
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_2_1																																	123.5bp	98.1%	200.3M																80.8%	53%	151bp	151bp	27%	208.2M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			78.8%	55%	151bp	151bp	18%	208.2M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			80.9%	54%	119bp	122bp	18%	204.2M	80.9%	54%	119bp	122bp	18%	204.2M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			80.3%	55%	119bp	122bp	9%	204.2M	80.3%	55%	119bp	122bp	9%	204.2M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_1	9999000000	141616493	No	0.00%	108.6bp	104.0bp	0.00%	0.98%	0.29%	0.00%	0.01%	3.06%	0.48%	0.00%	590624724	0.01%	0.76%	139728825	0.90%	0.94%	0.07%	0.06%	125752249	62901851	9435206	3860639	176.14	53.00	0.59%	0.38%	0.97	0.000				109bp	154bp	76.9%	0.0%	97.4%	82.7%	94.2%	278.0M	39.2%	96.9%	62566.3Mb	590.6M	56.0%	98.4%	84.1%
1173_T46_T1_RNA_SLD_01_A23T55JLT4_1_1																																	108.6bp	98.0%	289.4M																85.9%	53%	151bp	151bp	27%	314.7M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_1_2																																																			83.4%	55%	151bp	151bp	27%	314.7M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_1																																																			85.7%	55%	109bp	107bp	18%	295.3M	85.7%	55%	109bp	107bp	18%	295.3M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_1_trimmed_2																																																			84.2%	56%	109bp	107bp	18%	295.3M	84.2%	56%	109bp	107bp	18%	295.3M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_2	9999000000	96735325	No	0.00%	106.8bp	101.0bp	0.00%	0.93%	0.29%	0.00%	0.00%	2.98%	0.49%	0.00%	544744504	0.01%	0.78%	118341229	0.90%	0.95%	0.06%	0.05%	106384653	53121844	7582049	3000221	148.85	46.00	0.57%	0.35%	0.97	0.000				108bp	156bp	78.9%	0.0%	97.5%	84.5%	94.3%	256.9M	48.2%	97.2%	57140.0Mb	544.7M	56.3%	97.9%	84.9%
1173_T46_T1_RNA_SLD_01_A23T55JLT4_2_1																																	106.8bp	98.3%	267.8M																87.6%	54%	151bp	151bp	27%	278.2M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_2_2																																																			84.7%	55%	151bp	151bp	27%	278.2M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_1																																																			87.7%	55%	108bp	107bp	18%	272.4M	87.7%	55%	108bp	107bp	18%	272.4M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_2_trimmed_2																																																			86.5%	56%	108bp	107bp	18%	272.4M	86.5%	56%	108bp	107bp	18%	272.4M
FFPE_HD789_01_RNA_13_A23T55JLT4_1	9999000000	531926337	Yes	62.05%	175.8bp	158.0bp	0.01%	1.71%	0.76%	0.00%	0.01%	4.92%	1.09%	0.00%	588609644	0.01%	0.41%	347473501	0.95%	0.98%	0.04%	0.02%	328636355	166504100	15211665	3654097	729.01	298.00	0.72%	0.62%	0.97	0.000				315bp	932bp	41.2%	0.0%	97.6%	90.2%	95.9%	282.3M	29.8%	97.1%	78183.0Mb	588.6M	54.1%	98.1%	39.0%
FFPE_HD789_01_RNA_13_A23T55JLT4_1_1																																	175.8bp	98.3%	289.2M																88.5%	53%	151bp	151bp	18%	604.3M
FFPE_HD789_01_RNA_13_A23T55JLT4_1_2																																																			87.0%	54%	151bp	151bp	18%	604.3M
FFPE_HD789_01_RNA_13_A23T55JLT4_1_trimmed_1																																																			84.3%	53%	137bp	151bp	9%	294.3M	84.3%	53%	137bp	151bp	9%	294.3M
FFPE_HD789_01_RNA_13_A23T55JLT4_1_trimmed_2																																																			84.7%	54%	137bp	151bp	9%	294.3M	84.7%	54%	137bp	151bp	9%	294.3M
FFPE_V4_0002_RNA_0001_A23T55JLT4_1	9999000000	287762206	No	0.00%	160.2bp	146.0bp	0.01%	1.80%	1.18%	0.00%	0.01%	4.90%	1.62%	0.00%	587997246	0.01%	0.52%	280285138	0.93%	0.97%	0.05%	0.03%	261377061	132423352	14609510	4066066	541.37	135.00	0.60%	0.52%	0.97	0.000				224bp	590bp	52.7%	0.0%	96.8%	89.5%	95.6%	281.0M	37.4%	97.1%	76255.1Mb	588.0M	54.2%	98.0%	45.7%
FFPE_V4_0002_RNA_0001_A23T55JLT4_1_1																																	160.2bp	97.4%	286.4M																87.2%	53%	151bp	151bp	18%	356.2M
FFPE_V4_0002_RNA_0001_A23T55JLT4_1_2																																																			85.8%	54%	151bp	151bp	18%	356.2M
FFPE_V4_0002_RNA_0001_A23T55JLT4_1_trimmed_1																																																			86.2%	53%	134bp	151bp	9%	294.0M	86.2%	53%	134bp	151bp	9%	294.0M
FFPE_V4_0002_RNA_0001_A23T55JLT4_1_trimmed_2																																																			86.4%	54%	134bp	151bp	9%	294.0M	86.4%	54%	134bp	151bp	9%	294.0M
NTC_0001_0001_A23T55JLT4_1	9999000000	2116	Skipped	N/A%	91.5bp	100.0bp	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	0.00%	1444	0.44%	0.22%	1129	0.08%	0.20%	0.35%	0.80%	91	47	398	188	0.00	0.00	0.00%	0.00%	0.94	0.000				33bp	51bp	39.2%	0.3%	45.3%	4.7%	17.7%	0.0M	29.4%	89.0%	0.1Mb	0.0M	68.5%	4.1%	50.8%
NTC_0001_0001_A23T55JLT4_1_1																																	91.5bp	19.4%	0.0M																94.8%	73%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23T55JLT4_1_2																																																			95.2%	98%	151bp	151bp	55%	0.0M
NTC_0001_0001_A23T55JLT4_1_trimmed_1																																																			32.1%	64%	92bp	92bp	45%	0.0M	32.1%	64%	92bp	92bp	45%	0.0M
NTC_0001_0001_A23T55JLT4_1_trimmed_2																																																			39.9%	71%	95bp	97bp	45%	0.0M	39.9%	71%	95bp	97bp	45%	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
1173_9C_T1_RNA_SLD_01_A23T55JLT4_1	659.7M	0.0M	0.0M	68.2M	4.5M	560.6M	280.5M	280.1M	280.4M	280.3M	349.4M	211.2M	558.3M	0.0M
1173_BEE_T1_RNA_SLD_01_A23T55JLT4_1	639.4M	0.0M	0.0M	71.6M	4.5M	533.1M	266.7M	266.4M	266.6M	266.5M	341.0M	192.1M	531.0M	0.0M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_1	228.1M	0.0M	0.0M	21.7M	1.5M	195.7M	97.9M	97.8M	97.9M	97.8M	117.5M	78.2M	195.0M	0.0M
1173_C31_T1_RNA_SLD_01_A23T55JLT4_2	339.7M	0.0M	0.0M	32.6M	2.5M	290.2M	145.2M	145.0M	145.1M	145.1M	173.7M	116.5M	289.1M	0.0M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_1	74.3M	0.0M	0.0M	7.5M	0.5M	63.4M	31.8M	31.7M	31.7M	31.7M	42.8M	20.7M	63.2M	0.0M
1173_CH0_T1_RNA_SLD_01_A23T55JLT4_2	388.4M	0.0M	0.0M	41.1M	2.7M	329.0M	164.7M	164.3M	164.6M	164.5M	222.3M	106.7M	327.7M	0.0M
1173_CI9_T1_RNA_SLD_01_A23T55JLT4_1	544.1M	0.0M	0.0M	53.4M	3.9M	466.4M	233.3M	233.1M	233.2M	233.1M	310.8M	155.6M	465.1M	0.0M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_1	646.4M	0.0M	0.0M	52.7M	4.0M	567.0M	283.6M	283.4M	283.5M	283.4M	333.3M	233.6M	564.6M	0.0M
1173_CRL_T1_RNA_SLD_01_A23T55JLT4_2	644.6M	0.0M	0.0M	52.2M	4.5M	565.1M	282.7M	282.4M	282.6M	282.5M	322.9M	242.2M	562.7M	0.0M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_1	25.3M	0.0M	0.0M	2.5M	0.2M	21.7M	10.9M	10.9M	10.9M	10.9M	13.4M	8.3M	21.6M	0.0M
1173_CRX_T1_RNA_SLD_01_A23T55JLT4_2	652.1M	0.0M	0.0M	62.0M	4.4M	561.6M	281.1M	280.5M	280.9M	280.7M	333.0M	228.6M	559.3M	0.0M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_1	635.3M	0.0M	0.0M	41.6M	3.6M	572.8M	286.4M	286.3M	286.4M	286.3M	300.6M	272.2M	570.2M	0.0M
1173_D6K_T1_RNA_SLD_01_A23T55JLT4_2	630.6M	0.0M	0.0M	38.3M	3.9M	571.7M	286.0M	285.7M	285.9M	285.8M	287.5M	284.2M	569.0M	0.0M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_1	696.1M	0.0M	0.0M	104.0M	4.0M	545.1M	272.6M	272.5M	272.6M	272.5M	343.9M	201.2M	543.4M	0.0M
1173_DSO_T1_RNA_SLD_01_A23T55JLT4_2	484.8M	0.0M	0.0M	70.1M	3.2M	381.6M	191.0M	190.7M	190.9M	190.8M	226.9M	154.7M	380.0M	0.0M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_1	688.2M	0.0M	0.0M	95.6M	3.9M	549.9M	275.1M	274.8M	275.0M	274.9M	338.1M	211.8M	548.3M	0.0M
1173_F0Y_T1_RNA_SLD_01_A23T55JLT4_2	679.7M	0.0M	0.0M	103.6M	4.7M	531.3M	265.9M	265.3M	265.7M	265.6M	319.9M	211.3M	529.2M	0.0M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_1	666.8M	0.0M	0.0M	76.6M	4.7M	558.6M	279.5M	279.2M	279.4M	279.2M	350.5M	208.1M	556.7M	0.0M
1173_FM_T1_RNA_SLD_01_A23T55JLT4_2	667.5M	0.0M	0.0M	78.2M	5.6M	556.6M	278.6M	278.0M	278.4M	278.2M	332.3M	224.3M	554.0M	0.0M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_1	657.8M	0.0M	0.0M	67.0M	4.6M	558.2M	279.3M	278.9M	279.2M	279.0M	322.1M	236.1M	556.2M	0.0M
1173_FWA_T1_RNA_SLD_01_A23T55JLT4_2	0.1M	0.0M	0.0M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_1	680.8M	0.0M	0.0M	90.4M	5.5M	552.1M	276.4M	275.7M	276.1M	276.0M	381.6M	170.5M	550.2M	0.0M
1173_G2E_T1_RNA_SLD_01_A23T55JLT4_2	655.3M	0.0M	0.0M	88.8M	5.7M	528.2M	264.5M	263.8M	264.1M	264.1M	357.5M	170.7M	526.3M	0.0M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_1	659.2M	0.0M	0.0M	75.4M	7.4M	545.5M	273.0M	272.5M	272.8M	272.7M	357.2M	188.3M	543.3M	0.0M
1173_GFO_T1_RNA_SLD_01_A23T55JLT4_2	549.6M	0.0M	0.0M	63.6M	6.9M	452.8M	226.7M	226.1M	226.5M	226.3M	297.3M	155.5M	450.8M	0.0M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_1	651.7M	0.0M	0.0M	59.6M	4.1M	564.9M	282.6M	282.3M	282.5M	282.4M	375.7M	189.1M	563.0M	0.0M
1173_GXL_T1_RNA_SLD_01_A23T55JLT4_2	628.8M	0.0M	0.0M	60.6M	4.4M	540.9M	270.7M	270.2M	270.5M	270.4M	348.4M	192.5M	538.8M	0.0M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_1	34.2M	0.0M	0.0M	3.2M	0.2M	29.4M	14.7M	14.7M	14.7M	14.7M	18.0M	11.4M	29.3M	0.0M
1173_GZ1_T1_RNA_SLD_01_A23T55JLT4_2	623.2M	0.0M	0.0M	60.1M	5.2M	533.4M	266.9M	266.5M	266.8M	266.6M	318.5M	214.9M	531.5M	0.0M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_1	646.3M	0.0M	0.0M	55.3M	4.6M	564.1M	282.1M	282.0M	282.1M	282.0M	341.9M	222.2M	562.2M	0.0M
1173_H2E_T1_RNA_SLD_01_A23T55JLT4_2	641.7M	0.0M	0.0M	50.9M	5.0M	564.6M	282.4M	282.2M	282.4M	282.2M	322.4M	242.2M	562.4M	0.0M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_1	668.4M	0.0M	0.0M	76.3M	4.2M	558.4M	279.3M	279.1M	279.3M	279.2M	337.3M	221.2M	556.6M	0.0M
1173_HOB_T1_RNA_SLD_01_A23T55JLT4_2	543.2M	0.0M	0.0M	65.1M	3.7M	449.6M	225.0M	224.6M	224.9M	224.7M	267.6M	182.0M	447.8M	0.0M
1173_HRO_T1_RNA_SLD_01_A23T55JLT4_1	664.8M	0.0M	0.0M	73.3M	4.2M	555.9M	278.1M	277.8M	278.0M	277.9M	345.8M	210.1M	554.3M	0.0M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_1	600.2M	0.0M	0.0M	75.9M	3.5M	497.5M	248.8M	248.7M	248.8M	248.7M	322.4M	175.2M	496.5M	0.0M
1173_IT6_T1_RNA_SLD_01_A23T55JLT4_2	336.3M	0.0M	0.0M	34.7M	2.2M	287.2M	143.7M	143.5M	143.6M	143.6M	182.0M	105.3M	286.3M	0.0M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_1	553.1M	0.0M	0.0M	78.6M	3.3M	444.3M	222.2M	222.0M	222.2M	222.1M	316.1M	128.1M	443.0M	0.0M
1173_J3R_T1_RNA_SLD_01_A23T55JLT4_2	412.2M	0.0M	0.0M	60.4M	2.8M	328.4M	164.4M	164.0M	164.2M	164.2M	223.8M	104.6M	327.0M	0.0M
1173_JIG_T1_RNA_SLD_01_A23T55JLT4_1	187.0M	0.0M	0.0M	130.8M	1.5M	35.2M	17.6M	17.6M	17.6M	17.6M	24.4M	10.8M	35.0M	0.0M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_1	648.2M	0.0M	0.0M	55.6M	4.5M	565.2M	282.7M	282.5M	282.6M	282.5M	323.2M	242.0M	562.9M	0.0M
1173_JLC_T1_RNA_SLD_01_A23T55JLT4_2	646.7M	0.0M	0.0M	54.7M	4.9M	564.3M	282.3M	282.0M	282.2M	282.1M	310.2M	254.1M	561.6M	0.0M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_1	618.1M	0.0M	0.0M	82.6M	3.6M	507.9M	254.0M	253.9M	254.0M	253.9M	281.5M	226.4M	505.9M	0.0M
1173_JXL_T1_RNA_SLD_01_A23T55JLT4_2	646.6M	0.0M	0.0M	53.7M	3.8M	568.1M	284.1M	284.0M	284.1M	284.0M	306.1M	262.0M	565.8M	0.0M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_1	32.0M	0.0M	0.0M	3.5M	0.2M	27.0M	13.5M	13.5M	13.5M	13.5M	19.7M	7.2M	26.9M	0.0M
1173_K3O_T1_RNA_SLD_01_A23T55JLT4_2	334.5M	0.0M	0.0M	38.6M	2.9M	278.8M	139.6M	139.2M	139.4M	139.4M	199.3M	79.5M	277.6M	0.0M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_1	658.9M	0.0M	0.0M	65.8M	3.5M	563.2M	281.7M	281.5M	281.6M	281.5M	372.2M	190.9M	561.6M	0.0M
1173_K7E_T1_RNA_SLD_01_A23T55JLT4_2	482.1M	0.0M	0.0M	50.0M	3.0M	409.4M	204.8M	204.6M	204.8M	204.7M	268.0M	141.5M	408.0M	0.0M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_1	319.9M	0.0M	0.0M	25.2M	1.6M	282.9M	141.5M	141.4M	141.5M	141.4M	163.9M	119.1M	281.9M	0.0M
1173_KQG_T1_RNA_SLD_01_A23T55JLT4_2	641.5M	0.0M	0.0M	47.5M	3.7M	570.6M	285.5M	285.1M	285.4M	285.2M	315.4M	255.2M	568.2M	0.0M
1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1	26.6M	0.0M	0.0M	5.9M	0.2M	18.8M	9.4M	9.4M	9.4M	9.4M	13.4M	5.4M	18.7M	0.0M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_1	652.5M	0.0M	0.0M	58.3M	4.3M	565.9M	283.0M	282.9M	283.0M	282.9M	365.7M	200.2M	564.6M	0.0M
1173_KTN_T1_RNA_SLD_01_A23T55JLT4_2	488.2M	0.0M	0.0M	44.1M	3.6M	422.6M	211.5M	211.2M	211.4M	211.3M	264.3M	158.3M	421.1M	0.0M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_1	219.0M	0.0M	0.0M	126.1M	1.4M	69.7M	34.9M	34.8M	34.8M	34.8M	51.1M	18.6M	69.5M	0.0M
1173_LAF_T1_RNA_SLD_01_A23T55JLT4_2	309.8M	0.0M	0.0M	148.5M	2.1M	131.1M	65.6M	65.5M	65.5M	65.5M	93.4M	37.7M	130.7M	0.0M
1173_LQD_T1_RNA_SLD_01_A23T55JLT4_1	651.1M	0.0M	0.0M	58.2M	4.6M	566.4M	283.3M	283.1M	283.2M	283.1M	328.8M	237.6M	564.2M	0.0M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_1	650.5M	0.0M	0.0M	61.9M	4.6M	560.8M	280.6M	280.2M	280.4M	280.3M	368.0M	192.8M	558.3M	0.0M
1173_LV7_T1_RNA_SLD_01_A23T55JLT4_2	648.3M	0.0M	0.0M	58.8M	4.5M	562.4M	281.5M	280.9M	281.3M	281.1M	358.2M	204.2M	560.0M	0.0M
1173_M2F_T1_RNA_SLD_01_A23T55JLT4_1	516.4M	0.0M	0.0M	47.7M	2.8M	446.9M	223.5M	223.4M	223.5M	223.4M	297.1M	149.8M	445.9M	0.0M
1173_M4Y_T1_RNA_SLD_01_A23T55JLT4_1	365.3M	0.0M	0.0M	67.5M	3.1M	274.9M	137.7M	137.2M	137.4M	137.4M	205.5M	69.4M	273.5M	0.0M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_1	660.9M	0.0M	0.0M	68.6M	4.1M	560.6M	280.5M	280.2M	280.4M	280.2M	343.7M	216.9M	558.6M	0.0M
1173_M5U_T1_RNA_SLD_01_A23T55JLT4_2	646.2M	0.0M	0.0M	70.9M	4.3M	542.7M	271.6M	271.1M	271.4M	271.3M	325.7M	216.9M	540.4M	0.0M
1173_MHK_T1_RNA_SLD_01_A23T55JLT4_1	669.6M	0.0M	0.0M	78.0M	5.4M	556.7M	278.6M	278.1M	278.4M	278.3M	346.0M	210.7M	554.5M	0.0M
1173_N5V_T1_RNA_SLD_01_A23T55JLT4_1	443.3M	0.0M	0.0M	39.9M	2.1M	383.9M	192.0M	191.9M	192.0M	191.9M	261.2M	122.7M	382.8M	0.0M
1173_NBF_T1_RNA_SLD_01_A23T55JLT4_1	524.1M	0.0M	0.0M	50.9M	3.8M	449.1M	224.6M	224.5M	224.6M	224.5M	284.6M	164.5M	447.9M	0.0M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_1	672.8M	0.0M	0.0M	80.7M	5.3M	559.2M	280.0M	279.3M	279.7M	279.6M	396.8M	162.4M	557.0M	0.0M
1173_NFO_T1_RNA_SLD_01_A23T55JLT4_2	502.9M	0.0M	0.0M	66.1M	4.3M	410.7M	205.7M	205.0M	205.4M	205.3M	286.5M	124.2M	408.9M	0.0M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_1	607.6M	0.0M	0.0M	69.1M	4.4M	508.1M	254.3M	253.9M	254.1M	254.0M	333.6M	174.5M	506.0M	0.0M
1173_NMN_T1_RNA_SLD_01_A23T55JLT4_2	582.8M	0.0M	0.0M	64.8M	4.5M	488.5M	244.5M	244.0M	244.3M	244.2M	316.5M	172.0M	486.5M	0.0M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_1	640.6M	0.0M	0.0M	46.3M	3.4M	571.7M	285.9M	285.8M	285.9M	285.8M	318.2M	253.5M	569.9M	0.0M
1173_NWE_T1_RNA_SLD_01_A23T55JLT4_2	634.9M	0.0M	0.0M	41.6M	3.6M	571.4M	285.8M	285.6M	285.8M	285.7M	304.7M	266.8M	569.2M	0.0M
1173_OHF_T1_RNA_SLD_01_A23T55JLT4_1	10.1M	0.0M	0.0M	1.3M	0.1M	8.2M	4.1M	4.1M	4.1M	4.1M	6.3M	1.9M	8.2M	0.0M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_1	231.8M	0.0M	0.0M	20.7M	1.5M	201.1M	100.6M	100.5M	100.6M	100.5M	135.0M	66.1M	200.4M	0.0M
1173_PCB_T1_RNA_SLD_01_A23T55JLT4_2	510.3M	0.0M	0.0M	46.1M	3.7M	441.5M	221.0M	220.6M	220.8M	220.7M	287.3M	154.2M	439.7M	0.0M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_1	648.4M	0.0M	0.0M	56.3M	4.5M	565.7M	283.0M	282.7M	282.9M	282.8M	357.7M	208.0M	563.1M	0.0M
1173_Q7O_T1_RNA_SLD_01_A23T55JLT4_2	543.4M	0.0M	0.0M	47.0M	4.1M	473.7M	237.0M	236.6M	236.9M	236.8M	290.0M	183.7M	471.1M	0.0M
1173_QEV_T1_RNA_SLD_01_A23T55JLT4_1	23.8M	0.0M	0.0M	4.0M	0.2M	18.2M	9.1M	9.1M	9.1M	9.1M	12.6M	5.6M	18.1M	0.0M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_1	346.6M	0.0M	0.0M	35.5M	2.0M	295.6M	147.9M	147.8M	147.8M	147.8M	189.0M	106.7M	294.8M	0.0M
1173_QJL_T1_RNA_SLD_01_A23T55JLT4_2	538.5M	0.0M	0.0M	57.8M	3.5M	456.0M	228.1M	227.9M	228.1M	228.0M	285.0M	171.0M	454.3M	0.0M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_1	632.1M	0.0M	0.0M	76.3M	5.9M	523.1M	262.0M	261.1M	261.6M	261.5M	356.3M	166.8M	520.4M	0.0M
1173_RDM_T1_RNA_SLD_01_A23T55JLT4_2	318.8M	0.0M	0.0M	42.4M	3.2M	258.4M	129.5M	129.0M	129.3M	129.2M	181.2M	77.3M	257.3M	0.0M
1173_RGW_T1_RNA_SLD_01_A23T55JLT4_1	286.9M	0.0M	0.0M	69.6M	3.4M	193.9M	97.2M	96.7M	97.0M	96.9M	147.0M	46.9M	192.8M	0.0M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_1	60.5M	0.0M	0.0M	5.4M	0.4M	52.6M	26.3M	26.3M	26.3M	26.3M	33.5M	19.1M	52.5M	0.0M
1173_RPC_T1_RNA_SLD_01_A23T55JLT4_2	615.0M	0.0M	0.0M	53.1M	4.0M	536.5M	268.4M	268.1M	268.3M	268.2M	335.1M	201.4M	534.8M	0.0M
1173_RPX_T1_RNA_SLD_01_A23T55JLT4_1	659.5M	0.0M	0.0M	66.8M	4.2M	562.7M	281.6M	281.2M	281.4M	281.3M	339.9M	222.8M	560.4M	0.0M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_1	608.3M	0.0M	0.0M	69.9M	4.5M	510.0M	255.4M	254.6M	255.1M	254.9M	327.5M	182.5M	507.6M	0.0M
1173_RQT_T1_RNA_SLD_01_A23T55JLT4_2	432.3M	0.0M	0.0M	49.0M	3.3M	363.3M	181.9M	181.4M	181.7M	181.6M	228.1M	135.2M	361.7M	0.0M
1173_S9Q_T1_RNA_SLD_01_A23T55JLT4_1	662.0M	0.0M	0.0M	69.6M	5.0M	561.2M	280.9M	280.3M	280.7M	280.5M	355.7M	205.5M	558.9M	0.0M
1173_SDP_T1_RNA_SLD_01_A23T55JLT4_1	652.0M	0.0M	0.0M	58.3M	4.1M	567.8M	284.1M	283.7M	284.0M	283.8M	365.9M	201.9M	566.2M	0.0M
1173_SFA_T1_RNA_SLD_01_A23T55JLT4_1	82.0M	0.0M	0.0M	12.4M	0.6M	64.4M	32.2M	32.2M	32.2M	32.2M	40.4M	24.0M	64.2M	0.0M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_1	668.4M	0.0M	0.0M	75.5M	4.6M	561.5M	280.8M	280.7M	280.8M	280.7M	339.4M	222.0M	559.7M	0.0M
1173_SK8_T1_RNA_SLD_01_A23T55JLT4_2	451.3M	0.0M	0.0M	40.9M	3.5M	390.1M	195.2M	194.9M	195.1M	195.0M	224.1M	166.0M	388.5M	0.0M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_1	679.7M	0.0M	0.0M	84.2M	4.5M	565.5M	282.5M	283.0M	282.8M	282.7M	346.1M	219.4M	562.2M	0.0M
1173_T46_T1_RNA_SLD_01_A23T55JLT4_2	614.0M	0.0M	0.0M	65.5M	4.4M	521.6M	260.7M	260.9M	260.9M	260.7M	315.3M	206.3M	518.8M	0.0M
FFPE_HD789_01_RNA_13_A23T55JLT4_1	629.0M	0.0M	0.0M	38.5M	3.6M	569.2M	284.7M	284.5M	284.7M	284.5M	256.2M	313.0M	567.4M	0.0M
FFPE_V4_0002_RNA_0001_A23T55JLT4_1	631.3M	0.0M	0.0M	41.3M	4.3M	566.8M	283.5M	283.3M	283.5M	283.3M	275.9M	290.9M	564.9M	0.0M
NTC_0001_0001_A23T55JLT4_1	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	376785959	0.3837%
GTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGCC	12	1717551	0.0017%
GCGGCGGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGAA	11	802377	0.0008%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	7	826	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	6	594	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	5	166	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	4	73	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	4	70	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGGGTTTCGGTCCCGCCGC	4	248140	0.0003%
GCCGGGGGGGCTGTAACACTCGGGGGGGGTTTCGGTCCCGCCGCCGCCGC	4	237687	0.0002%
TTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGCCGC	4	317527	0.0003%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	3	183	0.0000%
CCGAGTGTTACAGCCCCCCCGGCAGCAGCA	3	94	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	3	185	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGCA	3	61	0.0000%
GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	3	57	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGG	3	37	0.0000%
GTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT	3	43	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGC	3	46	0.0000%
GCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	3	47	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	159121189	0.3744%
GTTTCGGTCCCGCCGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGCCGCC	6	853142	0.0020%
GCGGCGGCGGCGGCGGCGGTGGCGGCGGCGGCGGCGGCGGCGGGACCGAA	5	350874	0.0008%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	417	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	352	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	148	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	4	73	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	4	70	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	3	183	0.0000%
CCGAGTGTTACAGCCCCCCCGGCAGCAGCA	3	94	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	3	185	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGCA	3	61	0.0000%
GGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG	3	57	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGG	3	37	0.0000%
GTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT	3	43	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGC	3	46	0.0000%
GCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	3	47	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGGG	3	16	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAG	3	28	0.0000%
CTGCCGGGGGGGCTGTAACACTCGGGGGGCC	3	28	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0016/A23T55JLT4/nfcore_rnafusion__2cae617--20260515-145204' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0016-2cae617 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260408_LH00995_0025_A23T55JLT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260408_LH00995_0025_A23T55JLT4/bclconvert_samplesheet.csv' --flowcell_id 20260408_LH00995_0025_A23T55JLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0016/A23T55JLT4/nfcore_rnafusion__2cae617--20260515-145204'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0016-2cae617
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0016/A23T55JLT4/nfcore_rnafusion__2cae617--20260515-145204
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260408_LH00995_0025_A23T55JLT4/
flowcell_id: 20260408_LH00995_0025_A23T55JLT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260408_LH00995_0025_A23T55JLT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks