MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-06-08, 12:50 UTC based on data in: /tmp/nxf.SqDJGjFwtr

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₁ columns.

Sample Name	Unique Reads	Frac Antisense	Total Reads	Expected Distinct	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	ChrY Signature Score	RNA contaminated	RNA contamination %	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Frag Length	% Aligned	M Aligned	Duplication	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_01_RNA_13_B23MVV7LT4_1	575729781	0.9360	9999000000	469677104	181.4bp	163.0bp	0.01%	1.78%	0.71%	0.00%	0.02%	5.23%	1.03%	0.00%	3.92	Yes	61.91%	592726750	0.00%	0.44%	329791654	0.95%	0.98%	0.05%	0.02%	312201833	158438905	14947354	3823530	696.21	280.00	0.72%	0.62%	0.98	0.000				44.6%	91.3%	96.4%	285.7M	35.8%	98.0%	80421.1Mb	592.7M	54.9%	98.8%	35.2%
FFPE_HD789_01_RNA_13_B23MVV7LT4_1_1																																				181.4bp	98.1%	290.8M												88.3%	54%	151bp	151bp	18%	588.3M
FFPE_HD789_01_RNA_13_B23MVV7LT4_1_2																																																		87.7%	55%	151bp	151bp	18%	588.3M
FFPE_HD789_01_RNA_13_B23MVV7LT4_1_trimmed_1																																																		84.2%	54%	138bp	151bp	9%	296.4M	84.2%	54%	138bp	151bp	9%	296.4M
FFPE_HD789_01_RNA_13_B23MVV7LT4_1_trimmed_2																																																		84.7%	55%	139bp	151bp	9%	296.4M	84.7%	55%	139bp	151bp	9%	296.4M
FFPE_V4_0002_RNA_0001_B23MVV7LT4_1	386095151	0.9671	9999000000	239080734	170.7bp	155.0bp	0.01%	1.81%	1.03%	0.00%	0.01%	5.06%	1.44%	0.00%	6.72	No	0.00%	398910896	0.01%	0.48%	206943636	0.94%	0.97%	0.05%	0.03%	194021372	98492580	10764824	3079580	410.25	96.00	0.58%	0.50%	0.98	0.000				48.4%	90.2%	96.0%	191.5M	37.2%	98.0%	53244.6Mb	398.9M	54.8%	98.7%	41.0%
FFPE_V4_0002_RNA_0001_B23MVV7LT4_1_1																																				170.7bp	97.2%	193.8M												84.0%	53%	151bp	151bp	18%	202.0M
FFPE_V4_0002_RNA_0001_B23MVV7LT4_1_2																																																		83.5%	54%	151bp	151bp	18%	202.0M
FFPE_V4_0002_RNA_0001_B23MVV7LT4_1_trimmed_1																																																		84.0%	54%	136bp	151bp	9%	199.5M	84.0%	54%	136bp	151bp	9%	199.5M
FFPE_V4_0002_RNA_0001_B23MVV7LT4_1_trimmed_2																																																		84.4%	55%	136bp	151bp	9%	199.5M	84.4%	55%	136bp	151bp	9%	199.5M
tih_rna_sample_00569_B23MVV7LT4_1	573165758	0.9042	9999000000	320686658	141.2bp	129.0bp	0.01%	0.97%	0.57%	0.00%	0.01%	2.90%	0.84%	0.00%	4.90	No	0.00%	592660546	0.01%	0.51%	289863752	0.94%	0.97%	0.04%	0.03%	273635990	138053707	12808162	4133447	512.13	219.00	0.74%	0.62%	0.98	0.000				51.4%	89.6%	95.7%	283.5M	33.5%	98.0%	73677.3Mb	592.7M	56.9%	98.8%	58.8%
tih_rna_sample_00569_B23MVV7LT4_1_1																																				141.2bp	98.0%	290.3M												84.4%	55%	151bp	151bp	18%	402.7M
tih_rna_sample_00569_B23MVV7LT4_1_2																																																		83.4%	56%	151bp	151bp	18%	402.7M
tih_rna_sample_00569_B23MVV7LT4_1_trimmed_1																																																		82.1%	56%	127bp	137bp	9%	296.3M	82.1%	56%	127bp	137bp	9%	296.3M
tih_rna_sample_00569_B23MVV7LT4_1_trimmed_2																																																		82.1%	57%	127bp	137bp	9%	296.3M	82.1%	57%	127bp	137bp	9%	296.3M
tih_rna_sample_00570_B23MVV7LT4_1	575888716	0.9465	9999000000	297119406	130.7bp	119.0bp	0.01%	0.56%	0.37%	0.00%	0.02%	1.99%	0.64%	0.00%	0.04	No	0.00%	591717042	0.01%	0.55%	266748465	0.95%	0.97%	0.04%	0.03%	252297476	126904962	11189199	3871214	449.72	218.00	0.73%	0.62%	0.98	0.000				55.2%	90.8%	96.1%	284.3M	36.9%	98.1%	71252.8Mb	591.7M	54.8%	98.6%	65.2%
tih_rna_sample_00570_B23MVV7LT4_1_1																																				130.7bp	98.8%	292.2M												85.1%	53%	151bp	151bp	18%	327.0M
tih_rna_sample_00570_B23MVV7LT4_1_2																																																		84.4%	54%	151bp	151bp	18%	327.0M
tih_rna_sample_00570_B23MVV7LT4_1_trimmed_1																																																		84.5%	54%	123bp	127bp	9%	295.9M	84.5%	54%	123bp	127bp	9%	295.9M
tih_rna_sample_00570_B23MVV7LT4_1_trimmed_2																																																		84.9%	55%	123bp	127bp	9%	295.9M	84.9%	55%	123bp	127bp	9%	295.9M
tih_rna_sample_00572_B23MVV7LT4_1	429465973	0.9072	9999000000	207749059	140.7bp	130.0bp	0.01%	0.60%	0.36%	0.00%	0.01%	1.93%	0.56%	0.00%	0.12	No	0.00%	445011724	0.01%	0.53%	209227884	0.93%	0.96%	0.05%	0.04%	195107213	98431529	10962179	3852404	356.19	171.00	0.73%	0.60%	0.98	0.000				53.4%	89.1%	95.6%	212.7M	36.5%	98.1%	55399.5Mb	445.0M	56.6%	98.7%	58.9%
tih_rna_sample_00572_B23MVV7LT4_1_1																																				140.7bp	97.7%	217.5M												79.8%	55%	151bp	151bp	18%	225.3M
tih_rna_sample_00572_B23MVV7LT4_1_2																																																		79.2%	56%	151bp	151bp	18%	225.3M
tih_rna_sample_00572_B23MVV7LT4_1_trimmed_1																																																		79.8%	56%	127bp	137bp	9%	222.5M	79.8%	56%	127bp	137bp	9%	222.5M
tih_rna_sample_00572_B23MVV7LT4_1_trimmed_2																																																		80.1%	56%	127bp	137bp	9%	222.5M	80.1%	56%	127bp	137bp	9%	222.5M
tih_rna_sample_00574_B23MVV7LT4_1	576158314	0.9278	9999000000	381836907	148.1bp	135.0bp	0.02%	0.69%	0.34%	0.00%	0.04%	2.27%	0.53%	0.00%	0.00	No	0.00%	592791414	0.01%	0.48%	308736481	0.94%	0.97%	0.04%	0.03%	291754283	147254753	13815871	4356969	569.41	291.00	0.77%	0.66%	0.98	0.000				48.2%	90.8%	96.1%	285.0M	35.6%	97.9%	75716.2Mb	592.8M	55.5%	98.8%	53.5%
tih_rna_sample_00574_B23MVV7LT4_1_1																																				148.1bp	98.4%	291.7M												85.2%	54%	151bp	151bp	18%	359.3M
tih_rna_sample_00574_B23MVV7LT4_1_2																																																		84.1%	55%	151bp	151bp	18%	359.3M
tih_rna_sample_00574_B23MVV7LT4_1_trimmed_1																																																		83.9%	55%	130bp	147bp	9%	296.4M	83.9%	55%	130bp	147bp	9%	296.4M
tih_rna_sample_00574_B23MVV7LT4_1_trimmed_2																																																		83.8%	55%	130bp	147bp	9%	296.4M	83.8%	55%	130bp	147bp	9%	296.4M
tih_rna_sample_00575_B23MVV7LT4_1	146275707	0.8740	9999000000	27131840	112.2bp	106.0bp	0.01%	0.62%	0.31%	0.00%	0.01%	2.07%	0.55%	0.00%	0.06	No	0.00%	153420912	0.01%	0.81%	28923788	0.87%	0.92%	0.09%	0.08%	25122553	12574531	2558600	1098406	34.88	10.00	0.28%	0.07%	0.98	0.000				81.8%	83.5%	94.0%	72.1M	46.3%	97.7%	16688.1Mb	153.4M	59.1%	98.5%	82.5%
tih_rna_sample_00575_B23MVV7LT4_1_1																																				112.2bp	97.9%	75.1M												84.6%	57%	151bp	151bp	18%	77.8M
tih_rna_sample_00575_B23MVV7LT4_1_2																																																		83.4%	57%	151bp	151bp	27%	77.8M
tih_rna_sample_00575_B23MVV7LT4_1_trimmed_1																																																		84.6%	58%	111bp	112bp	9%	76.7M	84.6%	58%	111bp	112bp	9%	76.7M
tih_rna_sample_00575_B23MVV7LT4_1_trimmed_2																																																		84.3%	59%	111bp	112bp	9%	76.7M	84.3%	59%	111bp	112bp	9%	76.7M
tih_rna_sample_00576_B23MVV7LT4_1	364771415	0.9439	9999000000	181489006	134.1bp	123.0bp	0.01%	0.62%	0.33%	0.00%	0.03%	1.94%	0.51%	0.00%	0.03	No	0.00%	378656160	0.01%	0.52%	181396396	0.93%	0.96%	0.05%	0.04%	169080008	85097489	9828568	3694865	293.88	137.00	0.70%	0.56%	0.98	0.000				52.4%	88.6%	95.5%	180.7M	35.4%	98.1%	45862.5Mb	378.7M	54.8%	98.5%	64.8%
tih_rna_sample_00576_B23MVV7LT4_1_1																																				134.1bp	98.2%	185.9M												81.0%	53%	151bp	151bp	18%	192.1M
tih_rna_sample_00576_B23MVV7LT4_1_2																																																		80.1%	54%	151bp	151bp	18%	192.1M
tih_rna_sample_00576_B23MVV7LT4_1_trimmed_1																																																		81.0%	54%	123bp	127bp	9%	189.3M	81.0%	54%	123bp	127bp	9%	189.3M
tih_rna_sample_00576_B23MVV7LT4_1_trimmed_2																																																		81.3%	55%	124bp	127bp	9%	189.3M	81.3%	55%	124bp	127bp	9%	189.3M
tih_rna_sample_00581_B23MVV7LT4_1	566556735	0.9049	9999000000	116568966	130.6bp	122.0bp	0.01%	1.11%	0.49%	0.00%	0.01%	3.39%	0.75%	0.00%	0.01	No	0.00%	591258008	0.01%	0.74%	154255118	0.91%	0.95%	0.06%	0.05%	139951371	70381383	9907410	3795402	231.39	87.00	0.64%	0.48%	0.98	0.000				74.5%	86.0%	94.9%	280.5M	49.8%	97.9%	71041.3Mb	591.3M	57.9%	98.5%	67.3%
tih_rna_sample_00581_B23MVV7LT4_1_1																																				130.6bp	97.9%	289.4M												88.2%	55%	151bp	151bp	18%	347.6M
tih_rna_sample_00581_B23MVV7LT4_1_2																																																		86.7%	57%	151bp	151bp	18%	347.6M
tih_rna_sample_00581_B23MVV7LT4_1_trimmed_1																																																		87.1%	57%	123bp	127bp	9%	295.6M	87.1%	57%	123bp	127bp	9%	295.6M
tih_rna_sample_00581_B23MVV7LT4_1_trimmed_2																																																		86.7%	58%	123bp	127bp	9%	295.6M	86.7%	58%	123bp	127bp	9%	295.6M
tih_rna_sample_00582_B23MVV7LT4_1	574270542	0.9403	9999000000	209646535	141.0bp	130.0bp	0.01%	0.75%	0.38%	0.00%	0.02%	2.38%	0.62%	0.00%	5.98	No	0.00%	592014850	0.01%	0.61%	231286816	0.93%	0.96%	0.05%	0.04%	215963669	108992717	12012073	4032345	395.01	167.00	0.74%	0.59%	0.98	0.000				61.3%	89.7%	95.9%	283.9M	42.3%	97.7%	73626.1Mb	592.0M	58.1%	98.7%	59.1%
tih_rna_sample_00582_B23MVV7LT4_1_1																																				141.0bp	98.3%	291.0M												87.8%	56%	151bp	151bp	18%	360.9M
tih_rna_sample_00582_B23MVV7LT4_1_2																																																		85.9%	57%	151bp	151bp	18%	360.9M
tih_rna_sample_00582_B23MVV7LT4_1_trimmed_1																																																		86.5%	57%	127bp	137bp	9%	296.0M	86.5%	57%	127bp	137bp	9%	296.0M
tih_rna_sample_00582_B23MVV7LT4_1_trimmed_2																																																		85.7%	58%	127bp	137bp	9%	296.0M	85.7%	58%	127bp	137bp	9%	296.0M
tih_rna_sample_00583_B23MVV7LT4_1	438459560	0.8849	9999000000	115117726	134.2bp	124.0bp	0.01%	1.22%	0.30%	0.00%	0.01%	3.73%	0.52%	0.00%	0.01	No	0.00%	455529910	0.01%	0.69%	143289996	0.91%	0.95%	0.07%	0.05%	130683915	65823094	9660784	3662262	222.07	101.00	0.69%	0.50%	0.98	0.000				69.0%	86.6%	95.1%	216.6M	47.3%	97.9%	55439.3Mb	455.5M	57.1%	98.6%	64.3%
tih_rna_sample_00583_B23MVV7LT4_1_1																																				134.2bp	97.9%	223.1M												85.0%	55%	151bp	151bp	18%	230.9M
tih_rna_sample_00583_B23MVV7LT4_1_2																																																		83.4%	56%	151bp	151bp	18%	230.9M
tih_rna_sample_00583_B23MVV7LT4_1_trimmed_1																																																		85.1%	56%	124bp	132bp	9%	227.8M	85.1%	56%	124bp	132bp	9%	227.8M
tih_rna_sample_00583_B23MVV7LT4_1_trimmed_2																																																		84.4%	57%	124bp	132bp	9%	227.8M	84.4%	57%	124bp	132bp	9%	227.8M
tih_rna_sample_00584_B23MVV7LT4_1	67022305	0.8697	9999000000	12769202	115.3bp	109.0bp	0.01%	0.55%	0.20%	0.00%	0.01%	1.81%	0.36%	0.00%	0.01	No	0.00%	70334206	0.01%	0.77%	15983530	0.87%	0.91%	0.09%	0.09%	13828897	6925014	1496811	654070	19.52	6.00	0.18%	0.03%	0.98	0.000				78.0%	83.1%	94.2%	33.1M	45.2%	97.8%	7705.8Mb	70.3M	59.1%	98.1%	80.7%
tih_rna_sample_00584_B23MVV7LT4_1_1																																				115.3bp	97.6%	34.3M												81.5%	57%	151bp	151bp	18%	35.9M
tih_rna_sample_00584_B23MVV7LT4_1_2																																																		80.1%	57%	151bp	151bp	27%	35.9M
tih_rna_sample_00584_B23MVV7LT4_1_trimmed_1																																																		81.4%	58%	112bp	112bp	9%	35.2M	81.4%	58%	112bp	112bp	9%	35.2M
tih_rna_sample_00584_B23MVV7LT4_1_trimmed_2																																																		81.0%	59%	112bp	112bp	9%	35.2M	81.0%	59%	112bp	112bp	9%	35.2M
tih_rna_sample_00586_B23MVV7LT4_1	344685847	0.9575	9999000000	258520356	166.5bp	149.0bp	0.01%	0.80%	0.48%	0.00%	0.03%	2.48%	0.75%	0.00%	0.00	No	0.00%	364992038	0.01%	0.45%	201717222	0.94%	0.97%	0.05%	0.03%	188683294	95633377	9418677	2631442	393.12	167.00	0.70%	0.58%	0.98	0.000				45.2%	84.8%	93.6%	170.9M	33.2%	97.8%	48137.1Mb	365.0M	56.7%	98.7%	43.9%
tih_rna_sample_00586_B23MVV7LT4_1_1																																				166.5bp	97.8%	178.5M												81.4%	55%	151bp	151bp	18%	184.8M
tih_rna_sample_00586_B23MVV7LT4_1_2																																																		80.3%	56%	151bp	151bp	18%	184.8M
tih_rna_sample_00586_B23MVV7LT4_1_trimmed_1																																																		81.4%	56%	135bp	151bp	9%	182.5M	81.4%	56%	135bp	151bp	9%	182.5M
tih_rna_sample_00586_B23MVV7LT4_1_trimmed_2																																																		81.2%	57%	135bp	151bp	9%	182.5M	81.2%	57%	135bp	151bp	9%	182.5M
tih_rna_sample_00588_B23MVV7LT4_1	570600828	0.9377	9999000000	340763125	143.8bp	129.0bp	0.01%	1.06%	0.42%	0.00%	0.02%	3.31%	0.65%	0.00%	0.01	Yes	0.00%	590613342	0.01%	0.49%	299375530	0.94%	0.97%	0.05%	0.03%	281884705	142172498	13914529	4581047	530.06	270.00	0.77%	0.66%	0.98	0.000				49.6%	89.1%	95.7%	282.7M	33.9%	98.0%	73467.3Mb	590.6M	55.9%	98.4%	56.4%
tih_rna_sample_00588_B23MVV7LT4_1_1																																				143.8bp	98.0%	289.3M												84.9%	54%	151bp	151bp	18%	350.8M
tih_rna_sample_00588_B23MVV7LT4_1_2																																																		83.6%	55%	151bp	151bp	18%	350.8M
tih_rna_sample_00588_B23MVV7LT4_1_trimmed_1																																																		83.8%	55%	127bp	137bp	9%	295.3M	83.8%	55%	127bp	137bp	9%	295.3M
tih_rna_sample_00588_B23MVV7LT4_1_trimmed_2																																																		83.8%	56%	127bp	142bp	9%	295.3M	83.8%	56%	127bp	142bp	9%	295.3M
tih_rna_sample_00591_B23MVV7LT4_1	573111631	0.9082	9999000000	221236679	126.0bp	116.0bp	0.01%	1.48%	0.70%	0.00%	0.02%	4.13%	0.97%	0.00%	5.65	Yes	0.00%	592191878	0.00%	0.59%	244238405	0.94%	0.96%	0.05%	0.04%	229374974	115350708	11908075	4362366	380.92	154.00	0.68%	0.56%	0.98	0.000				59.1%	88.8%	95.6%	283.0M	36.9%	98.0%	69347.4Mb	592.2M	56.0%	98.7%	71.6%
tih_rna_sample_00591_B23MVV7LT4_1_1																																				126.0bp	98.4%	291.3M												84.7%	54%	151bp	151bp	18%	309.0M
tih_rna_sample_00591_B23MVV7LT4_1_2																																																		83.6%	55%	151bp	151bp	18%	309.0M
tih_rna_sample_00591_B23MVV7LT4_1_trimmed_1																																																		84.4%	55%	119bp	122bp	9%	296.1M	84.4%	55%	119bp	122bp	9%	296.1M
tih_rna_sample_00591_B23MVV7LT4_1_trimmed_2																																																		84.3%	56%	120bp	122bp	9%	296.1M	84.3%	56%	120bp	122bp	9%	296.1M
tih_rna_sample_00592_B23MVV7LT4_1	480176929	0.9501	9999000000	179683803	163.9bp	146.0bp	0.04%	0.58%	0.28%	0.00%	0.09%	1.75%	0.42%	0.00%	5.90	No	0.00%	498234664	0.01%	0.60%	201544382	0.93%	0.97%	0.05%	0.03%	188224409	95342146	10496098	3049071	381.10	167.00	0.72%	0.59%	0.98	0.000				59.9%	89.4%	95.5%	238.0M	44.7%	97.9%	65166.4Mb	498.2M	55.5%	98.4%	44.4%
tih_rna_sample_00592_B23MVV7LT4_1_1																																				163.9bp	98.0%	244.1M												85.0%	54%	151bp	151bp	18%	253.1M
tih_rna_sample_00592_B23MVV7LT4_1_2																																																		83.7%	55%	151bp	151bp	18%	253.1M
tih_rna_sample_00592_B23MVV7LT4_1_trimmed_1																																																		85.0%	55%	134bp	151bp	9%	249.1M	85.0%	55%	134bp	151bp	9%	249.1M
tih_rna_sample_00592_B23MVV7LT4_1_trimmed_2																																																		84.9%	55%	134bp	151bp	9%	249.1M	84.9%	55%	134bp	151bp	9%	249.1M
tih_rna_sample_00594_B23MVV7LT4_1	556851327	0.9381	9999000000	377878169	159.2bp	144.0bp	0.02%	0.77%	0.50%	0.00%	0.04%	2.39%	0.74%	0.00%	5.32	No	0.00%	592166710	0.01%	0.48%	305835102	0.94%	0.97%	0.04%	0.03%	288348088	145807901	13739645	4078845	587.09	241.00	0.73%	0.62%	0.98	0.000				48.7%	83.3%	93.3%	276.1M	35.9%	98.0%	77205.5Mb	592.2M	56.3%	98.7%	47.6%
tih_rna_sample_00594_B23MVV7LT4_1_1																																				159.2bp	98.1%	290.5M												86.6%	55%	151bp	151bp	18%	477.6M
tih_rna_sample_00594_B23MVV7LT4_1_2																																																		85.4%	56%	151bp	151bp	18%	477.6M
tih_rna_sample_00594_B23MVV7LT4_1_trimmed_1																																																		83.4%	55%	133bp	151bp	9%	296.1M	83.4%	55%	133bp	151bp	9%	296.1M
tih_rna_sample_00594_B23MVV7LT4_1_trimmed_2																																																		83.4%	56%	133bp	151bp	9%	296.1M	83.4%	56%	133bp	151bp	9%	296.1M
tih_rna_sample_00596_B23MVV7LT4_1	567251085	0.9235	9999000000	191736616	151.8bp	140.0bp	0.01%	0.98%	0.51%	0.00%	0.01%	3.06%	0.76%	0.00%	0.00	No	0.00%	591643132	0.01%	0.61%	230033546	0.93%	0.97%	0.05%	0.03%	214302378	108245566	11847893	3860900	410.70	196.00	0.74%	0.62%	0.98	0.000				61.5%	87.7%	95.0%	280.9M	46.2%	98.0%	76529.1Mb	591.6M	56.9%	98.6%	51.8%
tih_rna_sample_00596_B23MVV7LT4_1_1																																				151.8bp	98.0%	289.9M												87.2%	55%	151bp	151bp	18%	387.2M
tih_rna_sample_00596_B23MVV7LT4_1_2																																																		85.8%	56%	151bp	151bp	18%	387.2M
tih_rna_sample_00596_B23MVV7LT4_1_trimmed_1																																																		85.3%	56%	132bp	147bp	9%	295.8M	85.3%	56%	132bp	147bp	9%	295.8M
tih_rna_sample_00596_B23MVV7LT4_1_trimmed_2																																																		85.0%	57%	132bp	147bp	9%	295.8M	85.0%	57%	132bp	147bp	9%	295.8M
tih_rna_sample_00598_B23MVV7LT4_1	338133678	0.8836	9999000000	58051894	125.5bp	118.0bp	0.01%	0.88%	0.28%	0.00%	0.01%	2.75%	0.46%	0.00%	0.03	No	0.00%	355853632	0.01%	0.78%	76547136	0.86%	0.91%	0.10%	0.09%	65619806	32942186	7468529	3203876	101.53	40.00	0.56%	0.30%	0.98	0.000				79.3%	83.5%	94.0%	167.3M	51.9%	97.9%	41516.3Mb	355.9M	57.7%	98.4%	72.6%
tih_rna_sample_00598_B23MVV7LT4_1_1																																				125.5bp	97.3%	173.2M												85.9%	55%	151bp	151bp	18%	180.8M
tih_rna_sample_00598_B23MVV7LT4_1_2																																																		84.4%	56%	151bp	151bp	18%	180.8M
tih_rna_sample_00598_B23MVV7LT4_1_trimmed_1																																																		86.0%	57%	119bp	122bp	9%	177.9M	86.0%	57%	119bp	122bp	9%	177.9M
tih_rna_sample_00598_B23MVV7LT4_1_trimmed_2																																																		85.6%	57%	119bp	122bp	9%	177.9M	85.6%	57%	119bp	122bp	9%	177.9M
tih_rna_sample_00599_B23MVV7LT4_1	534829788	0.8941	9999000000	177490281	122.3bp	114.0bp	0.01%	1.29%	0.43%	0.00%	0.01%	3.95%	0.71%	0.00%	0.01	No	0.00%	558209418	0.01%	0.65%	194977021	0.92%	0.95%	0.06%	0.05%	179964011	90424093	11295038	4446113	286.70	117.00	0.70%	0.53%	0.98	0.000				65.5%	86.1%	94.8%	264.4M	39.3%	97.7%	64232.6Mb	558.2M	57.5%	98.6%	74.3%
tih_rna_sample_00599_B23MVV7LT4_1_1																																				122.3bp	98.3%	274.4M												84.8%	55%	151bp	151bp	18%	283.0M
tih_rna_sample_00599_B23MVV7LT4_1_2																																																		83.5%	56%	151bp	151bp	18%	283.0M
tih_rna_sample_00599_B23MVV7LT4_1_trimmed_1																																																		84.9%	57%	118bp	117bp	9%	279.1M	84.9%	57%	118bp	117bp	9%	279.1M
tih_rna_sample_00599_B23MVV7LT4_1_trimmed_2																																																		84.6%	57%	118bp	117bp	9%	279.1M	84.6%	57%	118bp	117bp	9%	279.1M
tih_rna_sample_00602_B23MVV7LT4_1	570101305	0.9577	9999000000	444669574	166.7bp	151.0bp	0.01%	0.71%	0.52%	0.00%	0.02%	2.25%	0.75%	0.00%	0.00	No	0.00%	591527256	0.01%	0.44%	331341000	0.94%	0.97%	0.05%	0.03%	312771065	158354237	15047902	4258175	653.27	330.00	0.76%	0.66%	0.98	0.000				44.2%	89.4%	95.5%	282.4M	34.7%	98.0%	77981.2Mb	591.5M	54.1%	98.6%	43.2%
tih_rna_sample_00602_B23MVV7LT4_1_1																																				166.7bp	97.8%	289.4M												86.8%	53%	151bp	151bp	18%	478.1M
tih_rna_sample_00602_B23MVV7LT4_1_2																																																		85.8%	54%	151bp	151bp	18%	478.1M
tih_rna_sample_00602_B23MVV7LT4_1_trimmed_1																																																		83.6%	53%	135bp	151bp	9%	295.8M	83.6%	53%	135bp	151bp	9%	295.8M
tih_rna_sample_00602_B23MVV7LT4_1_trimmed_2																																																		84.0%	54%	135bp	151bp	9%	295.8M	84.0%	54%	135bp	151bp	9%	295.8M
tih_rna_sample_00604_B23MVV7LT4_1	575072372	0.9495	9999000000	471112891	154.9bp	140.0bp	0.01%	0.98%	0.53%	0.00%	0.02%	3.15%	0.85%	0.00%	0.01	No	0.00%	592685022	0.01%	0.44%	330287895	0.95%	0.97%	0.04%	0.03%	313003732	158169028	14011164	4211038	632.42	314.00	0.76%	0.66%	0.98	0.000				44.5%	90.8%	96.2%	285.1M	32.2%	98.0%	76395.9Mb	592.7M	56.2%	98.8%	49.6%
tih_rna_sample_00604_B23MVV7LT4_1_1																																				154.9bp	98.4%	291.5M												87.3%	55%	151bp	151bp	18%	480.1M
tih_rna_sample_00604_B23MVV7LT4_1_2																																																		86.5%	56%	151bp	151bp	18%	480.1M
tih_rna_sample_00604_B23MVV7LT4_1_trimmed_1																																																		84.3%	55%	131bp	151bp	9%	296.3M	84.3%	55%	131bp	151bp	9%	296.3M
tih_rna_sample_00604_B23MVV7LT4_1_trimmed_2																																																		84.5%	56%	132bp	151bp	9%	296.3M	84.5%	56%	132bp	151bp	9%	296.3M
tih_rna_sample_00612_B23MVV7LT4_1	569041124	0.9432	9999000000	307226438	149.2bp	134.0bp	0.01%	1.16%	0.57%	0.00%	0.02%	3.53%	0.87%	0.00%	3.83	No	0.00%	590445706	0.01%	0.51%	287817100	0.94%	0.97%	0.05%	0.03%	271387864	137078084	13458743	4156526	523.16	236.00	0.72%	0.62%	0.98	0.000				51.5%	88.6%	95.5%	282.0M	38.9%	98.0%	74793.2Mb	590.4M	55.9%	98.4%	51.9%
tih_rna_sample_00612_B23MVV7LT4_1_1																																				149.2bp	98.2%	289.9M												85.5%	54%	151bp	151bp	18%	373.0M
tih_rna_sample_00612_B23MVV7LT4_1_2																																																		84.5%	56%	151bp	151bp	18%	373.0M
tih_rna_sample_00612_B23MVV7LT4_1_trimmed_1																																																		83.9%	55%	129bp	147bp	9%	295.2M	83.9%	55%	129bp	147bp	9%	295.2M
tih_rna_sample_00612_B23MVV7LT4_1_trimmed_2																																																		84.2%	56%	129bp	147bp	9%	295.2M	84.2%	56%	129bp	147bp	9%	295.2M
tih_rna_sample_00613_B23MVV7LT4_1	565883883	0.9217	9999000000	283939890	155.2bp	141.0bp	0.01%	0.75%	0.35%	0.00%	0.01%	2.22%	0.52%	0.00%	5.04	No	0.00%	592113278	0.01%	0.55%	264975139	0.94%	0.97%	0.05%	0.03%	248922532	125842033	12443706	3826244	500.77	243.00	0.78%	0.65%	0.98	0.000				55.6%	87.8%	94.8%	280.6M	40.6%	98.0%	76645.9Mb	592.1M	56.6%	98.7%	49.5%
tih_rna_sample_00613_B23MVV7LT4_1_1																																				155.2bp	97.8%	289.7M												84.7%	55%	151bp	151bp	18%	315.3M
tih_rna_sample_00613_B23MVV7LT4_1_2																																																		83.7%	56%	151bp	151bp	18%	315.3M
tih_rna_sample_00613_B23MVV7LT4_1_trimmed_1																																																		84.3%	56%	132bp	151bp	9%	296.1M	84.3%	56%	132bp	151bp	9%	296.1M
tih_rna_sample_00613_B23MVV7LT4_1_trimmed_2																																																		84.5%	56%	132bp	151bp	9%	296.1M	84.5%	56%	132bp	151bp	9%	296.1M
tih_rna_sample_00614_B23MVV7LT4_1	489227585	0.8860	9999000000	168190700	137.3bp	127.0bp	0.00%	0.73%	0.46%	0.00%	0.01%	2.33%	0.69%	0.00%	0.01	No	0.00%	506836954	0.01%	0.61%	199782990	0.93%	0.96%	0.05%	0.04%	185961044	93630334	10479276	3813933	330.73	144.00	0.68%	0.56%	0.98	0.000				61.0%	89.3%	95.5%	242.0M	42.5%	98.0%	62496.8Mb	506.8M	55.4%	98.6%	62.2%
tih_rna_sample_00614_B23MVV7LT4_1_1																																				137.3bp	98.0%	248.4M												83.8%	54%	151bp	151bp	18%	257.0M
tih_rna_sample_00614_B23MVV7LT4_1_2																																																		82.9%	55%	151bp	151bp	18%	257.0M
tih_rna_sample_00614_B23MVV7LT4_1_trimmed_1																																																		83.8%	55%	126bp	132bp	9%	253.4M	83.8%	55%	126bp	132bp	9%	253.4M
tih_rna_sample_00614_B23MVV7LT4_1_trimmed_2																																																		84.0%	55%	126bp	132bp	9%	253.4M	84.0%	55%	126bp	132bp	9%	253.4M
tih_rna_sample_00616_B23MVV7LT4_1	578603280	0.9280	9999000000	360481767	145.1bp	131.0bp	0.01%	0.92%	0.39%	0.00%	0.01%	3.06%	0.63%	0.00%	5.97	No	0.00%	592952402	0.00%	0.50%	298496253	0.95%	0.97%	0.04%	0.03%	283534914	143099177	12341294	3843703	548.95	241.00	0.76%	0.64%	0.98	0.000				49.9%	92.0%	96.5%	286.2M	34.3%	98.0%	74897.3Mb	593.0M	55.5%	98.8%	55.4%
tih_rna_sample_00616_B23MVV7LT4_1_1																																				145.1bp	98.6%	292.5M												85.6%	54%	151bp	151bp	18%	343.4M
tih_rna_sample_00616_B23MVV7LT4_1_2																																																		84.8%	55%	151bp	151bp	18%	343.4M
tih_rna_sample_00616_B23MVV7LT4_1_trimmed_1																																																		84.7%	55%	129bp	142bp	9%	296.5M	84.7%	55%	129bp	142bp	9%	296.5M
tih_rna_sample_00616_B23MVV7LT4_1_trimmed_2																																																		84.9%	55%	129bp	142bp	9%	296.5M	84.9%	55%	129bp	142bp	9%	296.5M
tih_rna_sample_00618_B23MVV7LT4_1	572028652	0.9055	9999000000	389560739	154.0bp	140.0bp	0.01%	0.92%	0.43%	0.00%	0.01%	2.89%	0.66%	0.00%	4.39	No	0.00%	592242442	0.01%	0.47%	313595235	0.95%	0.97%	0.04%	0.03%	296812868	149928830	13740983	4257011	588.98	294.00	0.76%	0.66%	0.98	0.000				47.3%	90.1%	95.7%	283.5M	33.9%	98.0%	76465.1Mb	592.2M	55.5%	98.7%	50.6%
tih_rna_sample_00618_B23MVV7LT4_1_1																																				154.0bp	98.3%	291.1M												84.5%	54%	151bp	151bp	18%	394.3M
tih_rna_sample_00618_B23MVV7LT4_1_2																																																		83.3%	55%	151bp	151bp	18%	394.3M
tih_rna_sample_00618_B23MVV7LT4_1_trimmed_1																																																		82.6%	55%	132bp	147bp	9%	296.1M	82.6%	55%	132bp	147bp	9%	296.1M
tih_rna_sample_00618_B23MVV7LT4_1_trimmed_2																																																		82.4%	55%	132bp	147bp	9%	296.1M	82.4%	55%	132bp	147bp	9%	296.1M
tih_rna_sample_00619_B23MVV7LT4_1	467741806	0.9262	9999000000	126161063	123.7bp	116.0bp	0.00%	1.00%	0.33%	0.00%	0.01%	3.32%	0.56%	0.00%	0.04	No	0.00%	483589822	0.01%	0.68%	152822037	0.92%	0.95%	0.06%	0.05%	140947751	70810714	8851104	3431369	228.22	92.00	0.67%	0.48%	0.98	0.000				68.8%	88.6%	95.7%	231.3M	42.4%	97.8%	56425.7Mb	483.6M	58.1%	98.5%	72.3%
tih_rna_sample_00619_B23MVV7LT4_1_1																																				123.7bp	98.3%	237.8M												84.6%	56%	151bp	151bp	18%	245.5M
tih_rna_sample_00619_B23MVV7LT4_1_2																																																		83.4%	56%	151bp	151bp	18%	245.5M
tih_rna_sample_00619_B23MVV7LT4_1_trimmed_1																																																		84.7%	57%	119bp	122bp	9%	241.8M	84.7%	57%	119bp	122bp	9%	241.8M
tih_rna_sample_00619_B23MVV7LT4_1_trimmed_2																																																		84.6%	58%	119bp	122bp	9%	241.8M	84.6%	58%	119bp	122bp	9%	241.8M
tih_rna_sample_00622_B23MVV7LT4_1	572474696	0.9260	9999000000	347794207	135.5bp	123.0bp	0.01%	0.82%	0.35%	0.00%	0.02%	2.70%	0.57%	0.00%	0.01	No	0.00%	591152882	0.01%	0.50%	294760120	0.94%	0.97%	0.05%	0.03%	277606066	139880511	13720876	4693823	505.79	264.00	0.76%	0.65%	0.98	0.000				50.4%	90.1%	95.8%	283.2M	32.4%	98.0%	71867.3Mb	591.2M	55.3%	98.5%	61.5%
tih_rna_sample_00622_B23MVV7LT4_1_1																																				135.5bp	98.4%	290.9M												84.0%	54%	151bp	151bp	18%	328.9M
tih_rna_sample_00622_B23MVV7LT4_1_2																																																		82.9%	55%	151bp	151bp	18%	328.9M
tih_rna_sample_00622_B23MVV7LT4_1_trimmed_1																																																		83.3%	54%	124bp	132bp	9%	295.6M	83.3%	54%	124bp	132bp	9%	295.6M
tih_rna_sample_00622_B23MVV7LT4_1_trimmed_2																																																		83.4%	55%	124bp	132bp	9%	295.6M	83.4%	55%	124bp	132bp	9%	295.6M
tih_rna_sample_00624_B23MVV7LT4_1	426534581	0.9205	9999000000	253549691	137.1bp	126.0bp	0.01%	0.56%	0.38%	0.00%	0.01%	1.78%	0.55%	0.00%	6.36	No	0.00%	445445492	0.01%	0.48%	231813618	0.93%	0.96%	0.06%	0.04%	215626823	108625476	12994284	4825229	385.56	197.00	0.74%	0.61%	0.98	0.000				48.3%	87.3%	94.8%	211.1M	32.1%	98.0%	54756.7Mb	445.4M	54.6%	98.8%	61.4%
tih_rna_sample_00624_B23MVV7LT4_1_1																																				137.1bp	97.8%	217.8M												80.0%	53%	151bp	151bp	18%	225.5M
tih_rna_sample_00624_B23MVV7LT4_1_2																																																		79.5%	54%	151bp	151bp	18%	225.5M
tih_rna_sample_00624_B23MVV7LT4_1_trimmed_1																																																		80.0%	54%	125bp	132bp	9%	222.7M	80.0%	54%	125bp	132bp	9%	222.7M
tih_rna_sample_00624_B23MVV7LT4_1_trimmed_2																																																		80.4%	54%	126bp	132bp	9%	222.7M	80.4%	54%	126bp	132bp	9%	222.7M
tih_rna_sample_00626_B23MVV7LT4_1	574371922	0.9110	9999000000	335331904	136.9bp	125.0bp	0.01%	1.23%	0.54%	0.00%	0.02%	3.83%	0.85%	0.00%	0.01	No	0.00%	592760626	0.01%	0.51%	291767560	0.95%	0.97%	0.04%	0.03%	276186473	139184171	12440305	4096218	507.00	248.00	0.76%	0.65%	0.98	0.000				51.0%	89.9%	95.9%	284.1M	33.4%	98.0%	72712.3Mb	592.8M	56.2%	98.8%	61.6%
tih_rna_sample_00626_B23MVV7LT4_1_1																																				136.9bp	98.4%	291.7M												86.4%	55%	151bp	151bp	18%	451.7M
tih_rna_sample_00626_B23MVV7LT4_1_2																																																		85.1%	55%	151bp	151bp	18%	451.7M
tih_rna_sample_00626_B23MVV7LT4_1_trimmed_1																																																		83.5%	55%	125bp	132bp	9%	296.4M	83.5%	55%	125bp	132bp	9%	296.4M
tih_rna_sample_00626_B23MVV7LT4_1_trimmed_2																																																		83.1%	56%	125bp	132bp	9%	296.4M	83.1%	56%	125bp	132bp	9%	296.4M
tih_rna_sample_00628_B23MVV7LT4_1	573656724	0.9443	9999000000	425494606	159.6bp	142.0bp	0.01%	0.90%	0.36%	0.00%	0.01%	2.92%	0.61%	0.00%	0.02	Yes	0.00%	591399546	0.01%	0.46%	319170499	0.94%	0.97%	0.04%	0.03%	301244852	152438639	14195091	4038763	615.79	306.00	0.77%	0.67%	0.98	0.000				46.3%	90.9%	96.1%	284.1M	33.3%	98.0%	76542.0Mb	591.4M	55.8%	98.6%	46.9%
tih_rna_sample_00628_B23MVV7LT4_1_1																																				159.6bp	98.2%	290.3M												86.3%	54%	151bp	151bp	18%	439.2M
tih_rna_sample_00628_B23MVV7LT4_1_2																																																		85.3%	55%	151bp	151bp	18%	439.2M
tih_rna_sample_00628_B23MVV7LT4_1_trimmed_1																																																		83.8%	55%	132bp	151bp	9%	295.7M	83.8%	55%	132bp	151bp	9%	295.7M
tih_rna_sample_00628_B23MVV7LT4_1_trimmed_2																																																		84.0%	56%	132bp	151bp	9%	295.7M	84.0%	56%	132bp	151bp	9%	295.7M
tih_rna_sample_00629_B23MVV7LT4_1	573078819	0.8933	9999000000	330947385	132.7bp	121.0bp	0.01%	0.86%	0.44%	0.00%	0.02%	2.79%	0.72%	0.00%	0.01	Yes	0.00%	591095006	0.01%	0.52%	285087399	0.95%	0.97%	0.04%	0.03%	270571766	136098422	11307765	3801799	484.50	238.00	0.73%	0.63%	0.98	0.000				52.1%	90.0%	95.9%	283.3M	32.9%	98.1%	71491.9Mb	591.1M	55.2%	98.5%	64.4%
tih_rna_sample_00629_B23MVV7LT4_1_1																																				132.7bp	98.7%	291.8M												84.6%	54%	151bp	151bp	18%	373.8M
tih_rna_sample_00629_B23MVV7LT4_1_2																																																		83.3%	55%	151bp	151bp	18%	373.8M
tih_rna_sample_00629_B23MVV7LT4_1_trimmed_1																																																		82.9%	54%	123bp	127bp	9%	295.5M	82.9%	54%	123bp	127bp	9%	295.5M
tih_rna_sample_00629_B23MVV7LT4_1_trimmed_2																																																		82.8%	55%	123bp	132bp	9%	295.5M	82.8%	55%	123bp	132bp	9%	295.5M
tih_rna_sample_00635_B23MVV7LT4_1	570820259	0.9504	9999000000	315408686	154.7bp	141.0bp	0.01%	0.83%	0.52%	0.00%	0.01%	2.59%	0.76%	0.00%	5.59	No	0.00%	590920158	0.01%	0.51%	292243960	0.94%	0.97%	0.05%	0.03%	273765349	138368604	13963563	4335708	542.00	258.00	0.75%	0.64%	0.98	0.000				50.9%	90.0%	95.7%	282.7M	36.4%	98.0%	76302.3Mb	590.9M	55.6%	98.5%	49.4%
tih_rna_sample_00635_B23MVV7LT4_1_1																																				154.7bp	97.6%	288.5M												83.7%	54%	151bp	151bp	18%	332.1M
tih_rna_sample_00635_B23MVV7LT4_1_2																																																		82.9%	55%	151bp	151bp	18%	332.1M
tih_rna_sample_00635_B23MVV7LT4_1_trimmed_1																																																		82.9%	55%	132bp	151bp	9%	295.5M	82.9%	55%	132bp	151bp	9%	295.5M
tih_rna_sample_00635_B23MVV7LT4_1_trimmed_2																																																		83.3%	55%	132bp	151bp	9%	295.5M	83.3%	55%	132bp	151bp	9%	295.5M
tih_rna_sample_00636_B23MVV7LT4_1	536511531	0.9107	9999000000	261416555	139.7bp	126.0bp	0.01%	0.69%	0.31%	0.00%	0.03%	2.29%	0.48%	0.00%	0.34	Yes	0.15%	556596734	0.01%	0.53%	263020752	0.93%	0.96%	0.05%	0.04%	245586433	123767252	13742896	4877103	450.08	226.00	0.75%	0.63%	0.98	0.000				53.1%	88.7%	95.5%	265.7M	35.7%	97.9%	68597.2Mb	556.6M	56.1%	98.5%	59.4%
tih_rna_sample_00636_B23MVV7LT4_1_1																																				139.7bp	98.1%	273.1M												84.1%	55%	151bp	151bp	18%	282.5M
tih_rna_sample_00636_B23MVV7LT4_1_2																																																		83.1%	56%	151bp	151bp	18%	282.5M
tih_rna_sample_00636_B23MVV7LT4_1_trimmed_1																																																		84.2%	55%	126bp	137bp	9%	278.3M	84.2%	55%	126bp	137bp	9%	278.3M
tih_rna_sample_00636_B23MVV7LT4_1_trimmed_2																																																		84.3%	56%	126bp	137bp	9%	278.3M	84.3%	56%	126bp	137bp	9%	278.3M
tih_rna_sample_00637_B23MVV7LT4_1	501786604	0.9399	9999000000	228045429	136.6bp	126.0bp	0.01%	0.73%	0.36%	0.00%	0.01%	2.37%	0.53%	0.00%	0.03	No	0.00%	521622402	0.01%	0.54%	240554570	0.93%	0.96%	0.05%	0.04%	224084602	112826782	13136087	4938295	398.51	180.00	0.72%	0.60%	0.98	0.000				54.2%	88.0%	95.2%	248.4M	36.8%	98.0%	63959.2Mb	521.6M	55.7%	98.6%	62.5%
tih_rna_sample_00637_B23MVV7LT4_1_1																																				136.6bp	98.0%	255.5M												82.1%	54%	151bp	151bp	18%	264.4M
tih_rna_sample_00637_B23MVV7LT4_1_2																																																		81.1%	55%	151bp	151bp	18%	264.4M
tih_rna_sample_00637_B23MVV7LT4_1_trimmed_1																																																		82.1%	55%	125bp	132bp	9%	260.8M	82.1%	55%	125bp	132bp	9%	260.8M
tih_rna_sample_00637_B23MVV7LT4_1_trimmed_2																																																		82.2%	56%	125bp	132bp	9%	260.8M	82.2%	56%	125bp	132bp	9%	260.8M
tih_rna_sample_00638_B23MVV7LT4_1	462766006	0.8933	9999000000	144693662	114.3bp	107.0bp	0.01%	1.29%	0.51%	0.00%	0.01%	3.51%	0.73%	0.00%	5.15	No	0.00%	484672702	0.01%	0.64%	175262939	0.93%	0.96%	0.05%	0.04%	163543348	82098892	8886491	3461659	249.14	110.00	0.69%	0.52%	0.98	0.000				64.2%	86.0%	94.4%	228.8M	34.8%	98.1%	53504.1Mb	484.7M	54.8%	98.7%	80.2%
tih_rna_sample_00638_B23MVV7LT4_1_1																																				114.3bp	98.3%	238.3M												82.4%	54%	151bp	151bp	18%	245.4M
tih_rna_sample_00638_B23MVV7LT4_1_2																																																		81.4%	54%	151bp	151bp	27%	245.4M
tih_rna_sample_00638_B23MVV7LT4_1_trimmed_1																																																		82.4%	54%	112bp	112bp	9%	242.3M	82.4%	54%	112bp	112bp	9%	242.3M
tih_rna_sample_00638_B23MVV7LT4_1_trimmed_2																																																		82.3%	55%	113bp	112bp	9%	242.3M	82.3%	55%	113bp	112bp	9%	242.3M
tih_rna_sample_00639_B23MVV7LT4_1	569511729	0.9536	9999000000	124285585	121.9bp	114.0bp	0.02%	1.76%	0.62%	0.00%	0.04%	4.73%	0.93%	0.00%	0.01	No	0.00%	591737144	0.01%	0.71%	169647005	0.93%	0.96%	0.06%	0.04%	156929610	78849744	9431755	3603682	251.06	72.00	0.60%	0.45%	0.98	0.000				71.7%	87.9%	95.2%	281.6M	43.3%	98.0%	67885.6Mb	591.7M	55.6%	98.6%	75.0%
tih_rna_sample_00639_B23MVV7LT4_1_1																																				121.9bp	98.4%	291.2M												87.4%	54%	151bp	151bp	18%	341.9M
tih_rna_sample_00639_B23MVV7LT4_1_2																																																		86.2%	55%	151bp	151bp	18%	341.9M
tih_rna_sample_00639_B23MVV7LT4_1_trimmed_1																																																		86.4%	55%	117bp	117bp	9%	295.9M	86.4%	55%	117bp	117bp	9%	295.9M
tih_rna_sample_00639_B23MVV7LT4_1_trimmed_2																																																		86.2%	55%	117bp	117bp	9%	295.9M	86.2%	55%	117bp	117bp	9%	295.9M
tih_rna_sample_00641_B23MVV7LT4_1	574546710	0.9079	9999000000	468755181	154.7bp	140.0bp	0.01%	0.84%	0.35%	0.00%	0.02%	2.82%	0.57%	0.00%	0.01	No	0.00%	591679532	0.01%	0.45%	325148798	0.94%	0.97%	0.05%	0.03%	307098634	155335506	14877671	4477523	621.38	325.00	0.78%	0.68%	0.98	0.000				45.3%	91.1%	96.0%	284.2M	32.6%	98.0%	76458.9Mb	591.7M	53.9%	98.6%	48.0%
tih_rna_sample_00641_B23MVV7LT4_1_1																																				154.7bp	98.3%	290.9M												86.7%	53%	151bp	151bp	18%	447.4M
tih_rna_sample_00641_B23MVV7LT4_1_2																																																		85.8%	54%	151bp	151bp	18%	447.4M
tih_rna_sample_00641_B23MVV7LT4_1_trimmed_1																																																		84.1%	53%	132bp	151bp	9%	295.8M	84.1%	53%	132bp	151bp	9%	295.8M
tih_rna_sample_00641_B23MVV7LT4_1_trimmed_2																																																		84.3%	54%	132bp	151bp	9%	295.8M	84.3%	54%	132bp	151bp	9%	295.8M
tih_rna_sample_00643_B23MVV7LT4_1	409952337	0.8807	9999000000	85724318	120.9bp	113.0bp	0.00%	0.54%	0.38%	0.00%	0.01%	1.68%	0.57%	0.00%	0.01	No	0.00%	432704864	0.01%	0.74%	113888135	0.89%	0.94%	0.07%	0.06%	100881444	50638571	8242215	3408348	154.57	60.00	0.61%	0.39%	0.98	0.000				74.5%	83.2%	93.7%	202.6M	46.6%	97.9%	49687.7Mb	432.7M	57.2%	98.6%	75.2%
tih_rna_sample_00643_B23MVV7LT4_1_1																																				120.9bp	98.0%	212.0M												86.3%	55%	151bp	151bp	18%	219.3M
tih_rna_sample_00643_B23MVV7LT4_1_2																																																		85.3%	56%	151bp	151bp	18%	219.3M
tih_rna_sample_00643_B23MVV7LT4_1_trimmed_1																																																		86.3%	56%	117bp	117bp	9%	216.4M	86.3%	56%	117bp	117bp	9%	216.4M
tih_rna_sample_00643_B23MVV7LT4_1_trimmed_2																																																		86.3%	57%	117bp	117bp	9%	216.4M	86.3%	57%	117bp	117bp	9%	216.4M
tih_rna_sample_00644_B23MVV7LT4_1	570207621	0.8733	9999000000	221263011	137.9bp	128.0bp	0.01%	1.81%	0.46%	0.00%	0.02%	5.20%	0.72%	0.00%	6.04	No	0.00%	592282932	0.01%	0.58%	248394984	0.93%	0.96%	0.06%	0.04%	230895109	116352816	13819461	5091028	412.01	176.00	0.69%	0.58%	0.98	0.000				58.4%	87.8%	95.3%	282.4M	39.3%	98.0%	73476.1Mb	592.3M	55.8%	98.7%	62.1%
tih_rna_sample_00644_B23MVV7LT4_1_1																																				137.9bp	97.9%	290.0M												83.1%	54%	151bp	151bp	18%	335.4M
tih_rna_sample_00644_B23MVV7LT4_1_2																																																		81.8%	55%	151bp	151bp	18%	335.4M
tih_rna_sample_00644_B23MVV7LT4_1_trimmed_1																																																		82.1%	55%	126bp	132bp	9%	296.1M	82.1%	55%	126bp	132bp	9%	296.1M
tih_rna_sample_00644_B23MVV7LT4_1_trimmed_2																																																		81.9%	56%	127bp	132bp	9%	296.1M	81.9%	56%	127bp	132bp	9%	296.1M
tih_rna_sample_00649_B23MVV7LT4_1	574052108	0.9308	9999000000	403152055	148.5bp	134.0bp	0.01%	0.84%	0.62%	0.00%	0.02%	2.55%	0.94%	0.00%	5.34	No	0.00%	592717232	0.01%	0.49%	304508910	0.95%	0.98%	0.04%	0.02%	289415853	146060989	11932194	3589372	565.76	243.00	0.73%	0.63%	0.98	0.000				48.9%	89.7%	95.9%	284.3M	34.8%	98.1%	75380.6Mb	592.7M	55.5%	98.8%	53.8%
tih_rna_sample_00649_B23MVV7LT4_1_1																																				148.5bp	98.4%	291.8M												86.8%	54%	151bp	151bp	18%	506.8M
tih_rna_sample_00649_B23MVV7LT4_1_2																																																		85.4%	55%	151bp	151bp	18%	506.8M
tih_rna_sample_00649_B23MVV7LT4_1_trimmed_1																																																		83.5%	55%	130bp	142bp	9%	296.4M	83.5%	55%	130bp	142bp	9%	296.4M
tih_rna_sample_00649_B23MVV7LT4_1_trimmed_2																																																		83.1%	55%	130bp	142bp	9%	296.4M	83.1%	55%	130bp	142bp	9%	296.4M
tih_rna_sample_00650_B23MVV7LT4_1	570113040	0.8959	9999000000	459886347	165.4bp	149.0bp	0.01%	0.45%	0.28%	0.00%	0.02%	1.45%	0.43%	0.00%	6.09	No	0.00%	592724998	0.01%	0.43%	334924231	0.94%	0.97%	0.05%	0.03%	313274681	159009275	17403706	5122784	648.91	329.00	0.77%	0.67%	0.98	0.000				43.8%	88.9%	95.4%	282.7M	33.1%	97.9%	78236.3Mb	592.7M	55.4%	98.8%	43.7%
tih_rna_sample_00650_B23MVV7LT4_1_1																																				165.4bp	97.7%	289.6M												85.3%	54%	151bp	151bp	18%	374.6M
tih_rna_sample_00650_B23MVV7LT4_1_2																																																		84.5%	55%	151bp	151bp	18%	374.6M
tih_rna_sample_00650_B23MVV7LT4_1_trimmed_1																																																		83.8%	55%	135bp	151bp	9%	296.4M	83.8%	55%	135bp	151bp	9%	296.4M
tih_rna_sample_00650_B23MVV7LT4_1_trimmed_2																																																		83.9%	55%	135bp	151bp	9%	296.4M	83.9%	55%	135bp	151bp	9%	296.4M
tih_rna_sample_00652_B23MVV7LT4_1	557086261	0.9448	9999000000	139254283	155.1bp	140.0bp	0.01%	0.88%	0.19%	0.00%	0.03%	2.20%	0.25%	0.00%	0.02	No	0.00%	591705478	0.01%	0.71%	174036176	0.92%	0.96%	0.06%	0.04%	159914193	80941369	10385507	3347280	318.20	147.00	0.72%	0.57%	0.98	0.000				71.0%	84.5%	93.4%	276.2M	53.5%	97.9%	76484.8Mb	591.7M	56.1%	98.6%	49.4%
tih_rna_sample_00652_B23MVV7LT4_1_1																																				155.1bp	97.6%	288.8M												89.1%	55%	151bp	151bp	18%	331.6M
tih_rna_sample_00652_B23MVV7LT4_1_2																																																		87.7%	56%	151bp	151bp	18%	331.6M
tih_rna_sample_00652_B23MVV7LT4_1_trimmed_1																																																		88.5%	55%	132bp	151bp	9%	295.9M	88.5%	55%	132bp	151bp	9%	295.9M
tih_rna_sample_00652_B23MVV7LT4_1_trimmed_2																																																		88.3%	56%	132bp	151bp	9%	295.9M	88.3%	56%	132bp	151bp	9%	295.9M
tih_rna_sample_00654_B23MVV7LT4_1	574868698	0.9319	9999000000	313907171	147.3bp	133.0bp	0.01%	1.17%	0.47%	0.00%	0.02%	3.69%	0.71%	0.00%	0.04	Yes	0.00%	592296668	0.01%	0.51%	289847524	0.94%	0.97%	0.05%	0.03%	273440445	138184122	13143312	4025848	527.61	248.00	0.75%	0.64%	0.98	0.000				51.3%	90.0%	96.0%	284.2M	37.7%	98.0%	75069.3Mb	592.3M	55.5%	98.7%	54.7%
tih_rna_sample_00654_B23MVV7LT4_1_1																																				147.3bp	98.4%	291.3M												86.4%	54%	151bp	151bp	18%	380.9M
tih_rna_sample_00654_B23MVV7LT4_1_2																																																		85.2%	55%	151bp	151bp	18%	380.9M
tih_rna_sample_00654_B23MVV7LT4_1_trimmed_1																																																		84.9%	55%	129bp	142bp	9%	296.1M	84.9%	55%	129bp	142bp	9%	296.1M
tih_rna_sample_00654_B23MVV7LT4_1_trimmed_2																																																		84.6%	55%	129bp	142bp	9%	296.1M	84.6%	55%	129bp	142bp	9%	296.1M
tih_rna_sample_00658_B23MVV7LT4_1	445975698	0.9183	9999000000	246148811	136.7bp	125.0bp	0.01%	0.77%	0.28%	0.00%	0.01%	2.77%	0.48%	0.00%	0.01	No	0.00%	459172864	0.01%	0.51%	224424788	0.94%	0.97%	0.05%	0.03%	211107004	106312218	10810374	3822012	385.78	185.00	0.74%	0.61%	0.98	0.000				51.4%	90.2%	96.1%	220.6M	34.4%	98.0%	56876.6Mb	459.2M	54.8%	98.6%	60.5%
tih_rna_sample_00658_B23MVV7LT4_1_1																																				136.7bp	98.3%	225.8M												82.5%	53%	151bp	151bp	18%	232.8M
tih_rna_sample_00658_B23MVV7LT4_1_2																																																		81.7%	54%	151bp	151bp	18%	232.8M
tih_rna_sample_00658_B23MVV7LT4_1_trimmed_1																																																		82.5%	54%	126bp	137bp	9%	229.6M	82.5%	54%	126bp	137bp	9%	229.6M
tih_rna_sample_00658_B23MVV7LT4_1_trimmed_2																																																		82.8%	55%	126bp	137bp	9%	229.6M	82.8%	55%	126bp	137bp	9%	229.6M
tih_rna_sample_00660_B23MVV7LT4_1	488278726	0.9295	9999000000	134436419	128.6bp	120.0bp	0.01%	1.01%	0.35%	0.00%	0.02%	3.17%	0.57%	0.00%	0.01	No	0.00%	505509640	0.01%	0.67%	167456536	0.92%	0.95%	0.06%	0.05%	154234129	77613961	9957006	3818038	254.76	121.00	0.70%	0.54%	0.98	0.000				67.3%	88.2%	95.4%	241.2M	47.6%	98.1%	60554.8Mb	505.5M	55.2%	98.8%	68.8%
tih_rna_sample_00660_B23MVV7LT4_1_1																																				128.6bp	98.3%	248.6M												85.6%	54%	151bp	151bp	18%	255.9M
tih_rna_sample_00660_B23MVV7LT4_1_2																																																		84.0%	54%	151bp	151bp	18%	255.9M
tih_rna_sample_00660_B23MVV7LT4_1_trimmed_1																																																		85.6%	54%	122bp	127bp	9%	252.8M	85.6%	54%	122bp	127bp	9%	252.8M
tih_rna_sample_00660_B23MVV7LT4_1_trimmed_2																																																		85.0%	55%	122bp	127bp	9%	252.8M	85.0%	55%	122bp	127bp	9%	252.8M
tih_rna_sample_00664_B23MVV7LT4_1	516776876	0.9555	9999000000	367512639	148.5bp	135.0bp	0.04%	0.99%	0.53%	0.00%	0.07%	2.82%	0.73%	0.00%	0.01	No	0.00%	533018650	0.01%	0.46%	287237100	0.94%	0.97%	0.04%	0.03%	271292936	137110800	12746031	3901652	529.07	209.00	0.72%	0.61%	0.98	0.000				46.4%	89.6%	95.9%	255.7M	33.6%	98.0%	67701.3Mb	533.0M	54.0%	98.8%	54.4%
tih_rna_sample_00664_B23MVV7LT4_1_1																																				148.5bp	98.3%	262.0M												83.7%	53%	151bp	151bp	18%	269.8M
tih_rna_sample_00664_B23MVV7LT4_1_2																																																		82.3%	54%	151bp	151bp	18%	269.8M
tih_rna_sample_00664_B23MVV7LT4_1_trimmed_1																																																		83.7%	53%	130bp	142bp	9%	266.5M	83.7%	53%	130bp	142bp	9%	266.5M
tih_rna_sample_00664_B23MVV7LT4_1_trimmed_2																																																		83.2%	54%	130bp	142bp	9%	266.5M	83.2%	54%	130bp	142bp	9%	266.5M
tih_rna_sample_00665_B23MVV7LT4_1	573504326	0.9525	9999000000	379380581	151.9bp	139.0bp	0.02%	1.13%	0.46%	0.00%	0.04%	3.55%	0.69%	0.00%	0.01	Yes	0.00%	592296166	0.01%	0.48%	305766250	0.95%	0.97%	0.04%	0.03%	289118278	146081141	13193968	4016266	577.04	294.00	0.78%	0.67%	0.98	0.000				48.7%	89.9%	95.9%	283.9M	35.0%	97.9%	76502.9Mb	592.3M	54.7%	98.7%	51.0%
tih_rna_sample_00665_B23MVV7LT4_1_1																																				151.9bp	98.2%	290.8M												86.5%	54%	151bp	151bp	18%	427.0M
tih_rna_sample_00665_B23MVV7LT4_1_2																																																		85.4%	54%	151bp	151bp	18%	427.0M
tih_rna_sample_00665_B23MVV7LT4_1_trimmed_1																																																		84.2%	54%	132bp	147bp	9%	296.1M	84.2%	54%	132bp	147bp	9%	296.1M
tih_rna_sample_00665_B23MVV7LT4_1_trimmed_2																																																		84.0%	55%	132bp	147bp	9%	296.1M	84.0%	55%	132bp	147bp	9%	296.1M
tih_rna_sample_00666_B23MVV7LT4_1	436928027	0.9433	9999000000	82081009	116.1bp	111.0bp	0.01%	0.90%	0.45%	0.00%	0.03%	2.87%	0.69%	0.00%	0.00	No	0.00%	456878374	0.01%	0.77%	107071768	0.89%	0.94%	0.07%	0.06%	95725697	47959893	7641364	3222857	139.27	52.00	0.59%	0.37%	0.98	0.000				77.2%	84.8%	94.5%	215.9M	50.5%	98.1%	51213.2Mb	456.9M	56.5%	98.6%	80.6%
tih_rna_sample_00666_B23MVV7LT4_1_1																																				116.1bp	98.2%	224.3M												86.6%	55%	151bp	151bp	18%	231.7M
tih_rna_sample_00666_B23MVV7LT4_1_2																																																		85.0%	55%	151bp	151bp	27%	231.7M
tih_rna_sample_00666_B23MVV7LT4_1_trimmed_1																																																		86.6%	56%	114bp	112bp	9%	228.4M	86.6%	56%	114bp	112bp	9%	228.4M
tih_rna_sample_00666_B23MVV7LT4_1_trimmed_2																																																		86.1%	56%	114bp	112bp	9%	228.4M	86.1%	56%	114bp	112bp	9%	228.4M
tih_rna_sample_00667_B23MVV7LT4_1	250910866	0.9548	9999000000	38432813	134.2bp	127.0bp	0.01%	0.55%	0.30%	0.00%	0.01%	1.79%	0.48%	0.00%	5.93	No	0.00%	261635160	0.01%	0.81%	50372688	0.86%	0.92%	0.09%	0.08%	43521809	21882661	4505787	1828904	70.92	26.00	0.47%	0.19%	0.98	0.000				81.5%	86.0%	94.7%	123.8M	59.3%	97.9%	32122.0Mb	261.6M	58.0%	98.4%	65.4%
tih_rna_sample_00667_B23MVV7LT4_1_1																																				134.2bp	97.7%	127.8M												86.7%	56%	151bp	151bp	18%	132.9M
tih_rna_sample_00667_B23MVV7LT4_1_2																																																		85.0%	57%	151bp	151bp	18%	132.9M
tih_rna_sample_00667_B23MVV7LT4_1_trimmed_1																																																		86.7%	57%	125bp	132bp	9%	130.8M	86.7%	57%	125bp	132bp	9%	130.8M
tih_rna_sample_00667_B23MVV7LT4_1_trimmed_2																																																		86.1%	58%	125bp	132bp	9%	130.8M	86.1%	58%	125bp	132bp	9%	130.8M
tih_rna_sample_00668_B23MVV7LT4_1	580576981	0.9447	9999000000	406160688	148.5bp	136.0bp	0.01%	0.65%	0.29%	0.00%	0.01%	2.48%	0.54%	0.00%	6.11	No	0.00%	593628098	0.00%	0.52%	286631132	0.95%	0.97%	0.04%	0.03%	271943511	137319201	11774976	3621626	542.15	253.00	0.75%	0.64%	0.98	0.000				52.0%	92.4%	96.7%	287.0M	36.9%	98.0%	76403.4Mb	593.6M	56.1%	98.9%	52.1%
tih_rna_sample_00668_B23MVV7LT4_1_1																																				148.5bp	98.7%	292.8M												89.0%	55%	151bp	151bp	27%	600.5M
tih_rna_sample_00668_B23MVV7LT4_1_2																																																		88.3%	55%	151bp	151bp	27%	600.5M
tih_rna_sample_00668_B23MVV7LT4_1_trimmed_1																																																		85.1%	55%	131bp	147bp	18%	296.8M	85.1%	55%	131bp	147bp	18%	296.8M
tih_rna_sample_00668_B23MVV7LT4_1_trimmed_2																																																		85.2%	56%	131bp	147bp	18%	296.8M	85.2%	56%	131bp	147bp	18%	296.8M
tih_rna_sample_00669_B23MVV7LT4_1	527112580	0.9563	9999000000	221283396	134.1bp	124.0bp	0.01%	0.74%	0.47%	0.00%	0.02%	2.31%	0.69%	0.00%	0.03	No	0.00%	545770758	0.01%	0.56%	240231598	0.93%	0.96%	0.05%	0.04%	224023214	112812228	12195514	4432919	392.91	186.00	0.74%	0.61%	0.98	0.000				56.4%	89.0%	95.7%	261.0M	37.0%	98.0%	66519.9Mb	545.8M	55.0%	98.7%	64.7%
tih_rna_sample_00669_B23MVV7LT4_1_1																																				134.1bp	98.1%	267.7M												82.2%	53%	151bp	151bp	18%	276.5M
tih_rna_sample_00669_B23MVV7LT4_1_2																																																		81.4%	54%	151bp	151bp	18%	276.5M
tih_rna_sample_00669_B23MVV7LT4_1_trimmed_1																																																		82.2%	54%	124bp	132bp	9%	272.9M	82.2%	54%	124bp	132bp	9%	272.9M
tih_rna_sample_00669_B23MVV7LT4_1_trimmed_2																																																		82.5%	55%	124bp	132bp	9%	272.9M	82.5%	55%	124bp	132bp	9%	272.9M
tih_rna_sample_00671_B23MVV7LT4_1	573320715	0.9603	9999000000	464858932	167.9bp	151.0bp	0.02%	1.38%	0.53%	0.00%	0.04%	4.19%	0.81%	0.00%	4.26	No	0.00%	592738002	0.01%	0.44%	334190228	0.94%	0.97%	0.05%	0.03%	315253643	159879201	15418736	4226063	664.94	322.00	0.75%	0.65%	0.98	0.000				43.9%	90.1%	95.9%	284.2M	34.4%	98.1%	78773.2Mb	592.7M	54.6%	98.8%	41.8%
tih_rna_sample_00671_B23MVV7LT4_1_1																																				167.9bp	98.0%	290.4M												86.3%	53%	151bp	151bp	18%	380.1M
tih_rna_sample_00671_B23MVV7LT4_1_2																																																		85.1%	54%	151bp	151bp	18%	380.1M
tih_rna_sample_00671_B23MVV7LT4_1_trimmed_1																																																		84.7%	54%	135bp	151bp	9%	296.4M	84.7%	54%	135bp	151bp	9%	296.4M
tih_rna_sample_00671_B23MVV7LT4_1_trimmed_2																																																		84.6%	55%	136bp	151bp	9%	296.4M	84.6%	55%	136bp	151bp	9%	296.4M
tih_rna_sample_00673_B23MVV7LT4_1	576584567	0.9670	9999000000	132983057	148.2bp	138.0bp	0.00%	0.99%	0.36%	0.00%	0.01%	3.12%	0.58%	0.00%	6.01	No	0.00%	592636942	0.01%	0.71%	172802670	0.93%	0.96%	0.05%	0.04%	159972422	80701716	9432306	3227061	299.55	116.00	0.68%	0.53%	0.98	0.000				71.3%	90.9%	96.1%	284.9M	56.4%	98.0%	77114.2Mb	592.6M	56.3%	98.8%	53.3%
tih_rna_sample_00673_B23MVV7LT4_1_1																																				148.2bp	98.4%	291.6M												88.4%	55%	151bp	151bp	18%	323.9M
tih_rna_sample_00673_B23MVV7LT4_1_2																																																		87.5%	56%	151bp	151bp	18%	323.9M
tih_rna_sample_00673_B23MVV7LT4_1_trimmed_1																																																		87.9%	56%	133bp	147bp	9%	296.3M	87.9%	56%	133bp	147bp	9%	296.3M
tih_rna_sample_00673_B23MVV7LT4_1_trimmed_2																																																		87.9%	56%	133bp	147bp	9%	296.3M	87.9%	56%	133bp	147bp	9%	296.3M
tih_rna_sample_00676_B23MVV7LT4_1	572541730	0.9066	9999000000	396901892	156.8bp	141.0bp	0.01%	1.27%	0.38%	0.00%	0.03%	3.86%	0.59%	0.00%	0.01	No	0.00%	590869318	0.01%	0.46%	317533767	0.94%	0.97%	0.05%	0.03%	298796376	151157203	15736595	4854876	600.80	249.00	0.73%	0.62%	0.98	0.000				46.5%	90.0%	95.9%	283.4M	33.5%	98.0%	76405.3Mb	590.9M	53.9%	98.5%	48.0%
tih_rna_sample_00676_B23MVV7LT4_1_1																																				156.8bp	98.1%	289.7M												84.7%	53%	151bp	151bp	18%	347.5M
tih_rna_sample_00676_B23MVV7LT4_1_2																																																		83.9%	54%	151bp	151bp	18%	347.5M
tih_rna_sample_00676_B23MVV7LT4_1_trimmed_1																																																		83.7%	53%	132bp	151bp	9%	295.4M	83.7%	53%	132bp	151bp	9%	295.4M
tih_rna_sample_00676_B23MVV7LT4_1_trimmed_2																																																		84.1%	54%	132bp	151bp	9%	295.4M	84.1%	54%	132bp	151bp	9%	295.4M
tih_rna_sample_00677_B23MVV7LT4_1	36579055	0.8782	9999000000	8439081	106.7bp	102.0bp	0.00%	0.72%	0.26%	0.00%	0.01%	2.27%	0.47%	0.00%	0.06	No	0.00%	40678016	0.02%	0.78%	8789929	0.80%	0.91%	0.09%	0.09%	7072167	3533847	776009	345768	9.24	2.00	0.05%	0.01%	0.98	0.000				80.2%	73.0%	88.7%	18.0M	40.0%	97.5%	4197.5Mb	40.7M	60.0%	97.2%	86.8%
tih_rna_sample_00677_B23MVV7LT4_1_1																																				106.7bp	97.2%	19.8M												83.2%	57%	151bp	151bp	18%	20.9M
tih_rna_sample_00677_B23MVV7LT4_1_2																																																		82.1%	58%	151bp	151bp	36%	20.9M
tih_rna_sample_00677_B23MVV7LT4_1_trimmed_1																																																		83.0%	59%	106bp	102bp	9%	20.3M	83.0%	59%	106bp	102bp	9%	20.3M
tih_rna_sample_00677_B23MVV7LT4_1_trimmed_2																																																		83.0%	60%	106bp	102bp	9%	20.3M	83.0%	60%	106bp	102bp	9%	20.3M
tih_rna_sample_00678_B23MVV7LT4_1	296156264	0.9230	9999000000	61218136	114.2bp	108.0bp	0.01%	0.87%	0.34%	0.00%	0.02%	2.78%	0.55%	0.00%	0.25	No	0.00%	309640796	0.01%	0.74%	80867702	0.89%	0.93%	0.08%	0.07%	72102621	36162135	6223261	2626568	107.08	45.00	0.58%	0.31%	0.98	0.000				74.5%	85.3%	94.5%	146.3M	46.9%	97.9%	34478.1Mb	309.6M	57.0%	98.5%	78.6%
tih_rna_sample_00678_B23MVV7LT4_1_1																																				114.2bp	98.0%	151.8M												85.5%	55%	151bp	151bp	18%	157.1M
tih_rna_sample_00678_B23MVV7LT4_1_2																																																		84.3%	56%	151bp	151bp	27%	157.1M
tih_rna_sample_00678_B23MVV7LT4_1_trimmed_1																																																		85.6%	56%	114bp	112bp	9%	154.8M	85.6%	56%	114bp	112bp	9%	154.8M
tih_rna_sample_00678_B23MVV7LT4_1_trimmed_2																																																		85.3%	57%	114bp	112bp	9%	154.8M	85.3%	57%	114bp	112bp	9%	154.8M
tih_rna_sample_00679_B23MVV7LT4_1	98104839	0.8705	9999000000	25246221	100.6bp	97.0bp	0.01%	0.85%	0.35%	0.00%	0.03%	2.46%	0.52%	0.00%	0.04	No	0.00%	103388652	0.01%	0.73%	27908455	0.87%	0.92%	0.09%	0.08%	24391532	12204184	2513631	1130127	30.61	9.00	0.26%	0.06%	0.98	0.000				73.7%	82.2%	93.5%	48.4M	34.6%	98.0%	10321.0Mb	103.4M	56.3%	98.4%	90.5%
tih_rna_sample_00679_B23MVV7LT4_1_1																																				100.6bp	97.4%	50.3M												78.7%	55%	151bp	151bp	18%	52.5M
tih_rna_sample_00679_B23MVV7LT4_1_2																																																		77.5%	55%	151bp	151bp	27%	52.5M
tih_rna_sample_00679_B23MVV7LT4_1_trimmed_1																																																		78.6%	56%	102bp	102bp	9%	51.7M	78.6%	56%	102bp	102bp	9%	51.7M
tih_rna_sample_00679_B23MVV7LT4_1_trimmed_2																																																		78.3%	56%	102bp	102bp	9%	51.7M	78.3%	56%	102bp	102bp	9%	51.7M
tih_rna_sample_00680_B23MVV7LT4_1	574167458	0.9411	9999000000	371241703	145.1bp	133.0bp	0.01%	0.97%	0.42%	0.00%	0.02%	3.14%	0.66%	0.00%	0.30	Yes	0.22%	592183838	0.01%	0.48%	309009609	0.94%	0.97%	0.05%	0.03%	291192230	147006383	14290144	4691369	555.34	280.00	0.76%	0.66%	0.98	0.000				48.1%	90.4%	96.0%	284.4M	33.5%	98.0%	74929.2Mb	592.2M	55.0%	98.7%	56.2%
tih_rna_sample_00680_B23MVV7LT4_1_1																																				145.1bp	98.2%	290.6M												84.5%	54%	151bp	151bp	18%	397.1M
tih_rna_sample_00680_B23MVV7LT4_1_2																																																		83.4%	54%	151bp	151bp	18%	397.1M
tih_rna_sample_00680_B23MVV7LT4_1_trimmed_1																																																		82.4%	54%	129bp	142bp	9%	296.1M	82.4%	54%	129bp	142bp	9%	296.1M
tih_rna_sample_00680_B23MVV7LT4_1_trimmed_2																																																		82.3%	55%	129bp	142bp	9%	296.1M	82.3%	55%	129bp	142bp	9%	296.1M
tih_rna_sample_00681_B23MVV7LT4_1	574730086	0.9314	9999000000	359984223	148.3bp	136.0bp	0.01%	0.93%	0.43%	0.00%	0.01%	3.05%	0.68%	0.00%	6.05	No	0.00%	592673976	0.01%	0.49%	300971132	0.94%	0.97%	0.04%	0.03%	284336657	143655456	13040498	3991642	556.14	253.00	0.76%	0.64%	0.98	0.000				49.5%	90.3%	96.0%	284.4M	34.7%	98.0%	75649.0Mb	592.7M	56.0%	98.8%	53.1%
tih_rna_sample_00681_B23MVV7LT4_1_1																																				148.3bp	98.3%	291.4M												87.0%	55%	151bp	151bp	18%	457.8M
tih_rna_sample_00681_B23MVV7LT4_1_2																																																		85.9%	56%	151bp	151bp	18%	457.8M
tih_rna_sample_00681_B23MVV7LT4_1_trimmed_1																																																		84.2%	55%	130bp	147bp	9%	296.3M	84.2%	55%	130bp	147bp	9%	296.3M
tih_rna_sample_00681_B23MVV7LT4_1_trimmed_2																																																		84.1%	56%	130bp	147bp	9%	296.3M	84.1%	56%	130bp	147bp	9%	296.3M
tih_rna_sample_00685_B23MVV7LT4_1	263944027	0.9121	9999000000	198860691	130.3bp	120.0bp	0.01%	0.62%	0.27%	0.00%	0.04%	2.04%	0.42%	0.00%	0.00	No	0.00%	272837788	0.01%	0.44%	153930426	0.94%	0.97%	0.05%	0.03%	145309051	73097603	6932929	2484416	251.57	116.00	0.69%	0.53%	0.98	0.000				43.9%	89.2%	95.7%	130.5M	26.6%	98.0%	32545.0Mb	272.8M	55.3%	98.5%	66.7%
tih_rna_sample_00685_B23MVV7LT4_1_1																																				130.3bp	98.3%	134.2M												77.1%	54%	151bp	151bp	18%	138.4M
tih_rna_sample_00685_B23MVV7LT4_1_2																																																		75.8%	55%	151bp	151bp	27%	138.4M
tih_rna_sample_00685_B23MVV7LT4_1_trimmed_1																																																		77.0%	55%	122bp	127bp	9%	136.4M	77.0%	55%	122bp	127bp	9%	136.4M
tih_rna_sample_00685_B23MVV7LT4_1_trimmed_2																																																		76.8%	55%	122bp	127bp	9%	136.4M	76.8%	55%	122bp	127bp	9%	136.4M
tih_rna_sample_00686_B23MVV7LT4_1	570862607	0.9502	9999000000	462707611	168.1bp	150.0bp	0.01%	1.10%	0.61%	0.00%	0.03%	3.68%	0.96%	0.00%	5.14	No	0.00%	591222488	0.01%	0.46%	320681316	0.95%	0.98%	0.04%	0.02%	303928986	153880026	13627596	3553821	649.94	285.00	0.74%	0.64%	0.98	0.000				46.0%	89.4%	95.7%	282.9M	33.2%	97.9%	78136.4Mb	591.2M	56.4%	98.5%	41.7%
tih_rna_sample_00686_B23MVV7LT4_1_1																																				168.1bp	98.3%	290.7M												84.7%	55%	151bp	151bp	18%	326.4M
tih_rna_sample_00686_B23MVV7LT4_1_2																																																		83.6%	56%	151bp	151bp	18%	326.4M
tih_rna_sample_00686_B23MVV7LT4_1_trimmed_1																																																		84.1%	55%	135bp	151bp	9%	295.6M	84.1%	55%	135bp	151bp	9%	295.6M
tih_rna_sample_00686_B23MVV7LT4_1_trimmed_2																																																		84.2%	56%	135bp	151bp	9%	295.6M	84.2%	56%	135bp	151bp	9%	295.6M
tih_rna_sample_00690_B23MVV7LT4_1	405019212	0.9400	9999000000	112115003	120.7bp	113.0bp	0.01%	1.05%	0.56%	0.00%	0.02%	3.06%	0.81%	0.00%	0.02	No	0.00%	419662118	0.01%	0.67%	139019897	0.93%	0.96%	0.05%	0.04%	128729310	64610704	7555799	2915019	198.70	81.00	0.65%	0.46%	0.98	0.000				67.3%	88.5%	95.3%	200.1M	46.8%	98.0%	48128.1Mb	419.7M	55.6%	98.4%	75.1%
tih_rna_sample_00690_B23MVV7LT4_1_1																																				120.7bp	98.3%	206.3M												84.4%	54%	151bp	151bp	18%	213.3M
tih_rna_sample_00690_B23MVV7LT4_1_2																																																		83.2%	54%	151bp	151bp	18%	213.3M
tih_rna_sample_00690_B23MVV7LT4_1_trimmed_1																																																		84.5%	55%	117bp	117bp	9%	209.8M	84.5%	55%	117bp	117bp	9%	209.8M
tih_rna_sample_00690_B23MVV7LT4_1_trimmed_2																																																		84.5%	55%	117bp	117bp	9%	209.8M	84.5%	55%	117bp	117bp	9%	209.8M
tih_rna_sample_00691_B23MVV7LT4_1	476175470	0.9440	9990000000	302298911	142.4bp	130.0bp	0.01%	1.83%	0.35%	0.00%	0.02%	5.14%	0.54%	0.00%	0.01	No	0.00%	492573176	0.01%	0.47%	259578431	0.94%	0.97%	0.05%	0.03%	244816441	123490877	11855509	3925455	460.80	197.00	0.73%	0.61%	0.98	0.000				47.6%	89.5%	95.7%	235.8M	31.9%	98.1%	61573.6Mb	492.6M	54.8%	98.7%	58.1%
tih_rna_sample_00691_B23MVV7LT4_1_1																																				142.4bp	98.4%	242.4M												83.0%	53%	151bp	151bp	18%	249.5M
tih_rna_sample_00691_B23MVV7LT4_1_2																																																		82.2%	54%	151bp	151bp	18%	249.5M
tih_rna_sample_00691_B23MVV7LT4_1_trimmed_1																																																		83.0%	54%	127bp	137bp	9%	246.3M	83.0%	54%	127bp	137bp	9%	246.3M
tih_rna_sample_00691_B23MVV7LT4_1_trimmed_2																																																		83.2%	55%	128bp	137bp	9%	246.3M	83.2%	55%	128bp	137bp	9%	246.3M
tih_rna_sample_00692_B23MVV7LT4_1	460331719	0.9492	9999000000	106079670	132.4bp	124.0bp	0.01%	1.02%	0.41%	0.00%	0.02%	3.07%	0.62%	0.00%	0.23	Yes	0.00%	481945300	0.01%	0.72%	136988456	0.90%	0.94%	0.07%	0.06%	122773147	61785594	10040790	4025427	204.74	98.00	0.67%	0.50%	0.98	0.000				72.2%	86.1%	94.6%	228.0M	50.4%	97.9%	58478.2Mb	481.9M	56.4%	98.6%	65.8%
tih_rna_sample_00692_B23MVV7LT4_1_1																																				132.4bp	97.5%	234.8M												85.3%	54%	151bp	151bp	18%	244.3M
tih_rna_sample_00692_B23MVV7LT4_1_2																																																		84.2%	55%	151bp	151bp	18%	244.3M
tih_rna_sample_00692_B23MVV7LT4_1_trimmed_1																																																		85.4%	56%	124bp	127bp	9%	241.0M	85.4%	56%	124bp	127bp	9%	241.0M
tih_rna_sample_00692_B23MVV7LT4_1_trimmed_2																																																		85.3%	56%	124bp	127bp	9%	241.0M	85.3%	56%	124bp	127bp	9%	241.0M
tih_rna_sample_00693_B23MVV7LT4_1	575032400	0.9546	9999000000	514620511	164.4bp	149.0bp	0.01%	0.75%	0.47%	0.00%	0.02%	2.40%	0.71%	0.00%	0.00	No	0.00%	592749236	0.01%	0.42%	343646531	0.94%	0.97%	0.05%	0.03%	323276316	163824639	16370170	4831842	672.60	336.00	0.77%	0.67%	0.98	0.000				42.3%	91.0%	96.1%	284.7M	32.5%	98.0%	78249.6Mb	592.7M	53.6%	98.8%	43.9%
tih_rna_sample_00693_B23MVV7LT4_1_1																																				164.4bp	97.9%	290.2M												86.5%	53%	151bp	151bp	18%	466.9M
tih_rna_sample_00693_B23MVV7LT4_1_2																																																		85.8%	54%	151bp	151bp	18%	466.9M
tih_rna_sample_00693_B23MVV7LT4_1_trimmed_1																																																		83.6%	53%	135bp	151bp	9%	296.4M	83.6%	53%	135bp	151bp	9%	296.4M
tih_rna_sample_00693_B23MVV7LT4_1_trimmed_2																																																		83.9%	53%	135bp	151bp	9%	296.4M	83.9%	53%	135bp	151bp	9%	296.4M
tih_rna_sample_00694_B23MVV7LT4_1	471817521	0.9405	9999000000	175950239	143.5bp	132.0bp	0.01%	0.71%	0.38%	0.00%	0.02%	2.29%	0.60%	0.00%	0.01	No	0.00%	496664804	0.01%	0.59%	202915501	0.93%	0.96%	0.05%	0.04%	188385367	94964530	10766719	3693248	347.31	152.00	0.71%	0.57%	0.98	0.000				59.6%	85.5%	94.2%	233.8M	41.8%	97.9%	62391.2Mb	496.7M	57.3%	98.2%	56.9%
tih_rna_sample_00694_B23MVV7LT4_1_1																																				143.5bp	98.0%	243.5M												84.3%	56%	151bp	151bp	18%	252.8M
tih_rna_sample_00694_B23MVV7LT4_1_2																																																		82.8%	57%	151bp	151bp	18%	252.8M
tih_rna_sample_00694_B23MVV7LT4_1_trimmed_1																																																		84.4%	56%	128bp	142bp	9%	248.3M	84.4%	56%	128bp	142bp	9%	248.3M
tih_rna_sample_00694_B23MVV7LT4_1_trimmed_2																																																		84.2%	57%	128bp	142bp	9%	248.3M	84.2%	57%	128bp	142bp	9%	248.3M
tih_rna_sample_00699_B23MVV7LT4_1	575803168	0.9084	9999000000	479344433	164.1bp	147.0bp	0.02%	0.73%	0.39%	0.00%	0.04%	2.33%	0.59%	0.00%	0.00	No	0.00%	593060658	0.01%	0.44%	332265344	0.94%	0.97%	0.05%	0.03%	313949315	159126998	15268039	4329111	652.73	316.00	0.77%	0.67%	0.98	0.000				44.2%	90.9%	96.3%	285.5M	32.9%	98.0%	77901.2Mb	593.1M	54.2%	98.8%	44.9%
tih_rna_sample_00699_B23MVV7LT4_1_1																																				164.1bp	98.2%	291.2M												87.1%	53%	151bp	151bp	18%	505.0M
tih_rna_sample_00699_B23MVV7LT4_1_2																																																		85.9%	54%	151bp	151bp	18%	505.0M
tih_rna_sample_00699_B23MVV7LT4_1_trimmed_1																																																		83.8%	53%	134bp	151bp	9%	296.5M	83.8%	53%	134bp	151bp	9%	296.5M
tih_rna_sample_00699_B23MVV7LT4_1_trimmed_2																																																		83.6%	54%	134bp	151bp	9%	296.5M	83.6%	54%	134bp	151bp	9%	296.5M
tih_rna_sample_00701_B23MVV7LT4_1	561542453	0.9597	9999000000	446329630	164.8bp	149.0bp	0.02%	1.36%	0.55%	0.00%	0.04%	4.27%	0.86%	0.00%	0.01	No	0.00%	592696948	0.01%	0.45%	325827314	0.95%	0.98%	0.04%	0.02%	308553140	156265484	14116417	3923316	648.74	322.00	0.76%	0.66%	0.98	0.000				45.3%	85.3%	93.9%	278.3M	35.5%	98.0%	78442.4Mb	592.7M	54.5%	98.8%	43.8%
tih_rna_sample_00701_B23MVV7LT4_1_1																																				164.8bp	98.2%	291.0M												87.0%	53%	151bp	151bp	18%	443.1M
tih_rna_sample_00701_B23MVV7LT4_1_2																																																		86.1%	54%	151bp	151bp	18%	443.1M
tih_rna_sample_00701_B23MVV7LT4_1_trimmed_1																																																		84.5%	54%	135bp	151bp	9%	296.3M	84.5%	54%	135bp	151bp	9%	296.3M
tih_rna_sample_00701_B23MVV7LT4_1_trimmed_2																																																		84.6%	54%	135bp	151bp	9%	296.3M	84.6%	54%	135bp	151bp	9%	296.3M
tih_rna_sample_00703_B23MVV7LT4_1	282066788	0.9227	9999000000	63072243	127.9bp	120.0bp	0.01%	0.91%	0.27%	0.00%	0.03%	2.95%	0.45%	0.00%	0.01	No	0.00%	292770324	0.01%	0.73%	79378562	0.90%	0.93%	0.08%	0.07%	71207506	35783274	6201263	2568009	113.15	50.00	0.60%	0.33%	0.98	0.000				73.4%	87.4%	95.3%	139.5M	51.9%	98.0%	34913.7Mb	292.8M	56.4%	98.7%	70.0%
tih_rna_sample_00703_B23MVV7LT4_1_1																																				127.9bp	97.9%	143.3M												84.6%	54%	151bp	151bp	18%	148.4M
tih_rna_sample_00703_B23MVV7LT4_1_2																																																		83.3%	55%	151bp	151bp	18%	148.4M
tih_rna_sample_00703_B23MVV7LT4_1_trimmed_1																																																		84.6%	56%	122bp	127bp	9%	146.4M	84.6%	56%	122bp	127bp	9%	146.4M
tih_rna_sample_00703_B23MVV7LT4_1_trimmed_2																																																		84.3%	56%	122bp	127bp	9%	146.4M	84.3%	56%	122bp	127bp	9%	146.4M
tih_rna_sample_00704_B23MVV7LT4_1	573644105	0.9593	9999000000	454999653	152.6bp	139.0bp	0.01%	1.33%	0.48%	0.00%	0.03%	3.99%	0.71%	0.00%	0.01	No	0.00%	592449282	0.01%	0.45%	327649474	0.95%	0.97%	0.04%	0.03%	310099837	156699392	14453863	4432493	620.50	221.00	0.70%	0.59%	0.98	0.000				44.9%	90.3%	96.0%	284.4M	32.7%	98.1%	76146.2Mb	592.4M	54.2%	98.7%	51.4%
tih_rna_sample_00704_B23MVV7LT4_1_1																																				152.6bp	98.5%	291.9M												88.1%	53%	151bp	151bp	18%	509.1M
tih_rna_sample_00704_B23MVV7LT4_1_2																																																		87.2%	54%	151bp	151bp	18%	509.1M
tih_rna_sample_00704_B23MVV7LT4_1_trimmed_1																																																		85.0%	53%	131bp	147bp	9%	296.2M	85.0%	53%	131bp	147bp	9%	296.2M
tih_rna_sample_00704_B23MVV7LT4_1_trimmed_2																																																		85.2%	54%	131bp	147bp	9%	296.2M	85.2%	54%	131bp	147bp	9%	296.2M
tih_rna_sample_00709_B23MVV7LT4_1	479095575	0.9319	9999000000	68606855	121.3bp	111.0bp	0.00%	0.91%	0.33%	0.00%	0.01%	2.98%	0.57%	0.00%	0.01	No	0.00%	495265738	0.01%	0.82%	86972187	0.88%	0.94%	0.07%	0.06%	76906046	38591845	6497042	2516091	120.50	44.00	0.57%	0.32%	0.98	0.000				83.0%	87.3%	95.3%	235.9M	51.6%	97.9%	56810.0Mb	495.3M	58.1%	98.4%	71.9%
tih_rna_sample_00709_B23MVV7LT4_1_1																																				121.3bp	98.5%	243.8M												90.4%	55%	151bp	151bp	27%	251.8M
tih_rna_sample_00709_B23MVV7LT4_1_2																																																		88.5%	57%	151bp	151bp	36%	251.8M
tih_rna_sample_00709_B23MVV7LT4_1_trimmed_1																																																		90.4%	57%	117bp	117bp	18%	247.6M	90.4%	57%	117bp	117bp	18%	247.6M
tih_rna_sample_00709_B23MVV7LT4_1_trimmed_2																																																		89.8%	58%	117bp	117bp	18%	247.6M	89.8%	58%	117bp	117bp	18%	247.6M
tih_rna_sample_00711_B23MVV7LT4_1	563156434	0.9693	9999000000	509322548	161.0bp	145.0bp	0.02%	1.28%	0.64%	0.00%	0.04%	3.83%	0.94%	0.00%	0.00	No	0.00%	591624780	0.01%	0.43%	337564982	0.95%	0.98%	0.04%	0.02%	319753259	161817828	14539803	4082133	665.20	300.00	0.73%	0.64%	0.98	0.000				43.2%	86.6%	94.3%	279.1M	32.0%	98.0%	77385.4Mb	591.6M	53.9%	98.6%	45.6%
tih_rna_sample_00711_B23MVV7LT4_1_1																																				161.0bp	98.2%	290.4M												88.3%	53%	151bp	151bp	18%	569.3M
tih_rna_sample_00711_B23MVV7LT4_1_2																																																		87.0%	54%	151bp	151bp	18%	569.3M
tih_rna_sample_00711_B23MVV7LT4_1_trimmed_1																																																		84.6%	53%	133bp	151bp	9%	295.8M	84.6%	53%	133bp	151bp	9%	295.8M
tih_rna_sample_00711_B23MVV7LT4_1_trimmed_2																																																		84.6%	54%	134bp	151bp	9%	295.8M	84.6%	54%	134bp	151bp	9%	295.8M
tih_rna_sample_00714_B23MVV7LT4_1	568495467	0.9581	9999000000	243020908	152.7bp	140.0bp	0.01%	0.65%	0.41%	0.00%	0.01%	1.99%	0.63%	0.00%	0.02	No	0.00%	591804836	0.01%	0.56%	261368385	0.93%	0.97%	0.05%	0.03%	244362050	123629265	13251039	4117763	474.85	212.00	0.71%	0.61%	0.98	0.000				56.2%	87.8%	95.2%	281.7M	43.5%	98.0%	76595.2Mb	591.8M	57.0%	98.6%	50.3%
tih_rna_sample_00714_B23MVV7LT4_1_1																																				152.7bp	98.0%	289.9M												87.4%	55%	151bp	151bp	18%	441.1M
tih_rna_sample_00714_B23MVV7LT4_1_2																																																		86.3%	56%	151bp	151bp	18%	441.1M
tih_rna_sample_00714_B23MVV7LT4_1_trimmed_1																																																		84.5%	56%	132bp	147bp	9%	295.9M	84.5%	56%	132bp	147bp	9%	295.9M
tih_rna_sample_00714_B23MVV7LT4_1_trimmed_2																																																		84.7%	57%	132bp	151bp	9%	295.9M	84.7%	57%	132bp	151bp	9%	295.9M
tih_rna_sample_00721_B23MVV7LT4_1	577166496	0.9320	9999000000	494280541	161.8bp	146.0bp	0.02%	0.73%	0.28%	0.00%	0.04%	2.31%	0.44%	0.00%	0.02	No	0.00%	592658100	0.00%	0.43%	336785142	0.94%	0.97%	0.05%	0.03%	318247574	161215446	15729736	4625580	658.29	302.00	0.76%	0.65%	0.98	0.000				43.4%	91.6%	96.5%	285.8M	32.9%	98.0%	78138.0Mb	592.7M	53.7%	98.8%	45.1%
tih_rna_sample_00721_B23MVV7LT4_1_1																																				161.8bp	98.1%	290.8M												87.4%	52%	151bp	151bp	18%	468.5M
tih_rna_sample_00721_B23MVV7LT4_1_2																																																		86.2%	53%	151bp	151bp	18%	468.5M
tih_rna_sample_00721_B23MVV7LT4_1_trimmed_1																																																		84.6%	53%	134bp	151bp	9%	296.3M	84.6%	53%	134bp	151bp	9%	296.3M
tih_rna_sample_00721_B23MVV7LT4_1_trimmed_2																																																		84.4%	54%	135bp	151bp	9%	296.3M	84.4%	54%	135bp	151bp	9%	296.3M
tih_rna_sample_00722_B23MVV7LT4_1	228570852	0.9203	9999000000	48498494	115.4bp	111.0bp	0.01%	1.17%	0.38%	0.00%	0.03%	3.55%	0.60%	0.00%	0.04	No	0.00%	238378480	0.01%	0.77%	54734200	0.87%	0.91%	0.09%	0.09%	47671483	23887765	5109979	2257337	66.44	26.00	0.48%	0.20%	0.98	0.000				77.7%	85.9%	94.6%	112.8M	48.8%	98.1%	26610.6Mb	238.4M	55.4%	98.6%	81.7%
tih_rna_sample_00722_B23MVV7LT4_1_1																																				115.4bp	97.8%	116.6M												85.0%	53%	151bp	151bp	18%	120.8M
tih_rna_sample_00722_B23MVV7LT4_1_2																																																		84.0%	54%	151bp	151bp	27%	120.8M
tih_rna_sample_00722_B23MVV7LT4_1_trimmed_1																																																		85.0%	55%	114bp	112bp	9%	119.2M	85.0%	55%	114bp	112bp	9%	119.2M
tih_rna_sample_00722_B23MVV7LT4_1_trimmed_2																																																		85.0%	55%	114bp	112bp	9%	119.2M	85.0%	55%	114bp	112bp	9%	119.2M
tih_rna_sample_00723_B23MVV7LT4_1	86882138	0.8971	9999000000	17616990	118.5bp	112.0bp	0.01%	0.70%	0.29%	0.00%	0.01%	2.00%	0.43%	0.00%	0.00	No	0.00%	91190176	0.01%	0.79%	19566183	0.86%	0.91%	0.10%	0.09%	16765683	8394398	1947029	828237	24.14	7.00	0.20%	0.05%	0.98	0.000				79.3%	79.7%	93.5%	42.6M	51.4%	97.9%	10318.8Mb	91.2M	54.3%	98.5%	78.4%
tih_rna_sample_00723_B23MVV7LT4_1_1																																				118.5bp	97.6%	44.5M												83.8%	53%	151bp	151bp	18%	46.3M
tih_rna_sample_00723_B23MVV7LT4_1_2																																																		82.5%	54%	151bp	151bp	36%	46.3M
tih_rna_sample_00723_B23MVV7LT4_1_trimmed_1																																																		83.8%	53%	115bp	117bp	9%	45.6M	83.8%	53%	115bp	117bp	9%	45.6M
tih_rna_sample_00723_B23MVV7LT4_1_trimmed_2																																																		83.4%	54%	116bp	117bp	18%	45.6M	83.4%	54%	116bp	117bp	18%	45.6M
tih_rna_sample_00725_B23MVV7LT4_1	568218826	0.9366	9999000000	186019366	147.4bp	133.0bp	0.01%	1.05%	0.44%	0.00%	0.03%	3.24%	0.67%	0.00%	5.99	No	0.00%	591980486	0.01%	0.62%	223987719	0.93%	0.96%	0.05%	0.04%	208577313	105303585	11683781	3837293	393.13	164.00	0.72%	0.59%	0.98	0.000				62.6%	87.9%	94.9%	280.9M	44.3%	97.8%	74702.0Mb	592.0M	57.7%	98.7%	54.8%
tih_rna_sample_00725_B23MVV7LT4_1_1																																				147.4bp	97.4%	288.4M												88.6%	56%	151bp	151bp	18%	391.7M
tih_rna_sample_00725_B23MVV7LT4_1_2																																																		87.2%	57%	151bp	151bp	18%	391.7M
tih_rna_sample_00725_B23MVV7LT4_1_trimmed_1																																																		86.8%	57%	129bp	142bp	9%	296.0M	86.8%	57%	129bp	142bp	9%	296.0M
tih_rna_sample_00725_B23MVV7LT4_1_trimmed_2																																																		86.6%	57%	129bp	142bp	9%	296.0M	86.6%	57%	129bp	142bp	9%	296.0M
tih_rna_sample_00729_B23MVV7LT4_1	573127180	0.9428	9999000000	208799472	142.2bp	130.0bp	0.01%	0.80%	0.37%	0.00%	0.02%	2.58%	0.59%	0.00%	5.29	No	0.00%	593126156	0.01%	0.60%	235914883	0.94%	0.97%	0.05%	0.03%	220941689	111548486	11696626	3854576	410.61	198.00	0.75%	0.62%	0.98	0.000				60.6%	89.2%	95.8%	284.1M	43.3%	98.1%	74668.9Mb	593.1M	55.8%	98.9%	56.8%
tih_rna_sample_00729_B23MVV7LT4_1_1																																				142.2bp	98.4%	291.8M												87.7%	54%	151bp	151bp	18%	355.1M
tih_rna_sample_00729_B23MVV7LT4_1_2																																																		85.9%	55%	151bp	151bp	18%	355.1M
tih_rna_sample_00729_B23MVV7LT4_1_trimmed_1																																																		86.5%	55%	128bp	142bp	9%	296.6M	86.5%	55%	128bp	142bp	9%	296.6M
tih_rna_sample_00729_B23MVV7LT4_1_trimmed_2																																																		85.6%	56%	128bp	142bp	9%	296.6M	85.6%	56%	128bp	142bp	9%	296.6M
tih_rna_sample_00730_B23MVV7LT4_1	568775907	0.9633	9999000000	288248772	156.1bp	143.0bp	0.01%	0.49%	0.37%	0.00%	0.01%	1.57%	0.61%	0.00%	4.32	No	0.00%	591730076	0.01%	0.52%	281146492	0.94%	0.97%	0.05%	0.03%	263554103	133433656	14340047	4395738	523.65	186.00	0.72%	0.59%	0.98	0.000				52.8%	88.0%	95.2%	281.7M	40.7%	97.9%	77523.2Mb	591.7M	58.6%	98.6%	47.6%
tih_rna_sample_00730_B23MVV7LT4_1_1																																				156.1bp	98.0%	290.0M												88.6%	57%	151bp	151bp	18%	443.1M
tih_rna_sample_00730_B23MVV7LT4_1_2																																																		87.4%	58%	151bp	151bp	18%	443.1M
tih_rna_sample_00730_B23MVV7LT4_1_trimmed_1																																																		86.1%	58%	134bp	151bp	9%	295.9M	86.1%	58%	134bp	151bp	9%	295.9M
tih_rna_sample_00730_B23MVV7LT4_1_trimmed_2																																																		86.1%	58%	134bp	151bp	9%	295.9M	86.1%	58%	134bp	151bp	9%	295.9M
tih_rna_sample_00731_B23MVV7LT4_1	568770076	0.9586	9990000000	306174420	149.8bp	138.0bp	0.02%	1.52%	0.59%	0.00%	0.04%	4.58%	0.88%	0.00%	0.00	No	0.00%	591698260	0.01%	0.51%	292078245	0.94%	0.97%	0.05%	0.03%	274977066	138800410	13807944	4468911	538.30	232.00	0.71%	0.61%	0.98	0.000				50.9%	88.1%	95.3%	282.1M	37.2%	98.0%	76148.9Mb	591.7M	55.5%	98.6%	52.4%
tih_rna_sample_00731_B23MVV7LT4_1_1																																				149.8bp	98.3%	290.8M												86.4%	54%	151bp	151bp	18%	347.4M
tih_rna_sample_00731_B23MVV7LT4_1_2																																																		85.4%	55%	151bp	151bp	18%	347.4M
tih_rna_sample_00731_B23MVV7LT4_1_trimmed_1																																																		85.3%	55%	131bp	147bp	9%	295.8M	85.3%	55%	131bp	147bp	9%	295.8M
tih_rna_sample_00731_B23MVV7LT4_1_trimmed_2																																																		85.5%	55%	131bp	147bp	9%	295.8M	85.5%	55%	131bp	147bp	9%	295.8M
tih_rna_sample_00736_B23MVV7LT4_1	558749203	0.9591	9999000000	213911149	142.3bp	131.0bp	0.02%	1.30%	0.48%	0.00%	0.03%	3.93%	0.74%	0.00%	5.04	Yes	0.00%	592000334	0.01%	0.59%	244410989	0.93%	0.96%	0.05%	0.04%	227263496	114613715	12918548	4533099	417.55	194.00	0.73%	0.61%	0.98	0.000				59.1%	84.0%	93.5%	276.9M	41.5%	98.0%	74392.3Mb	592.0M	56.4%	98.7%	58.9%
tih_rna_sample_00736_B23MVV7LT4_1_1																																				142.3bp	98.1%	290.3M												85.3%	55%	151bp	151bp	18%	341.6M
tih_rna_sample_00736_B23MVV7LT4_1_2																																																		84.3%	56%	151bp	151bp	18%	341.6M
tih_rna_sample_00736_B23MVV7LT4_1_trimmed_1																																																		84.3%	56%	128bp	137bp	9%	296.0M	84.3%	56%	128bp	137bp	9%	296.0M
tih_rna_sample_00736_B23MVV7LT4_1_trimmed_2																																																		84.4%	56%	128bp	137bp	9%	296.0M	84.4%	56%	128bp	137bp	9%	296.0M
tih_rna_sample_00737_B23MVV7LT4_1	536335614	0.9131	9999000000	284480369	137.2bp	128.0bp	0.01%	0.64%	0.39%	0.00%	0.03%	1.93%	0.59%	0.00%	0.01	No	0.00%	557117258	0.01%	0.52%	266278239	0.93%	0.96%	0.05%	0.04%	248896041	125511294	14041239	5053389	446.85	226.00	0.75%	0.63%	0.98	0.000				52.5%	87.9%	95.3%	265.5M	35.0%	98.1%	68750.5Mb	557.1M	54.7%	98.7%	62.2%
tih_rna_sample_00737_B23MVV7LT4_1_1																																				137.2bp	98.0%	272.9M												81.5%	53%	151bp	151bp	18%	282.1M
tih_rna_sample_00737_B23MVV7LT4_1_2																																																		80.5%	54%	151bp	151bp	18%	282.1M
tih_rna_sample_00737_B23MVV7LT4_1_trimmed_1																																																		81.6%	54%	126bp	132bp	9%	278.6M	81.6%	54%	126bp	132bp	9%	278.6M
tih_rna_sample_00737_B23MVV7LT4_1_trimmed_2																																																		81.5%	55%	126bp	132bp	9%	278.6M	81.5%	55%	126bp	132bp	9%	278.6M
tih_rna_sample_00739_B23MVV7LT4_1	566038669	0.9622	9999000000	425068572	159.7bp	144.0bp	0.02%	0.96%	0.56%	0.00%	0.04%	3.00%	0.85%	0.00%	4.36	Yes	0.00%	591865578	0.01%	0.46%	318661678	0.94%	0.97%	0.04%	0.03%	300906151	152224823	14103429	4035645	616.41	254.00	0.74%	0.63%	0.98	0.000				46.4%	87.0%	94.8%	280.4M	34.4%	97.8%	77179.6Mb	591.9M	57.8%	98.6%	47.0%
tih_rna_sample_00739_B23MVV7LT4_1_1																																				159.7bp	98.3%	290.8M												88.8%	56%	151bp	151bp	18%	540.6M
tih_rna_sample_00739_B23MVV7LT4_1_2																																																		87.5%	57%	151bp	151bp	18%	540.6M
tih_rna_sample_00739_B23MVV7LT4_1_trimmed_1																																																		85.3%	57%	133bp	151bp	9%	295.9M	85.3%	57%	133bp	151bp	9%	295.9M
tih_rna_sample_00739_B23MVV7LT4_1_trimmed_2																																																		85.3%	58%	133bp	151bp	9%	295.9M	85.3%	58%	133bp	151bp	9%	295.9M
tih_rna_sample_00740_B23MVV7LT4_1	569884901	0.9493	9999000000	233440787	148.2bp	134.0bp	0.01%	1.58%	0.52%	0.00%	0.01%	4.52%	0.80%	0.00%	5.83	Yes	12.45%	592370868	0.01%	0.57%	251951137	0.94%	0.97%	0.05%	0.03%	235872061	119419112	12568538	3825414	446.37	223.00	0.75%	0.63%	0.98	0.000				57.8%	88.1%	95.3%	282.2M	42.0%	98.0%	75300.5Mb	592.4M	54.9%	98.7%	54.7%
tih_rna_sample_00740_B23MVV7LT4_1_1																																				148.2bp	97.9%	290.0M												87.6%	53%	151bp	151bp	18%	371.6M
tih_rna_sample_00740_B23MVV7LT4_1_2																																																		85.7%	55%	151bp	151bp	18%	371.6M
tih_rna_sample_00740_B23MVV7LT4_1_trimmed_1																																																		86.2%	54%	130bp	142bp	9%	296.2M	86.2%	54%	130bp	142bp	9%	296.2M
tih_rna_sample_00740_B23MVV7LT4_1_trimmed_2																																																		85.3%	55%	130bp	142bp	9%	296.2M	85.3%	55%	130bp	142bp	9%	296.2M
tih_rna_sample_00742_B23MVV7LT4_1	325676098	0.9628	9999000000	259753688	150.6bp	136.0bp	0.01%	0.93%	0.38%	0.00%	0.02%	3.01%	0.57%	0.00%	0.02	No	0.00%	335795994	0.01%	0.43%	191182378	0.95%	0.97%	0.04%	0.03%	180955313	91390824	8498170	2634171	354.25	162.00	0.72%	0.58%	0.98	0.000				43.3%	90.4%	95.9%	161.0M	30.4%	98.0%	43004.6Mb	335.8M	55.5%	98.6%	51.6%
tih_rna_sample_00742_B23MVV7LT4_1_1																																				150.6bp	98.2%	164.9M												80.2%	54%	151bp	151bp	18%	170.3M
tih_rna_sample_00742_B23MVV7LT4_1_2																																																		79.3%	55%	151bp	151bp	18%	170.3M
tih_rna_sample_00742_B23MVV7LT4_1_trimmed_1																																																		80.2%	55%	131bp	147bp	9%	167.9M	80.2%	55%	131bp	147bp	9%	167.9M
tih_rna_sample_00742_B23MVV7LT4_1_trimmed_2																																																		80.3%	55%	131bp	147bp	9%	167.9M	80.3%	55%	131bp	147bp	9%	167.9M
tih_rna_sample_00754_B23MVV7LT4_1	420256721	0.9584	9999000000	266973151	143.4bp	132.0bp	0.01%	0.65%	0.38%	0.00%	0.02%	2.08%	0.60%	0.00%	0.01	No	0.00%	435953824	0.01%	0.47%	233121704	0.94%	0.97%	0.05%	0.03%	219007928	110511040	11206884	3795527	405.60	210.00	0.76%	0.63%	0.98	0.000				46.8%	88.4%	95.4%	208.0M	32.8%	98.0%	54764.0Mb	436.0M	55.6%	98.7%	57.7%
tih_rna_sample_00754_B23MVV7LT4_1_1																																				143.4bp	98.0%	213.5M												80.3%	54%	151bp	151bp	18%	220.9M
tih_rna_sample_00754_B23MVV7LT4_1_2																																																		79.4%	55%	151bp	151bp	18%	220.9M
tih_rna_sample_00754_B23MVV7LT4_1_trimmed_1																																																		80.3%	55%	128bp	137bp	9%	218.0M	80.3%	55%	128bp	137bp	9%	218.0M
tih_rna_sample_00754_B23MVV7LT4_1_trimmed_2																																																		80.5%	55%	128bp	137bp	9%	218.0M	80.5%	55%	128bp	137bp	9%	218.0M
tih_rna_sample_00755_B23MVV7LT4_1	572215469	0.9455	9999000000	447190601	155.9bp	141.0bp	0.01%	1.04%	0.61%	0.00%	0.01%	3.09%	0.91%	0.00%	3.51	No	0.00%	591838206	0.00%	0.46%	317343701	0.95%	0.98%	0.04%	0.02%	302169224	152638302	12459162	3503517	616.11	236.00	0.71%	0.61%	0.98	0.000				46.6%	89.5%	95.8%	283.5M	33.6%	98.0%	76652.2Mb	591.8M	54.6%	98.6%	49.6%
tih_rna_sample_00755_B23MVV7LT4_1_1																																				155.9bp	98.4%	291.2M												86.1%	53%	151bp	151bp	18%	392.7M
tih_rna_sample_00755_B23MVV7LT4_1_2																																																		85.2%	54%	151bp	151bp	18%	392.7M
tih_rna_sample_00755_B23MVV7LT4_1_trimmed_1																																																		84.5%	54%	132bp	151bp	9%	295.9M	84.5%	54%	132bp	151bp	9%	295.9M
tih_rna_sample_00755_B23MVV7LT4_1_trimmed_2																																																		84.6%	54%	132bp	151bp	9%	295.9M	84.6%	54%	132bp	151bp	9%	295.9M
tih_rna_sample_00758_B23MVV7LT4_1	572691613	0.9475	9999000000	314502931	152.7bp	139.0bp	0.01%	0.80%	0.35%	0.00%	0.01%	2.67%	0.57%	0.00%	0.00	No	0.00%	591845308	0.01%	0.51%	291898960	0.94%	0.97%	0.05%	0.03%	274516670	138643841	14182124	4603832	539.29	294.00	0.77%	0.66%	0.98	0.000				51.0%	89.8%	95.9%	283.8M	37.3%	98.0%	76463.7Mb	591.8M	54.8%	98.6%	51.3%
tih_rna_sample_00758_B23MVV7LT4_1_1																																				152.7bp	98.2%	290.7M												85.6%	53%	151bp	151bp	18%	354.9M
tih_rna_sample_00758_B23MVV7LT4_1_2																																																		84.1%	54%	151bp	151bp	18%	354.9M
tih_rna_sample_00758_B23MVV7LT4_1_trimmed_1																																																		84.3%	54%	132bp	147bp	9%	295.9M	84.3%	54%	132bp	147bp	9%	295.9M
tih_rna_sample_00758_B23MVV7LT4_1_trimmed_2																																																		83.9%	55%	132bp	147bp	9%	295.9M	83.9%	55%	132bp	147bp	9%	295.9M
tih_rna_sample_00760_B23MVV7LT4_1	465059111	0.9550	9999000000	222729745	130.4bp	120.0bp	0.01%	0.99%	0.48%	0.00%	0.03%	2.86%	0.69%	0.00%	0.01	No	0.00%	479579054	0.01%	0.53%	223455996	0.94%	0.97%	0.05%	0.03%	210682537	106083079	10296712	3599002	360.17	162.00	0.70%	0.58%	0.98	0.000				53.7%	89.8%	95.8%	229.7M	34.7%	98.1%	57268.4Mb	479.6M	54.0%	98.7%	68.4%
tih_rna_sample_00760_B23MVV7LT4_1_1																																				130.4bp	98.5%	236.2M												84.0%	52%	151bp	151bp	18%	243.0M
tih_rna_sample_00760_B23MVV7LT4_1_2																																																		82.6%	54%	151bp	151bp	18%	243.0M
tih_rna_sample_00760_B23MVV7LT4_1_trimmed_1																																																		84.0%	53%	122bp	127bp	9%	239.8M	84.0%	53%	122bp	127bp	9%	239.8M
tih_rna_sample_00760_B23MVV7LT4_1_trimmed_2																																																		83.6%	54%	122bp	127bp	9%	239.8M	83.6%	54%	122bp	127bp	9%	239.8M
tih_rna_sample_00761_B23MVV7LT4_1	142718447	0.9611	9999000000	25978662	120.3bp	113.0bp	0.01%	0.65%	0.29%	0.00%	0.01%	2.15%	0.51%	0.00%	0.48	Yes	10.14%	149169010	0.01%	0.82%	26394339	0.85%	0.90%	0.11%	0.10%	22333279	11194333	2826056	1220705	32.96	12.00	0.30%	0.07%	0.98	0.000				83.0%	84.4%	94.5%	70.5M	52.3%	97.8%	16994.2Mb	149.2M	57.4%	98.6%	76.1%
tih_rna_sample_00761_B23MVV7LT4_1_1																																				120.3bp	97.9%	73.0M												86.6%	56%	151bp	151bp	18%	75.7M
tih_rna_sample_00761_B23MVV7LT4_1_2																																																		85.3%	56%	151bp	151bp	27%	75.7M
tih_rna_sample_00761_B23MVV7LT4_1_trimmed_1																																																		86.7%	57%	116bp	117bp	9%	74.6M	86.7%	57%	116bp	117bp	9%	74.6M
tih_rna_sample_00761_B23MVV7LT4_1_trimmed_2																																																		86.3%	57%	117bp	117bp	9%	74.6M	86.3%	57%	117bp	117bp	9%	74.6M
tih_rna_sample_00762_B23MVV7LT4_1	561053972	0.9586	9999000000	400315103	165.3bp	150.0bp	0.02%	1.26%	0.55%	0.00%	0.04%	3.83%	0.80%	0.00%	5.74	No	0.00%	580056758	0.00%	0.46%	315824978	0.95%	0.97%	0.04%	0.03%	298979597	151343618	14027000	3962695	629.87	291.00	0.76%	0.65%	0.98	0.000				45.8%	89.8%	95.9%	278.3M	35.7%	98.0%	77436.9Mb	580.1M	55.5%	98.6%	42.3%
tih_rna_sample_00762_B23MVV7LT4_1_1																																				165.3bp	98.2%	284.8M												85.0%	54%	151bp	151bp	18%	294.0M
tih_rna_sample_00762_B23MVV7LT4_1_2																																																		84.1%	55%	151bp	151bp	18%	294.0M
tih_rna_sample_00762_B23MVV7LT4_1_trimmed_1																																																		85.1%	55%	136bp	151bp	9%	290.0M	85.1%	55%	136bp	151bp	9%	290.0M
tih_rna_sample_00762_B23MVV7LT4_1_trimmed_2																																																		85.3%	55%	136bp	151bp	9%	290.0M	85.3%	55%	136bp	151bp	9%	290.0M
tih_rna_sample_00763_B23MVV7LT4_1	559616863	0.9567	9999000000	289290444	131.4bp	121.0bp	0.02%	1.16%	0.49%	0.00%	0.04%	3.58%	0.77%	0.00%	0.04	No	0.00%	581134628	0.01%	0.53%	270968971	0.94%	0.97%	0.05%	0.03%	254651973	128198423	12805851	4613692	447.43	203.00	0.73%	0.61%	0.98	0.000				53.7%	88.0%	95.3%	276.9M	37.6%	98.1%	70105.5Mb	581.1M	53.1%	98.7%	65.9%
tih_rna_sample_00763_B23MVV7LT4_1_1																																				131.4bp	98.4%	285.9M												83.5%	52%	151bp	151bp	18%	294.4M
tih_rna_sample_00763_B23MVV7LT4_1_2																																																		82.3%	53%	151bp	151bp	18%	294.4M
tih_rna_sample_00763_B23MVV7LT4_1_trimmed_1																																																		83.5%	52%	123bp	127bp	9%	290.6M	83.5%	52%	123bp	127bp	9%	290.6M
tih_rna_sample_00763_B23MVV7LT4_1_trimmed_2																																																		83.5%	53%	123bp	127bp	9%	290.6M	83.5%	53%	123bp	127bp	9%	290.6M
tih_rna_sample_00764_B23MVV7LT4_1	475185051	0.9638	9999000000	227227758	136.6bp	127.0bp	0.01%	0.59%	0.50%	0.00%	0.02%	1.97%	0.73%	0.00%	0.01	No	0.00%	490263154	0.01%	0.54%	225808432	0.94%	0.96%	0.05%	0.04%	211616832	106505363	11532260	4285868	373.95	162.00	0.70%	0.58%	0.98	0.000				54.2%	89.7%	95.8%	234.9M	35.6%	98.1%	60169.2Mb	490.3M	54.4%	98.7%	63.5%
tih_rna_sample_00764_B23MVV7LT4_1_1																																				136.6bp	98.1%	240.5M												81.6%	53%	151bp	151bp	18%	248.3M
tih_rna_sample_00764_B23MVV7LT4_1_2																																																		80.6%	54%	151bp	151bp	18%	248.3M
tih_rna_sample_00764_B23MVV7LT4_1_trimmed_1																																																		81.7%	54%	125bp	132bp	9%	245.1M	81.7%	54%	125bp	132bp	9%	245.1M
tih_rna_sample_00764_B23MVV7LT4_1_trimmed_2																																																		81.6%	54%	125bp	132bp	9%	245.1M	81.6%	54%	125bp	132bp	9%	245.1M
tih_rna_sample_00766_B23MVV7LT4_1	388718624	0.9421	9999000000	112863832	124.1bp	117.0bp	0.00%	0.78%	0.32%	0.00%	0.01%	2.48%	0.51%	0.00%	6.13	No	0.00%	405849612	0.01%	0.66%	139504775	0.91%	0.94%	0.07%	0.06%	126401141	63441911	10051546	4235839	196.38	101.00	0.68%	0.50%	0.98	0.000				66.1%	86.3%	94.8%	192.3M	47.4%	98.1%	47466.5Mb	405.8M	55.4%	98.5%	73.6%
tih_rna_sample_00766_B23MVV7LT4_1_1																																				124.1bp	97.6%	198.1M												81.4%	54%	151bp	151bp	18%	206.1M
tih_rna_sample_00766_B23MVV7LT4_1_2																																																		80.3%	54%	151bp	151bp	18%	206.1M
tih_rna_sample_00766_B23MVV7LT4_1_trimmed_1																																																		81.4%	55%	119bp	122bp	9%	202.9M	81.4%	55%	119bp	122bp	9%	202.9M
tih_rna_sample_00766_B23MVV7LT4_1_trimmed_2																																																		81.5%	55%	119bp	122bp	9%	202.9M	81.5%	55%	119bp	122bp	9%	202.9M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: RSeQC	Unique Reads	Reads with mapq >= mapq_cut (uniquely mapped)	`unique_reads_rseqc`	None
\|\|	Custom content: RSeQC	Frac Antisense	Fraction of reads explained by antisense orientation (1+-,1-+,2++,2--)	`frac_antisense`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: Expression QC	ChrY Signature Score	Mean log2(TPM+1) score for chrY signature genes; used for sex verification.	`score_log2tpm1_mean_chry_signature`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_01_RNA_13_B23MVV7LT4_1	628.7M	0.0M	0.0M	34.2M	2.6M	575.7M	288.0M	287.7M	287.9M	287.8M	260.7M	315.1M	574.0M	0.0M
FFPE_V4_0002_RNA_0001_B23MVV7LT4_1	426.5M	0.0M	0.0M	26.3M	2.2M	386.1M	193.1M	192.9M	193.1M	193.0M	187.5M	198.6M	384.9M	0.0M
tih_rna_sample_00569_B23MVV7LT4_1	637.5M	0.0M	0.0M	42.2M	3.4M	573.2M	286.7M	286.5M	286.6M	286.5M	299.3M	273.9M	571.0M	0.0M
tih_rna_sample_00570_B23MVV7LT4_1	631.2M	0.0M	0.0M	36.6M	3.3M	575.9M	288.1M	287.7M	288.1M	287.8M	284.8M	291.1M	573.3M	0.0M
tih_rna_sample_00572_B23MVV7LT4_1	480.4M	0.0M	0.0M	33.7M	3.2M	429.5M	214.9M	214.6M	214.8M	214.7M	240.0M	189.4M	428.0M	0.0M
tih_rna_sample_00574_B23MVV7LT4_1	632.0M	0.0M	0.0M	36.7M	3.2M	576.2M	288.2M	287.9M	288.2M	288.0M	291.8M	284.3M	573.9M	0.0M
tih_rna_sample_00575_B23MVV7LT4_1	174.2M	0.0M	0.0M	19.8M	1.2M	146.3M	73.2M	73.1M	73.2M	73.1M	87.9M	58.4M	145.5M	0.0M
tih_rna_sample_00576_B23MVV7LT4_1	410.3M	0.0M	0.0M	30.3M	2.5M	364.8M	182.5M	182.2M	182.4M	182.4M	204.6M	160.2M	363.6M	0.0M
tih_rna_sample_00581_B23MVV7LT4_1	656.1M	0.0M	0.0M	62.2M	4.4M	566.6M	283.5M	283.1M	283.3M	283.2M	322.3M	244.2M	564.5M	0.0M
tih_rna_sample_00582_B23MVV7LT4_1	637.9M	0.0M	0.0M	43.1M	3.3M	574.3M	287.2M	287.0M	287.2M	287.1M	315.9M	258.4M	571.9M	0.0M
tih_rna_sample_00583_B23MVV7LT4_1	503.9M	0.0M	0.0M	45.9M	2.9M	438.5M	219.3M	219.2M	219.3M	219.2M	252.6M	185.9M	436.6M	0.0M
tih_rna_sample_00584_B23MVV7LT4_1	80.3M	0.0M	0.0M	9.6M	0.7M	67.0M	33.5M	33.5M	33.5M	33.5M	44.4M	22.6M	66.7M	0.0M
tih_rna_sample_00586_B23MVV7LT4_1	404.9M	0.0M	0.0M	38.6M	3.6M	344.7M	172.4M	172.3M	172.4M	172.3M	176.0M	168.7M	343.6M	0.0M
tih_rna_sample_00588_B23MVV7LT4_1	638.4M	0.0M	0.0M	45.5M	3.6M	570.6M	285.5M	285.1M	285.4M	285.2M	305.3M	265.3M	568.7M	0.0M
tih_rna_sample_00591_B23MVV7LT4_1	642.4M	0.0M	0.0M	47.0M	3.0M	573.1M	286.7M	286.4M	286.6M	286.5M	307.5M	265.7M	570.6M	0.0M
tih_rna_sample_00592_B23MVV7LT4_1	535.4M	0.0M	0.0M	35.5M	2.8M	480.2M	240.2M	240.0M	240.1M	240.0M	238.4M	241.8M	478.6M	0.0M
tih_rna_sample_00594_B23MVV7LT4_1	666.7M	0.0M	0.0M	72.5M	3.7M	556.9M	278.5M	278.3M	278.5M	278.4M	282.1M	274.8M	555.1M	0.0M
tih_rna_sample_00596_B23MVV7LT4_1	644.5M	0.0M	0.0M	50.5M	3.9M	567.3M	283.8M	283.5M	283.7M	283.6M	301.0M	266.2M	565.3M	0.0M
tih_rna_sample_00598_B23MVV7LT4_1	403.7M	0.0M	0.0M	46.2M	3.5M	338.1M	169.2M	168.9M	169.1M	169.0M	217.2M	121.0M	336.9M	0.0M
tih_rna_sample_00599_B23MVV7LT4_1	618.5M	0.0M	0.0M	57.7M	3.7M	534.8M	267.6M	267.2M	267.5M	267.3M	314.3M	220.5M	532.7M	0.0M
tih_rna_sample_00602_B23MVV7LT4_1	635.3M	0.0M	0.0M	41.6M	3.5M	570.1M	285.2M	284.9M	285.1M	285.0M	279.0M	291.1M	568.1M	0.0M
tih_rna_sample_00604_B23MVV7LT4_1	631.2M	0.0M	0.0M	36.5M	3.3M	575.1M	287.7M	287.4M	287.6M	287.5M	280.3M	294.7M	573.3M	0.0M
tih_rna_sample_00612_B23MVV7LT4_1	639.9M	0.0M	0.0M	47.4M	3.0M	569.0M	284.7M	284.4M	284.6M	284.5M	293.7M	275.3M	567.2M	0.0M
tih_rna_sample_00613_B23MVV7LT4_1	642.7M	0.0M	0.0M	48.5M	3.6M	565.9M	283.1M	282.8M	283.0M	282.9M	276.8M	289.1M	564.1M	0.0M
tih_rna_sample_00614_B23MVV7LT4_1	545.6M	0.0M	0.0M	36.5M	3.3M	489.2M	244.8M	244.4M	244.7M	244.6M	270.9M	218.3M	487.4M	0.0M
tih_rna_sample_00616_B23MVV7LT4_1	626.6M	0.0M	0.0M	31.1M	2.6M	578.6M	289.5M	289.1M	289.4M	289.2M	293.9M	284.7M	576.3M	0.0M
tih_rna_sample_00618_B23MVV7LT4_1	632.8M	0.0M	0.0M	38.5M	3.0M	572.0M	286.1M	285.9M	286.1M	286.0M	288.9M	283.1M	570.2M	0.0M
tih_rna_sample_00619_B23MVV7LT4_1	525.6M	0.0M	0.0M	39.8M	3.0M	467.7M	234.1M	233.7M	234.0M	233.8M	263.0M	204.7M	465.9M	0.0M
tih_rna_sample_00622_B23MVV7LT4_1	633.1M	0.0M	0.0M	39.5M	3.4M	572.5M	286.4M	286.1M	286.3M	286.1M	298.0M	274.5M	570.3M	0.0M
tih_rna_sample_00624_B23MVV7LT4_1	486.8M	0.0M	0.0M	39.6M	3.2M	426.5M	213.4M	213.1M	213.3M	213.2M	252.3M	174.2M	425.0M	0.0M
tih_rna_sample_00626_B23MVV7LT4_1	636.5M	0.0M	0.0M	41.2M	3.1M	574.4M	287.3M	287.1M	287.3M	287.1M	296.2M	278.2M	572.1M	0.0M
tih_rna_sample_00628_B23MVV7LT4_1	628.9M	0.0M	0.0M	35.3M	3.7M	573.7M	286.9M	286.7M	286.9M	286.7M	281.5M	292.2M	571.6M	0.0M
tih_rna_sample_00629_B23MVV7LT4_1	634.3M	0.0M	0.0M	40.5M	3.2M	573.1M	286.7M	286.4M	286.7M	286.4M	291.1M	282.0M	570.8M	0.0M
tih_rna_sample_00635_B23MVV7LT4_1	632.3M	0.0M	0.0M	39.1M	4.5M	570.8M	285.6M	285.3M	285.5M	285.3M	295.8M	275.0M	568.8M	0.0M
tih_rna_sample_00636_B23MVV7LT4_1	602.7M	0.0M	0.0M	44.0M	3.7M	536.5M	268.4M	268.1M	268.3M	268.2M	298.1M	238.4M	534.6M	0.0M
tih_rna_sample_00637_B23MVV7LT4_1	568.0M	0.0M	0.0M	44.3M	3.3M	501.8M	251.1M	250.7M	250.9M	250.9M	295.3M	206.4M	500.0M	0.0M
tih_rna_sample_00638_B23MVV7LT4_1	536.1M	0.0M	0.0M	49.0M	2.8M	462.8M	231.5M	231.2M	231.5M	231.3M	276.5M	186.2M	460.9M	0.0M
tih_rna_sample_00639_B23MVV7LT4_1	645.3M	0.0M	0.0M	50.6M	3.3M	569.5M	284.9M	284.6M	284.8M	284.7M	314.7M	254.9M	567.3M	0.0M
tih_rna_sample_00641_B23MVV7LT4_1	628.3M	0.0M	0.0M	34.1M	3.2M	574.5M	287.4M	287.1M	287.4M	287.2M	276.9M	297.6M	572.2M	0.0M
tih_rna_sample_00643_B23MVV7LT4_1	490.5M	0.0M	0.0M	55.6M	4.8M	410.0M	205.2M	204.8M	205.0M	204.9M	256.0M	153.9M	408.3M	0.0M
tih_rna_sample_00644_B23MVV7LT4_1	647.1M	0.0M	0.0M	52.4M	3.7M	570.2M	285.3M	284.9M	285.2M	285.1M	320.7M	249.5M	568.2M	0.0M
tih_rna_sample_00649_B23MVV7LT4_1	638.0M	0.0M	0.0M	42.9M	3.2M	574.1M	287.2M	286.9M	287.1M	286.9M	287.8M	286.2M	572.0M	0.0M
tih_rna_sample_00650_B23MVV7LT4_1	639.0M	0.0M	0.0M	44.3M	4.2M	570.1M	285.2M	284.9M	285.1M	285.0M	292.3M	277.8M	568.3M	0.0M
tih_rna_sample_00652_B23MVV7LT4_1	657.2M	0.0M	0.0M	63.4M	3.7M	557.1M	278.7M	278.4M	278.6M	278.5M	264.6M	292.4M	555.3M	0.0M
tih_rna_sample_00654_B23MVV7LT4_1	636.2M	0.0M	0.0M	41.2M	3.3M	574.9M	287.5M	287.4M	287.5M	287.4M	282.9M	292.0M	572.6M	0.0M
tih_rna_sample_00658_B23MVV7LT4_1	492.2M	0.0M	0.0M	31.0M	2.5M	446.0M	223.2M	222.8M	223.1M	222.9M	239.5M	206.4M	444.2M	0.0M
tih_rna_sample_00660_B23MVV7LT4_1	551.5M	0.0M	0.0M	43.4M	3.3M	488.3M	244.2M	244.1M	244.2M	244.1M	265.3M	223.0M	486.2M	0.0M
tih_rna_sample_00664_B23MVV7LT4_1	574.5M	0.0M	0.0M	39.2M	3.2M	516.8M	258.5M	258.3M	258.4M	258.4M	254.6M	262.2M	514.8M	0.0M
tih_rna_sample_00665_B23MVV7LT4_1	635.5M	0.0M	0.0M	40.8M	3.5M	573.5M	286.9M	286.6M	286.8M	286.7M	270.6M	302.9M	571.4M	0.0M
tih_rna_sample_00666_B23MVV7LT4_1	512.8M	0.0M	0.0M	53.5M	3.7M	436.9M	218.7M	218.2M	218.5M	218.4M	270.2M	166.7M	435.1M	0.0M
tih_rna_sample_00667_B23MVV7LT4_1	290.3M	0.0M	0.0M	27.2M	2.3M	250.9M	125.5M	125.4M	125.5M	125.4M	152.8M	98.1M	249.8M	0.0M
tih_rna_sample_00668_B23MVV7LT4_1	625.8M	0.0M	0.0M	29.6M	2.9M	580.6M	290.5M	290.1M	290.4M	290.2M	261.2M	319.4M	578.2M	0.0M
tih_rna_sample_00669_B23MVV7LT4_1	590.2M	0.0M	0.0M	42.3M	4.0M	527.1M	263.8M	263.3M	263.6M	263.5M	293.2M	233.9M	525.3M	0.0M
tih_rna_sample_00671_B23MVV7LT4_1	634.0M	0.0M	0.0M	39.2M	3.5M	573.3M	286.8M	286.5M	286.7M	286.6M	275.5M	297.8M	571.4M	0.0M
tih_rna_sample_00673_B23MVV7LT4_1	631.5M	0.0M	0.0M	36.0M	3.4M	576.6M	288.5M	288.1M	288.4M	288.2M	284.7M	291.9M	574.2M	0.0M
tih_rna_sample_00676_B23MVV7LT4_1	633.4M	0.0M	0.0M	40.2M	3.0M	572.5M	286.4M	286.1M	286.3M	286.2M	293.2M	279.3M	570.4M	0.0M
tih_rna_sample_00677_B23MVV7LT4_1	49.9M	0.0M	0.0M	8.9M	0.9M	36.6M	18.3M	18.3M	18.3M	18.3M	26.9M	9.7M	36.4M	0.0M
tih_rna_sample_00678_B23MVV7LT4_1	345.8M	0.0M	0.0M	34.6M	2.5M	296.2M	148.2M	147.9M	148.1M	148.0M	178.0M	118.2M	294.9M	0.0M
tih_rna_sample_00679_B23MVV7LT4_1	118.7M	0.0M	0.0M	14.7M	1.0M	98.1M	49.1M	49.0M	49.1M	49.0M	66.3M	31.8M	97.6M	0.0M
tih_rna_sample_00680_B23MVV7LT4_1	633.0M	0.0M	0.0M	38.5M	3.5M	574.2M	287.3M	286.9M	287.1M	287.0M	301.1M	273.1M	572.2M	0.0M
tih_rna_sample_00681_B23MVV7LT4_1	634.3M	0.0M	0.0M	39.1M	3.6M	574.7M	287.5M	287.2M	287.4M	287.3M	296.9M	277.9M	572.6M	0.0M
tih_rna_sample_00685_B23MVV7LT4_1	294.7M	0.0M	0.0M	20.6M	1.7M	263.9M	132.1M	131.9M	132.0M	131.9M	147.0M	116.9M	262.9M	0.0M
tih_rna_sample_00686_B23MVV7LT4_1	636.1M	0.0M	0.0M	42.8M	3.1M	570.9M	285.6M	285.3M	285.5M	285.4M	261.3M	309.6M	568.9M	0.0M
tih_rna_sample_00690_B23MVV7LT4_1	455.9M	0.0M	0.0M	34.1M	2.7M	405.0M	202.7M	202.4M	202.6M	202.5M	228.6M	176.4M	403.3M	0.0M
tih_rna_sample_00691_B23MVV7LT4_1	530.4M	0.0M	0.0M	35.9M	2.9M	476.2M	238.2M	238.0M	238.1M	238.0M	249.3M	226.9M	474.5M	0.0M
tih_rna_sample_00692_B23MVV7LT4_1	532.7M	0.0M	0.0M	48.7M	4.2M	460.3M	230.4M	230.0M	230.2M	230.1M	270.5M	189.9M	458.7M	0.0M
tih_rna_sample_00693_B23MVV7LT4_1	629.8M	0.0M	0.0M	34.8M	4.0M	575.0M	287.7M	287.4M	287.6M	287.5M	288.6M	286.4M	572.9M	0.0M
tih_rna_sample_00694_B23MVV7LT4_1	550.0M	0.0M	0.0M	51.5M	3.8M	471.8M	236.1M	235.7M	236.0M	235.9M	258.9M	213.0M	470.3M	0.0M
tih_rna_sample_00699_B23MVV7LT4_1	631.2M	0.0M	0.0M	36.1M	3.0M	575.8M	288.0M	287.8M	288.0M	287.8M	279.1M	296.7M	573.9M	0.0M
tih_rna_sample_00701_B23MVV7LT4_1	656.1M	0.0M	0.0M	61.3M	3.2M	561.5M	280.9M	280.6M	280.8M	280.7M	271.8M	289.8M	559.7M	0.0M
tih_rna_sample_00703_B23MVV7LT4_1	321.5M	0.0M	0.0M	27.3M	2.0M	282.1M	141.2M	140.9M	141.1M	141.0M	169.5M	112.6M	281.0M	0.0M
tih_rna_sample_00704_B23MVV7LT4_1	633.1M	0.0M	0.0M	38.6M	3.1M	573.6M	287.0M	286.7M	286.9M	286.8M	285.1M	288.6M	571.8M	0.0M
tih_rna_sample_00709_B23MVV7LT4_1	545.7M	0.0M	0.0M	47.2M	3.6M	479.1M	239.6M	239.5M	239.7M	239.4M	233.4M	245.7M	476.5M	0.0M
tih_rna_sample_00711_B23MVV7LT4_1	648.1M	0.0M	0.0M	54.3M	3.3M	563.2M	281.7M	281.4M	281.6M	281.5M	268.5M	294.7M	561.2M	0.0M
tih_rna_sample_00714_B23MVV7LT4_1	645.3M	0.0M	0.0M	51.2M	3.8M	568.5M	284.4M	284.1M	284.3M	284.2M	301.8M	266.7M	566.6M	0.0M
tih_rna_sample_00721_B23MVV7LT4_1	627.5M	0.0M	0.0M	32.7M	2.8M	577.2M	288.7M	288.4M	288.6M	288.5M	281.2M	296.0M	575.1M	0.0M
tih_rna_sample_00722_B23MVV7LT4_1	264.7M	0.0M	0.0M	25.0M	2.0M	228.6M	114.4M	114.1M	114.3M	114.3M	142.6M	86.0M	227.5M	0.0M
tih_rna_sample_00723_B23MVV7LT4_1	108.2M	0.0M	0.0M	16.1M	0.9M	86.9M	43.4M	43.5M	43.4M	43.4M	51.1M	35.8M	86.3M	0.0M
tih_rna_sample_00725_B23MVV7LT4_1	643.6M	0.0M	0.0M	48.8M	3.7M	568.2M	284.2M	284.0M	284.2M	284.1M	304.4M	263.8M	565.9M	0.0M
tih_rna_sample_00729_B23MVV7LT4_1	640.3M	0.0M	0.0M	44.9M	3.3M	573.1M	286.7M	286.5M	286.6M	286.5M	301.4M	271.7M	571.3M	0.0M
tih_rna_sample_00730_B23MVV7LT4_1	644.2M	0.0M	0.0M	50.2M	3.3M	568.8M	284.6M	284.2M	284.4M	284.3M	309.9M	258.9M	566.8M	0.0M
tih_rna_sample_00731_B23MVV7LT4_1	644.0M	0.0M	0.0M	50.3M	3.3M	568.8M	284.6M	284.2M	284.4M	284.3M	286.7M	282.0M	567.0M	0.0M
tih_rna_sample_00736_B23MVV7LT4_1	662.9M	0.0M	0.0M	68.7M	4.2M	558.7M	279.6M	279.2M	279.4M	279.3M	301.9M	256.8M	557.0M	0.0M
tih_rna_sample_00737_B23MVV7LT4_1	607.7M	0.0M	0.0M	48.2M	3.3M	536.3M	268.4M	268.0M	268.2M	268.1M	297.8M	238.5M	534.4M	0.0M
tih_rna_sample_00739_B23MVV7LT4_1	648.6M	0.0M	0.0M	54.5M	3.7M	566.0M	283.2M	282.9M	283.1M	283.0M	280.3M	285.7M	564.1M	0.0M
tih_rna_sample_00740_B23MVV7LT4_1	644.5M	0.0M	0.0M	49.7M	3.5M	569.9M	285.0M	284.9M	285.0M	284.9M	290.2M	279.7M	567.9M	0.0M
tih_rna_sample_00742_B23MVV7LT4_1	358.9M	0.0M	0.0M	21.7M	1.7M	325.7M	162.9M	162.8M	162.9M	162.8M	178.0M	147.7M	324.4M	0.0M
tih_rna_sample_00754_B23MVV7LT4_1	473.7M	0.0M	0.0M	36.0M	2.9M	420.3M	210.3M	210.0M	210.2M	210.1M	229.9M	190.3M	418.8M	0.0M
tih_rna_sample_00755_B23MVV7LT4_1	637.5M	0.0M	0.0M	43.5M	2.7M	572.2M	286.3M	286.0M	286.2M	286.0M	281.2M	291.0M	570.3M	0.0M
tih_rna_sample_00758_B23MVV7LT4_1	635.8M	0.0M	0.0M	41.9M	3.2M	572.7M	286.5M	286.2M	286.4M	286.3M	296.0M	276.6M	570.8M	0.0M
tih_rna_sample_00760_B23MVV7LT4_1	515.9M	0.0M	0.0M	33.9M	2.5M	465.1M	232.6M	232.4M	232.6M	232.5M	245.4M	219.7M	463.1M	0.0M
tih_rna_sample_00761_B23MVV7LT4_1	168.4M	0.0M	0.0M	18.4M	1.2M	142.7M	71.4M	71.3M	71.4M	71.3M	86.6M	56.1M	142.1M	0.0M
tih_rna_sample_00762_B23MVV7LT4_1	622.9M	0.0M	0.0M	41.0M	2.8M	561.1M	280.7M	280.4M	280.6M	280.5M	269.4M	291.7M	559.3M	0.0M
tih_rna_sample_00763_B23MVV7LT4_1	633.7M	0.0M	0.0M	50.1M	3.5M	559.6M	280.0M	279.6M	279.9M	279.7M	296.1M	263.5M	557.6M	0.0M
tih_rna_sample_00764_B23MVV7LT4_1	527.7M	0.0M	0.0M	35.2M	2.7M	475.2M	237.8M	237.4M	237.6M	237.5M	272.4M	202.8M	473.2M	0.0M
tih_rna_sample_00766_B23MVV7LT4_1	448.5M	0.0M	0.0M	40.8M	3.1M	388.7M	194.6M	194.2M	194.4M	194.3M	250.1M	138.6M	387.3M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ¹¹/₁₁ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	344385015	0.3172%
GGGAGATGCTGGTCCTGCTGGTCCTAAGGGTGAGCCTGGCAGCCCTGGTG	2	535443	0.0005%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGACACGTCATCTAGT	1	133060	0.0001%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTACTCTGCATCTAGT	1	169205	0.0002%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCTTCCAAGATCTGGG	1	208483	0.0002%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGCTTCCAAGATCTGGT	1	53110	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGAAGAATTATCTAGT	1	152661	0.0001%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCTGAGAGATCTGGG	1	152557	0.0001%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTGATCGCGATCTGGG	1	122298	0.0001%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACTACCAGATCTGGG	1	169470	0.0002%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGAGATGCATCTAGT	1	105494	0.0001%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

192 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²/₂ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	145888897	0.3014%
GGGAGATGCTGGTCCTGCTGGTCCTAAGGGTGAGCCTGGCAGCCCTGGTG	1	267646	0.0006%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
RSEQC_TO_MULTIQC	python	`3.11.14`
	rseqc_to_multiqc	`1.0.0`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.14`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0017/B23MVV7LT4/nfcore_rnafusion__73d51683--20260607-225254' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0017-73d51683 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0034_B23MVV7LT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0034_B23MVV7LT4/bclconvert_samplesheet_exp0017_8bpIndex_corrected.csv' --flowcell_id 20260428_LH00995_0034_B23MVV7LT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0017/B23MVV7LT4/nfcore_rnafusion__73d51683--20260607-225254'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0017-73d51683
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Skip steps

skip_picard_qc: true

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0017/B23MVV7LT4/nfcore_rnafusion__73d51683--20260607-225254
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0034_B23MVV7LT4/
flowcell_id: 20260428_LH00995_0034_B23MVV7LT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260428_LH00995_0034_B23MVV7LT4/bclconvert_samplesheet_exp0017_8bpIndex_corrected.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
arriba_gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir//ref_annot.gtf
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Mark Duplicates Help

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks