Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 10758509
total bases: 1624534859
Q20 bases: 1559358413(95.988%)
Q30 bases: 1458141108(89.7575%)

Read2 before filtering:
total reads: 10758509
total bases: 1624534859
Q20 bases: 1566078747(96.4017%)
Q30 bases: 1469706284(90.4694%)

Read1 after filtering:
total reads: 10301720
total bases: 1061053834
Q20 bases: 1055838610(99.5085%)
Q30 bases: 1032654062(97.3234%)

Read2 after filtering:
total reads: 10301720
total bases: 1068811134
Q20 bases: 1058825938(99.0658%)
Q30 bases: 1028902955(96.2661%)

Filtering result:
reads passed filter: 20603440
reads failed due to low quality: 622298
reads failed due to too many N: 3714
reads failed due to too short: 287566
reads with adapter trimmed: 18400958
bases trimmed due to adapters: 1020567641

Duplication rate: 39.6449%

Insert size peak (evaluated by paired-end reads): 86

JSON report: 1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1.fastp.json
HTML report: 1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1.fastp.html

fastp --in1 1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1_1.fastq.gz --in2 1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1_2.fastq.gz --out1 1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1_1.fastp.fastq.gz --out2 1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1_2.fastp.fastq.gz --json 1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1.fastp.json --html 1173_KRT_T1_RNA_SLD_01_A23T55JLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 21 seconds