MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-16, 16:32 UTC based on data in: /tmp/nxf.tM5x6hmCtm

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	Total Reads	Expected Distinct	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	RNA contaminated	RNA contamination %	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_01_RNA_13_B23WHYVLT4_1	9999000000	423956076	171.7bp	155.0bp	0.02%	1.91%	0.86%	0.00%	0.04%	5.45%	1.20%	0.00%	Yes	62.13%	590655984	0.01%	0.46%	316235912	0.94%	0.97%	0.05%	0.03%	297354088	150620479	15663421	4490578	650.95	263.00	0.71%	0.61%	0.98	0.000				302bp	913bp	46.7%	0.0%	97.5%	90.6%	96.1%	283.9M	35.1%	97.6%	78880.9Mb	590.7M	53.6%	98.4%	40.2%
FFPE_HD789_01_RNA_13_B23WHYVLT4_1_1																																	171.7bp	98.0%	289.5M																88.0%	53%	151bp	151bp	18%	406.0M
FFPE_HD789_01_RNA_13_B23WHYVLT4_1_2																																																			86.4%	53%	151bp	151bp	18%	406.0M
FFPE_HD789_01_RNA_13_B23WHYVLT4_1_trimmed_1																																																			86.3%	53%	137bp	151bp	9%	295.3M	86.3%	53%	137bp	151bp	9%	295.3M
FFPE_HD789_01_RNA_13_B23WHYVLT4_1_trimmed_2																																																			85.8%	54%	137bp	151bp	9%	295.3M	85.8%	54%	137bp	151bp	9%	295.3M
FFPE_V4_0002_RNA_0001_B23WHYVLT4_1	9999000000	271777777	160.5bp	146.0bp	0.02%	2.13%	1.50%	0.00%	0.03%	5.73%	1.94%	0.00%	No	0.00%	590042116	0.01%	0.55%	265357706	0.93%	0.96%	0.06%	0.04%	246310663	124730544	15375749	4924714	509.38	121.00	0.59%	0.51%	0.98	0.000				242bp	693bp	55.4%	0.0%	97.0%	90.2%	95.8%	282.8M	40.4%	97.6%	77194.4Mb	590.0M	53.0%	98.3%	46.0%
FFPE_V4_0002_RNA_0001_B23WHYVLT4_1_1																																	160.5bp	97.2%	286.9M																90.2%	52%	151bp	151bp	18%	524.1M
FFPE_V4_0002_RNA_0001_B23WHYVLT4_1_2																																																			88.6%	53%	151bp	151bp	18%	524.1M
FFPE_V4_0002_RNA_0001_B23WHYVLT4_1_trimmed_1																																																			87.1%	52%	134bp	151bp	9%	295.0M	87.1%	52%	134bp	151bp	9%	295.0M
FFPE_V4_0002_RNA_0001_B23WHYVLT4_1_trimmed_2																																																			86.9%	53%	134bp	151bp	9%	295.0M	86.9%	53%	134bp	151bp	9%	295.0M
NTC_0001_0001_B23WHYVLT4_1	9999000000	65229	44.7bp	31.0bp	0.00%	0.00%	0.35%	0.00%	0.00%	0.00%	1.10%	0.00%	Skipped	N/A%	46656	0.64%	0.18%	38029	0.01%	0.04%	0.21%	0.96%	287	151	8099	3868	0.00	0.00	0.00%	0.00%	0.83	0.000				63bp	69bp	50.7%	0.0%	20.1%	3.0%	9.1%	0.0M	65.8%	84.3%	4.6Mb	0.0M	68.8%	2.4%	50.1%
NTC_0001_0001_B23WHYVLT4_1_1																																	44.7bp	12.4%	0.0M																98.7%	73%	151bp	151bp	45%	1.0M
NTC_0001_0001_B23WHYVLT4_1_2																																																			96.5%	98%	151bp	151bp	55%	1.0M
NTC_0001_0001_B23WHYVLT4_1_trimmed_1																																																			67.2%	64%	117bp	137bp	55%	0.0M	67.2%	64%	117bp	137bp	55%	0.0M
NTC_0001_0001_B23WHYVLT4_1_trimmed_2																																																			69.9%	73%	117bp	137bp	55%	0.0M	69.9%	73%	117bp	137bp	55%	0.0M
aih-tih-sc-0183f6-R1_B23WHYVLT4_1	9999000000	107359842	112.0bp	106.0bp	0.06%	1.24%	0.42%	0.00%	0.12%	3.67%	0.64%	0.00%	No	0.00%	430115382	0.01%	0.75%	106928388	0.85%	0.88%	0.12%	0.12%	90512287	45323319	13037860	5923359	128.04	55.00	0.60%	0.38%	0.98	0.000				109bp	149bp	75.7%	0.0%	96.1%	81.6%	92.9%	199.8M	44.2%	97.7%	46676.0Mb	430.1M	52.4%	98.2%	83.2%
aih-tih-sc-0183f6-R1_B23WHYVLT4_1_1																																	112.0bp	97.0%	208.7M																86.4%	51%	151bp	151bp	27%	218.9M
aih-tih-sc-0183f6-R1_B23WHYVLT4_1_2																																																			84.5%	52%	151bp	151bp	27%	218.9M
aih-tih-sc-0183f6-R1_B23WHYVLT4_1_trimmed_1																																																			86.4%	52%	111bp	112bp	9%	215.1M	86.4%	52%	111bp	112bp	9%	215.1M
aih-tih-sc-0183f6-R1_B23WHYVLT4_1_trimmed_2																																																			85.6%	52%	111bp	112bp	9%	215.1M	85.6%	52%	111bp	112bp	9%	215.1M
aih-tih-sc-027d27-R1_B23WHYVLT4_1	9999000000	214484444	131.8bp	123.0bp	0.02%	1.27%	0.45%	0.00%	0.04%	3.69%	0.67%	0.00%	Yes	0.70%	519268344	0.01%	0.57%	224470226	0.91%	0.94%	0.07%	0.06%	205268576	103259106	15539356	6229582	356.17	191.00	0.74%	0.61%	0.98	0.000				135bp	236bp	57.2%	0.0%	96.1%	87.1%	95.0%	246.5M	36.8%	97.7%	62384.2Mb	519.3M	54.0%	98.3%	66.4%
aih-tih-sc-027d27-R1_B23WHYVLT4_1_1																																	131.8bp	97.2%	252.4M																82.5%	52%	151bp	151bp	18%	264.1M
aih-tih-sc-027d27-R1_B23WHYVLT4_1_2																																																			80.5%	53%	151bp	151bp	18%	264.1M
aih-tih-sc-027d27-R1_B23WHYVLT4_1_trimmed_1																																																			82.5%	53%	123bp	127bp	9%	259.6M	82.5%	53%	123bp	127bp	9%	259.6M
aih-tih-sc-027d27-R1_B23WHYVLT4_1_trimmed_2																																																			81.7%	54%	123bp	127bp	9%	259.6M	81.7%	54%	123bp	127bp	9%	259.6M
aih-tih-sc-03bdd8-R1_B23WHYVLT4_1	9999000000	228835933	134.9bp	125.0bp	0.07%	1.01%	0.49%	0.00%	0.15%	3.14%	0.75%	0.00%	No	0.00%	589763366	0.01%	0.58%	246613742	0.92%	0.96%	0.06%	0.04%	227963235	114780766	14343919	5333308	412.84	207.00	0.74%	0.62%	0.98	0.000				151bp	297bp	58.6%	0.0%	96.8%	86.4%	94.6%	279.1M	38.9%	97.6%	72282.5Mb	589.8M	56.1%	98.3%	62.0%
aih-tih-sc-03bdd8-R1_B23WHYVLT4_1_1																																	134.9bp	97.7%	288.1M																89.3%	54%	151bp	151bp	18%	572.8M
aih-tih-sc-03bdd8-R1_B23WHYVLT4_1_2																																																			87.6%	56%	151bp	151bp	18%	572.8M
aih-tih-sc-03bdd8-R1_B23WHYVLT4_1_trimmed_1																																																			85.2%	55%	125bp	132bp	9%	294.9M	85.2%	55%	125bp	132bp	9%	294.9M
aih-tih-sc-03bdd8-R1_B23WHYVLT4_1_trimmed_2																																																			84.6%	56%	126bp	132bp	9%	294.9M	84.6%	56%	126bp	132bp	9%	294.9M
aih-tih-sc-070e1d-R1_B23WHYVLT4_1	9999000000	111938074	120.1bp	113.0bp	0.02%	1.55%	0.70%	0.00%	0.04%	4.13%	0.98%	0.00%	No	0.00%	552967876	0.01%	0.77%	128756605	0.87%	0.91%	0.10%	0.09%	112561551	56465167	12567389	5371563	174.08	73.00	0.62%	0.44%	0.98	0.000				124bp	216bp	77.2%	0.0%	96.8%	86.2%	94.7%	261.7M	48.4%	97.6%	63154.3Mb	553.0M	55.0%	98.1%	75.5%
aih-tih-sc-070e1d-R1_B23WHYVLT4_1_1																																	120.1bp	97.2%	268.8M																88.5%	53%	151bp	151bp	18%	282.0M
aih-tih-sc-070e1d-R1_B23WHYVLT4_1_2																																																			86.5%	55%	151bp	151bp	18%	282.0M
aih-tih-sc-070e1d-R1_B23WHYVLT4_1_trimmed_1																																																			88.5%	54%	117bp	117bp	9%	276.5M	88.5%	54%	117bp	117bp	9%	276.5M
aih-tih-sc-070e1d-R1_B23WHYVLT4_1_trimmed_2																																																			87.9%	55%	117bp	117bp	9%	276.5M	87.9%	55%	117bp	117bp	9%	276.5M
aih-tih-sc-099ac4-R1_B23WHYVLT4_1	9999000000	333236771	142.8bp	132.0bp	0.02%	0.48%	0.34%	0.00%	0.04%	1.55%	0.53%	0.00%	No	0.00%	590448472	0.01%	0.52%	285215106	0.93%	0.96%	0.06%	0.04%	264039955	133088935	16254210	5915171	503.26	205.00	0.73%	0.61%	0.98	0.000				156bp	325bp	52.1%	0.0%	97.0%	88.0%	95.2%	280.9M	35.2%	97.7%	74018.6Mb	590.4M	54.0%	98.4%	58.2%
aih-tih-sc-099ac4-R1_B23WHYVLT4_1_1																																	142.8bp	97.7%	288.5M																87.5%	53%	151bp	151bp	18%	457.9M
aih-tih-sc-099ac4-R1_B23WHYVLT4_1_2																																																			86.0%	54%	151bp	151bp	18%	457.9M
aih-tih-sc-099ac4-R1_B23WHYVLT4_1_trimmed_1																																																			84.8%	53%	128bp	137bp	9%	295.2M	84.8%	53%	128bp	137bp	9%	295.2M
aih-tih-sc-099ac4-R1_B23WHYVLT4_1_trimmed_2																																																			84.6%	54%	128bp	137bp	9%	295.2M	84.6%	54%	128bp	137bp	9%	295.2M
aih-tih-sc-0a6b7b-R1_B23WHYVLT4_1	9999000000	313236791	138.3bp	127.0bp	0.02%	1.21%	0.70%	0.00%	0.05%	3.86%	1.09%	0.00%	No	0.00%	590449702	0.01%	0.54%	274504239	0.94%	0.97%	0.05%	0.03%	257844233	129900611	13149765	4499877	481.42	236.00	0.75%	0.64%	0.98	0.000				160bp	365bp	53.8%	0.0%	97.4%	86.9%	94.7%	279.5M	35.3%	97.7%	72689.6Mb	590.4M	54.8%	98.4%	60.6%
aih-tih-sc-0a6b7b-R1_B23WHYVLT4_1_1																																	138.3bp	98.2%	290.0M																88.7%	54%	151bp	151bp	18%	508.5M
aih-tih-sc-0a6b7b-R1_B23WHYVLT4_1_2																																																			87.2%	54%	151bp	151bp	18%	508.5M
aih-tih-sc-0a6b7b-R1_B23WHYVLT4_1_trimmed_1																																																			85.4%	54%	126bp	132bp	9%	295.2M	85.4%	54%	126bp	132bp	9%	295.2M
aih-tih-sc-0a6b7b-R1_B23WHYVLT4_1_trimmed_2																																																			85.1%	55%	126bp	137bp	9%	295.2M	85.1%	55%	126bp	137bp	9%	295.2M
aih-tih-sc-0fc41c-R1_B23WHYVLT4_1	9999000000	208005915	131.4bp	122.0bp	0.04%	0.66%	0.41%	0.00%	0.07%	2.07%	0.62%	0.00%	No	0.00%	450486118	0.01%	0.55%	203913835	0.92%	0.95%	0.06%	0.05%	187956768	94555960	12036166	4588865	329.96	143.00	0.69%	0.56%	0.98	0.000				134bp	234bp	55.2%	0.0%	96.9%	85.4%	94.2%	212.2M	34.7%	97.5%	54012.7Mb	450.5M	55.2%	98.3%	66.7%
aih-tih-sc-0fc41c-R1_B23WHYVLT4_1_1																																	131.4bp	97.8%	220.3M																82.7%	54%	151bp	151bp	18%	229.1M
aih-tih-sc-0fc41c-R1_B23WHYVLT4_1_2																																																			80.8%	55%	151bp	151bp	18%	229.1M
aih-tih-sc-0fc41c-R1_B23WHYVLT4_1_trimmed_1																																																			82.8%	54%	123bp	127bp	9%	225.2M	82.8%	54%	123bp	127bp	9%	225.2M
aih-tih-sc-0fc41c-R1_B23WHYVLT4_1_trimmed_2																																																			82.0%	55%	123bp	127bp	9%	225.2M	82.0%	55%	123bp	127bp	9%	225.2M
aih-tih-sc-13a2f6-R1_B23WHYVLT4_1	9999000000	53001168	116.9bp	110.0bp	0.03%	1.11%	0.49%	0.00%	0.06%	3.62%	0.80%	0.00%	No	0.00%	208482094	0.01%	0.73%	56060102	0.87%	0.92%	0.09%	0.08%	48956887	24520386	5177100	2275786	73.14	29.00	0.50%	0.20%	0.98	0.000				118bp	180bp	73.8%	0.0%	96.8%	86.0%	94.5%	98.5M	44.5%	97.6%	23282.6Mb	208.5M	54.5%	98.2%	79.8%
aih-tih-sc-13a2f6-R1_B23WHYVLT4_1_1																																	116.9bp	97.5%	101.6M																83.0%	53%	151bp	151bp	18%	106.1M
aih-tih-sc-13a2f6-R1_B23WHYVLT4_1_2																																																			81.3%	54%	151bp	151bp	27%	106.1M
aih-tih-sc-13a2f6-R1_B23WHYVLT4_1_trimmed_1																																																			83.0%	54%	114bp	112bp	9%	104.2M	83.0%	54%	114bp	112bp	9%	104.2M
aih-tih-sc-13a2f6-R1_B23WHYVLT4_1_trimmed_2																																																			82.4%	54%	115bp	112bp	9%	104.2M	82.4%	54%	115bp	112bp	9%	104.2M
aih-tih-sc-16054b-R1_B23WHYVLT4_1	9999000000	310279826	143.1bp	130.0bp	0.02%	0.77%	0.42%	0.00%	0.06%	2.60%	0.70%	0.00%	No	0.00%	590914094	0.01%	0.54%	269212291	0.93%	0.96%	0.06%	0.04%	250031114	126196890	15254007	5387380	478.82	239.00	0.75%	0.64%	0.98	0.000				184bp	421bp	54.8%	0.0%	96.6%	89.7%	95.8%	283.0M	38.8%	97.7%	74308.1Mb	590.9M	54.5%	98.5%	56.2%
aih-tih-sc-16054b-R1_B23WHYVLT4_1_1																																	143.1bp	97.9%	289.2M																86.4%	53%	151bp	151bp	18%	372.7M
aih-tih-sc-16054b-R1_B23WHYVLT4_1_2																																																			85.0%	54%	151bp	151bp	18%	372.7M
aih-tih-sc-16054b-R1_B23WHYVLT4_1_trimmed_1																																																			84.9%	54%	129bp	142bp	9%	295.5M	84.9%	54%	129bp	142bp	9%	295.5M
aih-tih-sc-16054b-R1_B23WHYVLT4_1_trimmed_2																																																			84.6%	54%	129bp	142bp	9%	295.5M	84.6%	54%	129bp	142bp	9%	295.5M
aih-tih-sc-176637-R1_B23WHYVLT4_1	9999000000	304042290	148.5bp	134.0bp	0.05%	0.77%	0.45%	0.00%	0.12%	2.39%	0.69%	0.00%	No	0.00%	379318562	0.01%	0.44%	213288421	0.93%	0.96%	0.06%	0.04%	199023529	100452378	11752090	4012371	386.46	181.00	0.73%	0.60%	0.98	0.000				178bp	439bp	44.1%	0.0%	96.6%	89.2%	95.6%	181.3M	29.2%	97.7%	47853.8Mb	379.3M	53.0%	98.2%	54.4%
aih-tih-sc-176637-R1_B23WHYVLT4_1_1																																	148.5bp	97.7%	185.4M																82.5%	52%	151bp	151bp	18%	193.1M
aih-tih-sc-176637-R1_B23WHYVLT4_1_2																																																			80.4%	53%	151bp	151bp	18%	193.1M
aih-tih-sc-176637-R1_B23WHYVLT4_1_trimmed_1																																																			82.5%	52%	129bp	142bp	9%	189.7M	82.5%	52%	129bp	142bp	9%	189.7M
aih-tih-sc-176637-R1_B23WHYVLT4_1_trimmed_2																																																			81.8%	53%	129bp	142bp	9%	189.7M	81.8%	53%	129bp	142bp	9%	189.7M
aih-tih-sc-18a6f2-R1_B23WHYVLT4_1	9999000000	80518825	117.2bp	110.0bp	0.04%	0.98%	0.48%	0.00%	0.08%	3.19%	0.77%	0.00%	No	0.00%	386306214	0.01%	0.77%	89852236	0.88%	0.91%	0.10%	0.09%	78823469	39518664	8596300	3744484	119.65	50.00	0.59%	0.34%	0.98	0.000				124bp	214bp	77.2%	0.0%	96.8%	89.3%	95.8%	185.0M	50.6%	97.7%	43588.9Mb	386.3M	54.2%	98.4%	77.5%
aih-tih-sc-18a6f2-R1_B23WHYVLT4_1_1																																	117.2bp	97.7%	188.7M																86.8%	53%	151bp	151bp	18%	196.4M
aih-tih-sc-18a6f2-R1_B23WHYVLT4_1_2																																																			84.9%	53%	151bp	151bp	18%	196.4M
aih-tih-sc-18a6f2-R1_B23WHYVLT4_1_trimmed_1																																																			86.8%	53%	115bp	117bp	9%	193.2M	86.8%	53%	115bp	117bp	9%	193.2M
aih-tih-sc-18a6f2-R1_B23WHYVLT4_1_trimmed_2																																																			86.1%	54%	116bp	117bp	9%	193.2M	86.1%	54%	116bp	117bp	9%	193.2M
aih-tih-sc-1ba302-R1_B23WHYVLT4_1	9999000000	299506939	148.8bp	136.0bp	0.03%	1.26%	0.59%	0.00%	0.07%	4.21%	0.94%	0.00%	No	0.00%	591679186	0.01%	0.55%	266281538	0.93%	0.96%	0.06%	0.04%	246855808	124694460	15721354	5550221	484.99	234.00	0.73%	0.63%	0.98	0.000				192bp	466bp	55.3%	0.0%	96.7%	89.0%	95.6%	282.9M	39.8%	97.7%	75499.2Mb	591.7M	54.0%	98.6%	53.1%
aih-tih-sc-1ba302-R1_B23WHYVLT4_1_1																																	148.8bp	97.9%	289.6M																88.4%	53%	151bp	151bp	18%	415.2M
aih-tih-sc-1ba302-R1_B23WHYVLT4_1_2																																																			86.9%	54%	151bp	151bp	18%	415.2M
aih-tih-sc-1ba302-R1_B23WHYVLT4_1_trimmed_1																																																			86.4%	53%	131bp	147bp	9%	295.8M	86.4%	53%	131bp	147bp	9%	295.8M
aih-tih-sc-1ba302-R1_B23WHYVLT4_1_trimmed_2																																																			85.9%	54%	131bp	147bp	9%	295.8M	85.9%	54%	131bp	147bp	9%	295.8M
aih-tih-sc-1d89ab-R1_B23WHYVLT4_1	9999000000	202543121	131.4bp	122.0bp	0.02%	0.79%	0.46%	0.00%	0.05%	2.55%	0.70%	0.00%	No	0.00%	590170600	0.01%	0.63%	217841862	0.91%	0.95%	0.07%	0.05%	198869921	100042751	14877668	5805687	346.03	170.00	0.71%	0.59%	0.98	0.000				140bp	267bp	63.5%	0.0%	96.7%	88.3%	95.3%	281.2M	40.7%	97.5%	70724.9Mb	590.2M	54.2%	98.4%	66.6%
aih-tih-sc-1d89ab-R1_B23WHYVLT4_1_1																																	131.4bp	97.4%	287.4M																85.8%	53%	151bp	151bp	18%	313.3M
aih-tih-sc-1d89ab-R1_B23WHYVLT4_1_2																																																			84.3%	54%	151bp	151bp	18%	313.3M
aih-tih-sc-1d89ab-R1_B23WHYVLT4_1_trimmed_1																																																			85.5%	53%	123bp	127bp	9%	295.1M	85.5%	53%	123bp	127bp	9%	295.1M
aih-tih-sc-1d89ab-R1_B23WHYVLT4_1_trimmed_2																																																			85.2%	54%	123bp	127bp	9%	295.1M	85.2%	54%	123bp	127bp	9%	295.1M
aih-tih-sc-1d9134-R1_B23WHYVLT4_1	9999000000	304950103	135.5bp	124.0bp	0.02%	0.90%	0.47%	0.00%	0.04%	3.06%	0.77%	0.00%	No	0.00%	475528158	0.01%	0.52%	226623401	0.93%	0.96%	0.05%	0.04%	211870193	106755817	12096514	4397953	392.70	178.00	0.72%	0.59%	0.98	0.000				173bp	435bp	52.6%	0.0%	97.1%	90.6%	96.1%	228.5M	35.7%	97.7%	58210.9Mb	475.5M	53.0%	98.6%	62.3%
aih-tih-sc-1d9134-R1_B23WHYVLT4_1_1																																	135.5bp	98.2%	233.5M																84.5%	52%	151bp	151bp	18%	241.1M
aih-tih-sc-1d9134-R1_B23WHYVLT4_1_2																																																			82.7%	53%	151bp	151bp	18%	241.1M
aih-tih-sc-1d9134-R1_B23WHYVLT4_1_trimmed_1																																																			84.5%	52%	125bp	132bp	9%	237.8M	84.5%	52%	125bp	132bp	9%	237.8M
aih-tih-sc-1d9134-R1_B23WHYVLT4_1_trimmed_2																																																			83.7%	53%	125bp	132bp	9%	237.8M	83.7%	53%	125bp	132bp	9%	237.8M
aih-tih-sc-20b7e4-R1_B23WHYVLT4_1	9999000000	54103425	112.6bp	107.0bp	0.01%	0.52%	0.33%	0.00%	0.03%	1.65%	0.51%	0.00%	No	0.00%	222156290	0.01%	0.77%	50813403	0.82%	0.87%	0.14%	0.13%	41868622	20953272	7040309	3244762	59.01	22.00	0.44%	0.16%	0.98	0.000				113bp	152bp	77.8%	0.0%	95.5%	85.0%	94.0%	104.4M	38.4%	97.6%	24262.0Mb	222.2M	54.2%	98.1%	82.1%
aih-tih-sc-20b7e4-R1_B23WHYVLT4_1_1																																	112.6bp	96.5%	107.2M																84.2%	53%	151bp	151bp	18%	113.3M
aih-tih-sc-20b7e4-R1_B23WHYVLT4_1_2																																																			82.2%	54%	151bp	151bp	27%	113.3M
aih-tih-sc-20b7e4-R1_B23WHYVLT4_1_trimmed_1																																																			84.2%	53%	112bp	112bp	9%	111.1M	84.2%	53%	112bp	112bp	9%	111.1M
aih-tih-sc-20b7e4-R1_B23WHYVLT4_1_trimmed_2																																																			83.2%	54%	112bp	112bp	9%	111.1M	83.2%	54%	112bp	112bp	9%	111.1M
aih-tih-sc-2a5468-R1_B23WHYVLT4_1	9999000000	303989155	143.9bp	130.0bp	0.04%	1.28%	0.56%	0.00%	0.09%	3.78%	0.85%	0.00%	No	0.00%	587385778	0.01%	0.53%	274866373	0.93%	0.96%	0.06%	0.04%	255226276	128632557	15633227	5426875	480.05	229.00	0.73%	0.62%	0.98	0.000				163bp	399bp	53.6%	0.0%	96.7%	88.3%	95.2%	279.7M	36.6%	97.6%	72857.3Mb	587.4M	52.6%	97.9%	58.0%
aih-tih-sc-2a5468-R1_B23WHYVLT4_1_1																																	143.9bp	97.8%	287.1M																89.3%	51%	151bp	151bp	27%	525.7M
aih-tih-sc-2a5468-R1_B23WHYVLT4_1_2																																																			86.7%	53%	151bp	151bp	18%	525.7M
aih-tih-sc-2a5468-R1_B23WHYVLT4_1_trimmed_1																																																			86.0%	52%	127bp	137bp	18%	293.7M	86.0%	52%	127bp	137bp	18%	293.7M
aih-tih-sc-2a5468-R1_B23WHYVLT4_1_trimmed_2																																																			85.0%	52%	127bp	137bp	9%	293.7M	85.0%	52%	127bp	137bp	9%	293.7M
aih-tih-sc-2f84cc-R1_B23WHYVLT4_1	9999000000	116702598	129.3bp	121.0bp	0.01%	1.15%	0.49%	0.00%	0.03%	3.54%	0.75%	0.00%	No	0.00%	244181042	0.01%	0.55%	110001331	0.90%	0.93%	0.08%	0.07%	98494208	49471085	9187781	3905296	163.78	62.00	0.60%	0.41%	0.98	0.000				128bp	187bp	55.5%	0.0%	95.5%	86.0%	94.5%	115.4M	34.7%	97.6%	29033.8Mb	244.2M	53.2%	98.1%	70.1%
aih-tih-sc-2f84cc-R1_B23WHYVLT4_1_1																																	129.3bp	96.5%	117.8M																77.0%	52%	151bp	151bp	18%	124.4M
aih-tih-sc-2f84cc-R1_B23WHYVLT4_1_2																																																			74.7%	53%	151bp	151bp	18%	124.4M
aih-tih-sc-2f84cc-R1_B23WHYVLT4_1_trimmed_1																																																			76.9%	52%	122bp	127bp	9%	122.1M	76.9%	52%	122bp	127bp	9%	122.1M
aih-tih-sc-2f84cc-R1_B23WHYVLT4_1_trimmed_2																																																			75.9%	53%	122bp	127bp	9%	122.1M	75.9%	53%	122bp	127bp	9%	122.1M
aih-tih-sc-3376ed-R1_B23WHYVLT4_1	9999000000	248787693	154.2bp	140.0bp	0.04%	0.78%	0.82%	0.00%	0.09%	2.38%	1.10%	0.00%	No	0.00%	589630066	0.01%	0.56%	256914008	0.94%	0.97%	0.05%	0.03%	240838975	121650600	12523816	3860904	486.55	185.00	0.68%	0.58%	0.98	0.000				210bp	585bp	56.8%	0.0%	97.7%	90.1%	95.8%	282.4M	42.0%	97.7%	76403.7Mb	589.6M	53.8%	98.3%	49.2%
aih-tih-sc-3376ed-R1_B23WHYVLT4_1_1																																	154.2bp	98.3%	289.9M																88.7%	52%	151bp	151bp	18%	393.6M
aih-tih-sc-3376ed-R1_B23WHYVLT4_1_2																																																			86.8%	54%	151bp	151bp	18%	393.6M
aih-tih-sc-3376ed-R1_B23WHYVLT4_1_trimmed_1																																																			87.0%	53%	133bp	151bp	9%	294.8M	87.0%	53%	133bp	151bp	9%	294.8M
aih-tih-sc-3376ed-R1_B23WHYVLT4_1_trimmed_2																																																			86.6%	54%	133bp	151bp	9%	294.8M	86.6%	54%	133bp	151bp	9%	294.8M
aih-tih-sc-37dd87-R1_B23WHYVLT4_1	9999000000	395116070	142.8bp	130.0bp	0.04%	1.01%	0.65%	0.00%	0.10%	3.10%	0.93%	0.00%	No	0.00%	591116382	0.01%	0.48%	308087606	0.94%	0.96%	0.05%	0.04%	288936482	145724807	15624666	5363597	552.71	266.00	0.73%	0.63%	0.98	0.000				163bp	412bp	48.2%	0.0%	97.3%	89.7%	95.8%	283.0M	32.5%	97.8%	73497.1Mb	591.1M	52.2%	98.5%	58.0%
aih-tih-sc-37dd87-R1_B23WHYVLT4_1_1																																	142.8bp	98.0%	289.7M																85.6%	51%	151bp	151bp	18%	312.9M
aih-tih-sc-37dd87-R1_B23WHYVLT4_1_2																																																			83.7%	52%	151bp	151bp	18%	312.9M
aih-tih-sc-37dd87-R1_B23WHYVLT4_1_trimmed_1																																																			85.3%	51%	127bp	137bp	9%	295.6M	85.3%	51%	127bp	137bp	9%	295.6M
aih-tih-sc-37dd87-R1_B23WHYVLT4_1_trimmed_2																																																			84.5%	52%	127bp	137bp	9%	295.6M	84.5%	52%	127bp	137bp	9%	295.6M
aih-tih-sc-3924cb-R1_B23WHYVLT4_1	9999000000	345430119	139.3bp	129.0bp	0.03%	0.72%	0.50%	0.00%	0.06%	2.24%	0.72%	0.00%	No	0.00%	590316526	0.01%	0.54%	274128881	0.93%	0.96%	0.05%	0.04%	255824821	128918154	14717917	5239775	476.67	223.00	0.73%	0.62%	0.98	0.000				162bp	378bp	53.9%	0.0%	97.0%	90.6%	96.0%	283.5M	35.3%	97.4%	72916.8Mb	590.3M	53.2%	98.4%	60.3%
aih-tih-sc-3924cb-R1_B23WHYVLT4_1_1																																	139.3bp	98.1%	289.4M																85.9%	52%	151bp	151bp	18%	314.0M
aih-tih-sc-3924cb-R1_B23WHYVLT4_1_2																																																			84.0%	53%	151bp	151bp	18%	314.0M
aih-tih-sc-3924cb-R1_B23WHYVLT4_1_trimmed_1																																																			85.6%	52%	127bp	137bp	9%	295.2M	85.6%	52%	127bp	137bp	9%	295.2M
aih-tih-sc-3924cb-R1_B23WHYVLT4_1_trimmed_2																																																			85.0%	53%	127bp	137bp	9%	295.2M	85.0%	53%	127bp	137bp	9%	295.2M
aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1	9999000000	178710650	131.8bp	122.0bp	0.03%	1.04%	0.39%	0.00%	0.06%	3.25%	0.60%	0.00%	No	0.00%	590208944	0.01%	0.67%	197685921	0.90%	0.94%	0.08%	0.06%	178352845	89728388	15190983	6163866	308.55	143.00	0.71%	0.56%	0.98	0.000				134bp	239bp	67.0%	0.0%	96.6%	88.7%	95.5%	281.9M	44.8%	97.7%	71030.7Mb	590.2M	52.8%	98.4%	66.3%
aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1_1																																	131.8bp	97.6%	288.0M																86.5%	51%	151bp	151bp	18%	313.9M
aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1_2																																																			84.5%	53%	151bp	151bp	18%	313.9M
aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1_trimmed_1																																																			86.2%	52%	123bp	127bp	18%	295.1M	86.2%	52%	123bp	127bp	18%	295.1M
aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1_trimmed_2																																																			85.4%	53%	123bp	127bp	9%	295.1M	85.4%	53%	123bp	127bp	9%	295.1M
aih-tih-sc-3e91d2-R1_B23WHYVLT4_1	9990000000	341573960	150.0bp	137.0bp	0.02%	1.26%	0.72%	0.00%	0.03%	3.69%	1.04%	0.00%	No	0.00%	590392290	0.01%	0.52%	284864720	0.93%	0.97%	0.05%	0.03%	265581411	134156403	14318224	4640785	523.65	242.00	0.75%	0.63%	0.98	0.000				190bp	510bp	52.2%	0.0%	97.1%	88.3%	94.9%	280.1M	34.9%	97.7%	75230.4Mb	590.4M	53.1%	98.4%	53.7%
aih-tih-sc-3e91d2-R1_B23WHYVLT4_1_1																																	150.0bp	96.2%	284.1M																86.1%	52%	151bp	151bp	18%	418.3M
aih-tih-sc-3e91d2-R1_B23WHYVLT4_1_2																																																			84.4%	53%	151bp	151bp	18%	418.3M
aih-tih-sc-3e91d2-R1_B23WHYVLT4_1_trimmed_1																																																			83.9%	52%	130bp	142bp	9%	295.2M	83.9%	52%	130bp	142bp	9%	295.2M
aih-tih-sc-3e91d2-R1_B23WHYVLT4_1_trimmed_2																																																			83.3%	53%	131bp	147bp	9%	295.2M	83.3%	53%	131bp	147bp	9%	295.2M
aih-tih-sc-445ab1-R1_B23WHYVLT4_1	9999000000	213606482	151.8bp	139.0bp	0.02%	0.82%	0.55%	0.00%	0.04%	2.68%	0.85%	0.00%	No	0.00%	589726296	0.01%	0.60%	236364162	0.92%	0.95%	0.06%	0.05%	217794366	109938591	14659980	5225733	429.04	209.00	0.75%	0.62%	0.98	0.000				187bp	435bp	60.3%	0.0%	96.9%	89.2%	95.8%	282.4M	44.2%	97.6%	76045.4Mb	589.7M	54.7%	98.3%	51.1%
aih-tih-sc-445ab1-R1_B23WHYVLT4_1_1																																	151.8bp	97.8%	288.4M																87.1%	54%	151bp	151bp	18%	337.0M
aih-tih-sc-445ab1-R1_B23WHYVLT4_1_2																																																			85.3%	54%	151bp	151bp	18%	337.0M
aih-tih-sc-445ab1-R1_B23WHYVLT4_1_trimmed_1																																																			86.3%	54%	132bp	147bp	9%	294.9M	86.3%	54%	132bp	147bp	9%	294.9M
aih-tih-sc-445ab1-R1_B23WHYVLT4_1_trimmed_2																																																			85.9%	55%	132bp	147bp	9%	294.9M	85.9%	55%	132bp	147bp	9%	294.9M
aih-tih-sc-446670-R1_B23WHYVLT4_1	9999000000	199406808	146.2bp	136.0bp	0.02%	0.74%	0.81%	0.00%	0.03%	2.30%	1.19%	0.00%	No	0.00%	444003016	0.01%	0.57%	192625188	0.93%	0.96%	0.05%	0.04%	178929614	90229182	10097532	3469481	343.67	127.00	0.68%	0.54%	0.98	0.000				164bp	343bp	57.1%	0.0%	97.2%	86.5%	94.3%	209.4M	38.6%	97.6%	56467.6Mb	444.0M	55.5%	98.3%	55.9%
aih-tih-sc-446670-R1_B23WHYVLT4_1_1																																	146.2bp	98.0%	217.7M																83.4%	54%	151bp	151bp	18%	225.8M
aih-tih-sc-446670-R1_B23WHYVLT4_1_2																																																			81.6%	55%	151bp	151bp	18%	225.8M
aih-tih-sc-446670-R1_B23WHYVLT4_1_trimmed_1																																																			83.4%	55%	130bp	142bp	9%	222.0M	83.4%	55%	130bp	142bp	9%	222.0M
aih-tih-sc-446670-R1_B23WHYVLT4_1_trimmed_2																																																			82.9%	55%	130bp	142bp	9%	222.0M	82.9%	55%	130bp	142bp	9%	222.0M
aih-tih-sc-4cd8a8-R1_B23WHYVLT4_1	9999000000	175696336	128.8bp	120.0bp	0.02%	1.10%	0.33%	0.00%	0.04%	3.46%	0.52%	0.00%	No	0.00%	410385306	0.01%	0.58%	171556849	0.90%	0.93%	0.08%	0.07%	155103938	77970169	13656498	5710849	262.73	130.00	0.71%	0.55%	0.98	0.000				130bp	203bp	58.6%	0.0%	96.0%	85.8%	94.2%	193.4M	38.2%	97.7%	49048.9Mb	410.4M	52.5%	98.4%	68.8%
aih-tih-sc-4cd8a8-R1_B23WHYVLT4_1_1																																	128.8bp	97.1%	199.3M																82.2%	51%	151bp	151bp	18%	208.6M
aih-tih-sc-4cd8a8-R1_B23WHYVLT4_1_2																																																			80.4%	52%	151bp	151bp	27%	208.6M
aih-tih-sc-4cd8a8-R1_B23WHYVLT4_1_trimmed_1																																																			82.2%	52%	122bp	127bp	9%	205.2M	82.2%	52%	122bp	127bp	9%	205.2M
aih-tih-sc-4cd8a8-R1_B23WHYVLT4_1_trimmed_2																																																			81.5%	52%	122bp	127bp	9%	205.2M	81.5%	52%	122bp	127bp	9%	205.2M
aih-tih-sc-4dcd88-R1_B23WHYVLT4_1	9999000000	319901932	148.1bp	134.0bp	0.02%	0.67%	0.45%	0.00%	0.05%	2.08%	0.67%	0.00%	No	0.00%	590720092	0.01%	0.52%	284175391	0.93%	0.96%	0.05%	0.04%	264884980	133851729	15534384	5136138	512.60	259.00	0.76%	0.65%	0.98	0.000				167bp	364bp	52.2%	0.0%	96.5%	89.5%	95.8%	282.8M	35.9%	97.5%	74566.7Mb	590.7M	54.9%	98.5%	54.8%
aih-tih-sc-4dcd88-R1_B23WHYVLT4_1_1																																	148.1bp	97.8%	288.8M																86.6%	53%	151bp	151bp	18%	380.0M
aih-tih-sc-4dcd88-R1_B23WHYVLT4_1_2																																																			84.9%	55%	151bp	151bp	18%	380.0M
aih-tih-sc-4dcd88-R1_B23WHYVLT4_1_trimmed_1																																																			85.0%	54%	129bp	142bp	9%	295.4M	85.0%	54%	129bp	142bp	9%	295.4M
aih-tih-sc-4dcd88-R1_B23WHYVLT4_1_trimmed_2																																																			84.4%	55%	130bp	142bp	9%	295.4M	84.4%	55%	130bp	142bp	9%	295.4M
aih-tih-sc-4f4d6e-R1_B23WHYVLT4_1	9999000000	223805739	138.3bp	126.0bp	0.02%	1.16%	0.47%	0.00%	0.05%	3.75%	0.75%	0.00%	No	0.00%	431480824	0.01%	0.55%	195074011	0.93%	0.96%	0.05%	0.04%	182193772	91998870	10629763	3718580	339.64	154.00	0.71%	0.57%	0.98	0.000				169bp	404bp	55.1%	0.0%	96.8%	91.4%	96.3%	207.7M	37.2%	97.7%	53300.2Mb	431.5M	52.8%	98.8%	60.1%
aih-tih-sc-4f4d6e-R1_B23WHYVLT4_1_1																																	138.3bp	98.0%	211.4M																84.7%	51%	151bp	151bp	27%	218.5M
aih-tih-sc-4f4d6e-R1_B23WHYVLT4_1_2																																																			82.5%	53%	151bp	151bp	18%	218.5M
aih-tih-sc-4f4d6e-R1_B23WHYVLT4_1_trimmed_1																																																			84.7%	52%	126bp	137bp	18%	215.7M	84.7%	52%	126bp	137bp	18%	215.7M
aih-tih-sc-4f4d6e-R1_B23WHYVLT4_1_trimmed_2																																																			83.5%	53%	127bp	137bp	9%	215.7M	83.5%	53%	127bp	137bp	9%	215.7M
aih-tih-sc-505123-R1_B23WHYVLT4_1	9999000000	145547661	117.0bp	111.0bp	0.01%	0.50%	0.30%	0.00%	0.03%	1.61%	0.44%	0.00%	No	0.00%	266818884	0.01%	0.57%	114481713	0.89%	0.91%	0.10%	0.09%	101567674	50925830	11071644	4951140	154.50	71.00	0.63%	0.43%	0.98	0.000				114bp	145bp	57.5%	0.0%	94.9%	86.3%	94.7%	126.4M	35.4%	97.7%	29936.2Mb	266.8M	52.7%	98.2%	78.5%
aih-tih-sc-505123-R1_B23WHYVLT4_1_1																																	117.0bp	96.3%	128.5M																77.5%	51%	151bp	151bp	18%	135.8M
aih-tih-sc-505123-R1_B23WHYVLT4_1_2																																																			75.3%	53%	151bp	151bp	18%	135.8M
aih-tih-sc-505123-R1_B23WHYVLT4_1_trimmed_1																																																			77.4%	52%	115bp	117bp	9%	133.4M	77.4%	52%	115bp	117bp	9%	133.4M
aih-tih-sc-505123-R1_B23WHYVLT4_1_trimmed_2																																																			76.5%	52%	115bp	117bp	9%	133.4M	76.5%	52%	115bp	117bp	9%	133.4M
aih-tih-sc-51d534-R1_B23WHYVLT4_1	9999000000	298010718	142.8bp	131.0bp	0.03%	1.31%	0.63%	0.00%	0.07%	3.93%	0.94%	0.00%	No	0.00%	543691198	0.01%	0.52%	263602966	0.94%	0.97%	0.05%	0.03%	247444769	124782302	13085851	4457311	470.58	218.00	0.73%	0.62%	0.98	0.000				163bp	381bp	51.8%	0.0%	97.2%	86.6%	94.5%	257.0M	35.5%	97.7%	68044.2Mb	543.7M	53.9%	98.4%	57.6%
aih-tih-sc-51d534-R1_B23WHYVLT4_1_1																																	142.8bp	98.1%	266.8M																84.9%	52%	151bp	151bp	18%	276.2M
aih-tih-sc-51d534-R1_B23WHYVLT4_1_2																																																			83.3%	53%	151bp	151bp	18%	276.2M
aih-tih-sc-51d534-R1_B23WHYVLT4_1_trimmed_1																																																			85.0%	53%	128bp	137bp	9%	271.8M	85.0%	53%	128bp	137bp	9%	271.8M
aih-tih-sc-51d534-R1_B23WHYVLT4_1_trimmed_2																																																			84.6%	54%	128bp	137bp	9%	271.8M	84.6%	54%	128bp	137bp	9%	271.8M
aih-tih-sc-51ee59-R1_B23WHYVLT4_1	9999000000	328157044	147.9bp	134.0bp	0.02%	1.12%	0.48%	0.00%	0.05%	3.56%	0.72%	0.00%	No	0.00%	590939540	0.01%	0.52%	284124190	0.93%	0.96%	0.05%	0.04%	265594611	134145678	15004818	5041501	520.34	263.00	0.77%	0.66%	0.98	0.000				181bp	486bp	52.2%	0.0%	97.1%	90.8%	96.2%	284.1M	36.6%	97.7%	75021.3Mb	590.9M	53.3%	98.5%	54.4%
aih-tih-sc-51ee59-R1_B23WHYVLT4_1_1																																	147.9bp	98.0%	289.7M																86.8%	52%	151bp	151bp	27%	383.0M
aih-tih-sc-51ee59-R1_B23WHYVLT4_1_2																																																			85.1%	53%	151bp	151bp	18%	383.0M
aih-tih-sc-51ee59-R1_B23WHYVLT4_1_trimmed_1																																																			85.2%	52%	130bp	142bp	18%	295.5M	85.2%	52%	130bp	142bp	18%	295.5M
aih-tih-sc-51ee59-R1_B23WHYVLT4_1_trimmed_2																																																			84.5%	53%	130bp	142bp	9%	295.5M	84.5%	53%	130bp	142bp	9%	295.5M
aih-tih-sc-522d83-R1_B23WHYVLT4_1	9999000000	294147460	145.9bp	133.0bp	0.03%	1.31%	0.68%	0.00%	0.07%	3.93%	1.00%	0.00%	No	0.00%	589022260	0.01%	0.53%	275704870	0.94%	0.96%	0.05%	0.04%	257923966	130003991	14052455	4719566	496.54	231.00	0.74%	0.63%	0.98	0.000				176bp	406bp	53.5%	0.0%	97.2%	88.3%	95.3%	280.6M	36.6%	97.6%	74260.3Mb	589.0M	55.8%	98.2%	55.4%
aih-tih-sc-522d83-R1_B23WHYVLT4_1_1																																	145.9bp	97.9%	288.4M																85.7%	54%	151bp	151bp	18%	320.5M
aih-tih-sc-522d83-R1_B23WHYVLT4_1_2																																																			83.9%	55%	151bp	151bp	18%	320.5M
aih-tih-sc-522d83-R1_B23WHYVLT4_1_trimmed_1																																																			85.3%	55%	129bp	142bp	9%	294.5M	85.3%	55%	129bp	142bp	9%	294.5M
aih-tih-sc-522d83-R1_B23WHYVLT4_1_trimmed_2																																																			84.8%	56%	129bp	142bp	9%	294.5M	84.8%	56%	129bp	142bp	9%	294.5M
aih-tih-sc-5c902f-R1_B23WHYVLT4_1	9999000000	75890679	122.0bp	115.0bp	0.01%	1.19%	0.41%	0.00%	0.03%	3.89%	0.73%	0.00%	No	0.00%	441721150	0.01%	0.81%	84705738	0.83%	0.89%	0.11%	0.11%	70380155	35233386	9586682	4209892	109.44	37.00	0.54%	0.29%	0.98	0.000				124bp	176bp	81.7%	0.0%	96.5%	80.5%	92.2%	203.7M	52.2%	97.4%	51154.7Mb	441.7M	58.8%	97.8%	73.7%
aih-tih-sc-5c902f-R1_B23WHYVLT4_1_1																																	122.0bp	97.1%	214.5M																88.4%	57%	151bp	151bp	27%	225.9M
aih-tih-sc-5c902f-R1_B23WHYVLT4_1_2																																																			86.3%	58%	151bp	151bp	27%	225.9M
aih-tih-sc-5c902f-R1_B23WHYVLT4_1_trimmed_1																																																			88.5%	58%	119bp	122bp	9%	220.9M	88.5%	58%	119bp	122bp	9%	220.9M
aih-tih-sc-5c902f-R1_B23WHYVLT4_1_trimmed_2																																																			87.7%	59%	119bp	122bp	9%	220.9M	87.7%	59%	119bp	122bp	9%	220.9M
aih-tih-sc-5ef3cb-R1_B23WHYVLT4_1	9999000000	101488235	139.6bp	129.0bp	0.01%	0.16%	0.31%	0.00%	0.02%	0.47%	0.48%	0.00%	No	0.00%	550414724	0.01%	0.79%	113222961	0.83%	0.89%	0.12%	0.11%	94025692	47395579	14111209	5928253	159.18	41.00	0.54%	0.36%	0.98	0.000				139bp	204bp	80.2%	0.0%	94.1%	86.3%	94.9%	261.3M	56.3%	97.4%	67747.8Mb	550.4M	57.4%	98.0%	60.6%
aih-tih-sc-5ef3cb-R1_B23WHYVLT4_1_1																																	139.6bp	96.2%	264.7M																89.2%	56%	151bp	151bp	18%	280.9M
aih-tih-sc-5ef3cb-R1_B23WHYVLT4_1_2																																																			87.0%	57%	151bp	151bp	18%	280.9M
aih-tih-sc-5ef3cb-R1_B23WHYVLT4_1_trimmed_1																																																			89.3%	57%	126bp	137bp	9%	275.2M	89.3%	57%	126bp	137bp	9%	275.2M
aih-tih-sc-5ef3cb-R1_B23WHYVLT4_1_trimmed_2																																																			88.4%	57%	126bp	137bp	9%	275.2M	88.4%	57%	126bp	137bp	9%	275.2M
aih-tih-sc-60f9b9-R1_B23WHYVLT4_1	9999000000	123069448	133.3bp	125.0bp	0.02%	1.71%	0.42%	0.00%	0.04%	5.21%	0.72%	0.00%	No	0.00%	255548270	0.01%	0.55%	114796136	0.92%	0.95%	0.06%	0.05%	105180579	52897084	7428176	2944628	181.95	78.00	0.64%	0.45%	0.98	0.000				137bp	240bp	55.6%	0.0%	96.7%	86.0%	94.4%	120.6M	36.4%	97.7%	30956.9Mb	255.5M	52.9%	98.3%	66.6%
aih-tih-sc-60f9b9-R1_B23WHYVLT4_1_1																																	133.3bp	97.7%	124.8M																80.0%	52%	151bp	151bp	27%	130.0M
aih-tih-sc-60f9b9-R1_B23WHYVLT4_1_2																																																			77.9%	53%	151bp	151bp	18%	130.0M
aih-tih-sc-60f9b9-R1_B23WHYVLT4_1_trimmed_1																																																			79.9%	52%	124bp	127bp	18%	127.8M	79.9%	52%	124bp	127bp	18%	127.8M
aih-tih-sc-60f9b9-R1_B23WHYVLT4_1_trimmed_2																																																			79.1%	53%	124bp	127bp	9%	127.8M	79.1%	53%	124bp	127bp	9%	127.8M
aih-tih-sc-6284ec-R1_B23WHYVLT4_1	9999000000	218257664	137.0bp	127.0bp	0.02%	1.03%	0.41%	0.00%	0.05%	3.21%	0.64%	0.00%	No	0.00%	551623362	0.01%	0.58%	232663742	0.92%	0.95%	0.06%	0.05%	214045999	107841387	14855426	5700567	388.60	197.00	0.75%	0.62%	0.98	0.000				152bp	324bp	58.2%	0.0%	96.5%	89.0%	95.5%	263.5M	38.9%	97.7%	68158.4Mb	551.6M	52.5%	98.5%	61.8%
aih-tih-sc-6284ec-R1_B23WHYVLT4_1_1																																	137.0bp	97.7%	269.4M																84.1%	52%	151bp	151bp	18%	280.1M
aih-tih-sc-6284ec-R1_B23WHYVLT4_1_2																																																			82.5%	52%	151bp	151bp	18%	280.1M
aih-tih-sc-6284ec-R1_B23WHYVLT4_1_trimmed_1																																																			84.0%	52%	126bp	132bp	9%	275.8M	84.0%	52%	126bp	132bp	9%	275.8M
aih-tih-sc-6284ec-R1_B23WHYVLT4_1_trimmed_2																																																			83.7%	52%	127bp	132bp	9%	275.8M	83.7%	52%	127bp	132bp	9%	275.8M
aih-tih-sc-62dadb-R1_B23WHYVLT4_1	9999000000	72151744	122.0bp	114.0bp	0.02%	0.76%	0.38%	0.00%	0.04%	2.38%	0.59%	0.00%	No	0.00%	179706190	0.01%	0.59%	74158399	0.89%	0.92%	0.09%	0.08%	66186973	33209646	6334511	2742223	104.63	50.00	0.60%	0.33%	0.98	0.000				120bp	170bp	59.3%	0.0%	95.6%	85.3%	94.3%	84.8M	36.4%	97.6%	20561.1Mb	179.7M	54.8%	98.1%	75.0%
aih-tih-sc-62dadb-R1_B23WHYVLT4_1_1																																	122.0bp	96.7%	86.9M																75.8%	53%	151bp	151bp	18%	91.6M
aih-tih-sc-62dadb-R1_B23WHYVLT4_1_2																																																			73.8%	54%	151bp	151bp	18%	91.6M
aih-tih-sc-62dadb-R1_B23WHYVLT4_1_trimmed_1																																																			75.7%	54%	117bp	117bp	9%	89.9M	75.7%	54%	117bp	117bp	9%	89.9M
aih-tih-sc-62dadb-R1_B23WHYVLT4_1_trimmed_2																																																			74.9%	55%	117bp	117bp	9%	89.9M	74.9%	55%	117bp	117bp	9%	89.9M
aih-tih-sc-63b0e7-R1_B23WHYVLT4_1	9999000000	324557435	141.4bp	129.0bp	0.02%	0.92%	0.47%	0.00%	0.05%	2.85%	0.69%	0.00%	No	0.00%	590242212	0.01%	0.51%	286608154	0.93%	0.96%	0.06%	0.04%	266484363	134492920	16044660	5626217	499.85	275.00	0.78%	0.67%	0.98	0.000				156bp	366bp	51.8%	0.0%	96.6%	89.7%	95.8%	282.6M	34.9%	97.7%	73131.9Mb	590.2M	53.0%	98.4%	58.9%
aih-tih-sc-63b0e7-R1_B23WHYVLT4_1_1																																	141.4bp	97.9%	288.8M																84.8%	52%	151bp	151bp	27%	321.4M
aih-tih-sc-63b0e7-R1_B23WHYVLT4_1_2																																																			83.1%	53%	151bp	151bp	18%	321.4M
aih-tih-sc-63b0e7-R1_B23WHYVLT4_1_trimmed_1																																																			84.4%	52%	127bp	137bp	18%	295.1M	84.4%	52%	127bp	137bp	18%	295.1M
aih-tih-sc-63b0e7-R1_B23WHYVLT4_1_trimmed_2																																																			83.8%	53%	127bp	137bp	9%	295.1M	83.8%	53%	127bp	137bp	9%	295.1M
aih-tih-sc-63c8b4-R1_B23WHYVLT4_1	9999000000	135002604	128.5bp	119.0bp	0.02%	0.88%	0.38%	0.00%	0.04%	2.94%	0.63%	0.00%	No	0.00%	582663054	0.01%	0.71%	166227393	0.90%	0.94%	0.07%	0.06%	150181050	75548576	11854140	4675284	260.94	117.00	0.69%	0.53%	0.98	0.000				154bp	321bp	72.0%	0.0%	97.1%	90.2%	96.0%	279.8M	45.9%	97.6%	69911.5Mb	582.7M	54.7%	98.3%	66.8%
aih-tih-sc-63c8b4-R1_B23WHYVLT4_1_1																																	128.5bp	97.9%	285.3M																86.6%	53%	151bp	151bp	27%	296.3M
aih-tih-sc-63c8b4-R1_B23WHYVLT4_1_2																																																			84.4%	54%	151bp	151bp	18%	296.3M
aih-tih-sc-63c8b4-R1_B23WHYVLT4_1_trimmed_1																																																			86.6%	54%	123bp	127bp	27%	291.3M	86.6%	54%	123bp	127bp	27%	291.3M
aih-tih-sc-63c8b4-R1_B23WHYVLT4_1_trimmed_2																																																			85.7%	54%	123bp	127bp	9%	291.3M	85.7%	54%	123bp	127bp	9%	291.3M
aih-tih-sc-6473fb-R1_B23WHYVLT4_1	9999000000	88516949	127.4bp	119.0bp	0.08%	0.94%	0.43%	0.00%	0.16%	2.96%	0.68%	0.00%	No	0.00%	468278130	0.01%	0.79%	98665758	0.88%	0.92%	0.09%	0.08%	86806437	43534479	8624370	3623644	139.23	58.00	0.61%	0.37%	0.98	0.000				128bp	199bp	79.5%	0.0%	96.8%	87.3%	94.9%	222.1M	53.4%	97.7%	55648.0Mb	468.3M	54.4%	98.2%	70.3%
aih-tih-sc-6473fb-R1_B23WHYVLT4_1_1																																	127.4bp	97.9%	229.1M																87.9%	53%	151bp	151bp	18%	238.4M
aih-tih-sc-6473fb-R1_B23WHYVLT4_1_2																																																			86.1%	54%	151bp	151bp	18%	238.4M
aih-tih-sc-6473fb-R1_B23WHYVLT4_1_trimmed_1																																																			88.0%	54%	122bp	127bp	9%	234.1M	88.0%	54%	122bp	127bp	9%	234.1M
aih-tih-sc-6473fb-R1_B23WHYVLT4_1_trimmed_2																																																			87.4%	54%	122bp	127bp	9%	234.1M	87.4%	54%	122bp	127bp	9%	234.1M
aih-tih-sc-6e7384-R1_B23WHYVLT4_1	9999000000	272749468	143.5bp	130.0bp	0.01%	0.94%	0.39%	0.00%	0.04%	3.21%	0.64%	0.00%	No	0.00%	590995196	0.01%	0.57%	252945335	0.93%	0.96%	0.05%	0.04%	236465951	119340035	13346066	4553191	456.98	220.00	0.75%	0.63%	0.98	0.000				188bp	477bp	57.5%	0.0%	97.3%	91.1%	96.2%	284.4M	39.4%	97.7%	73952.2Mb	591.0M	53.5%	98.5%	56.5%
aih-tih-sc-6e7384-R1_B23WHYVLT4_1_1																																	143.5bp	98.3%	290.5M																88.6%	52%	151bp	151bp	27%	424.3M
aih-tih-sc-6e7384-R1_B23WHYVLT4_1_2																																																			86.8%	53%	151bp	151bp	18%	424.3M
aih-tih-sc-6e7384-R1_B23WHYVLT4_1_trimmed_1																																																			86.5%	53%	128bp	142bp	18%	295.5M	86.5%	53%	128bp	142bp	18%	295.5M
aih-tih-sc-6e7384-R1_B23WHYVLT4_1_trimmed_2																																																			85.7%	53%	128bp	142bp	9%	295.5M	85.7%	53%	128bp	142bp	9%	295.5M
aih-tih-sc-72546a-R1_B23WHYVLT4_1	9999000000	198803310	135.2bp	125.0bp	0.01%	0.93%	0.51%	0.00%	0.03%	3.12%	0.84%	0.00%	No	0.00%	590555810	0.01%	0.63%	220845169	0.92%	0.95%	0.06%	0.05%	202386014	101853307	14303148	5574615	363.84	182.00	0.74%	0.61%	0.98	0.000				153bp	301bp	63.0%	0.0%	96.9%	89.6%	95.8%	282.8M	41.6%	97.6%	72102.7Mb	590.6M	55.4%	98.4%	63.2%
aih-tih-sc-72546a-R1_B23WHYVLT4_1_1																																	135.2bp	97.7%	288.4M																86.0%	54%	151bp	151bp	18%	346.3M
aih-tih-sc-72546a-R1_B23WHYVLT4_1_2																																																			84.4%	55%	151bp	151bp	18%	346.3M
aih-tih-sc-72546a-R1_B23WHYVLT4_1_trimmed_1																																																			85.0%	55%	125bp	132bp	9%	295.3M	85.0%	55%	125bp	132bp	9%	295.3M
aih-tih-sc-72546a-R1_B23WHYVLT4_1_trimmed_2																																																			84.4%	55%	125bp	132bp	9%	295.3M	84.4%	55%	125bp	132bp	9%	295.3M
aih-tih-sc-758b5a-R1_B23WHYVLT4_1	9999000000	385535446	147.1bp	135.0bp	0.04%	0.95%	0.51%	0.00%	0.08%	2.94%	0.76%	0.00%	Yes	0.00%	590313058	0.01%	0.48%	304419361	0.94%	0.96%	0.05%	0.04%	285141727	143822609	15460147	5257935	563.01	283.00	0.77%	0.66%	0.98	0.000				174bp	443bp	48.7%	0.0%	97.2%	88.2%	95.0%	280.5M	34.2%	97.7%	75271.0Mb	590.3M	53.3%	98.4%	54.1%
aih-tih-sc-758b5a-R1_B23WHYVLT4_1_1																																	147.1bp	98.1%	289.6M																87.0%	52%	151bp	151bp	18%	445.8M
aih-tih-sc-758b5a-R1_B23WHYVLT4_1_2																																																			85.3%	53%	151bp	151bp	18%	445.8M
aih-tih-sc-758b5a-R1_B23WHYVLT4_1_trimmed_1																																																			84.5%	52%	130bp	142bp	9%	295.2M	84.5%	52%	130bp	142bp	9%	295.2M
aih-tih-sc-758b5a-R1_B23WHYVLT4_1_trimmed_2																																																			84.0%	53%	131bp	142bp	9%	295.2M	84.0%	53%	131bp	142bp	9%	295.2M
aih-tih-sc-75c3a9-R1_B23WHYVLT4_1	9999000000	224205999	129.7bp	121.0bp	0.02%	0.92%	0.61%	0.00%	0.04%	2.92%	0.92%	0.00%	No	0.00%	590006546	0.01%	0.60%	233099006	0.92%	0.95%	0.06%	0.05%	215356222	108373025	14042897	5299504	380.98	185.00	0.73%	0.61%	0.98	0.000				152bp	308bp	60.9%	0.0%	96.9%	88.9%	95.5%	281.7M	40.0%	97.6%	71145.6Mb	590.0M	55.8%	98.3%	65.3%
aih-tih-sc-75c3a9-R1_B23WHYVLT4_1_1																																	129.7bp	98.0%	289.2M																89.0%	54%	151bp	151bp	18%	460.3M
aih-tih-sc-75c3a9-R1_B23WHYVLT4_1_2																																																			87.0%	55%	151bp	151bp	18%	460.3M
aih-tih-sc-75c3a9-R1_B23WHYVLT4_1_trimmed_1																																																			86.3%	55%	123bp	127bp	9%	295.0M	86.3%	55%	123bp	127bp	9%	295.0M
aih-tih-sc-75c3a9-R1_B23WHYVLT4_1_trimmed_2																																																			85.5%	56%	124bp	127bp	9%	295.0M	85.5%	56%	124bp	127bp	9%	295.0M
aih-tih-sc-762402-R1_B23WHYVLT4_1	9999000000	256938522	138.2bp	127.0bp	0.01%	0.77%	0.47%	0.00%	0.03%	2.78%	0.82%	0.00%	No	0.00%	423842384	0.01%	0.55%	192741975	0.94%	0.97%	0.05%	0.03%	180978375	91195232	9044508	3045529	345.58	145.00	0.70%	0.56%	0.98	0.000				210bp	500bp	54.9%	0.0%	97.6%	91.7%	96.4%	204.3M	35.1%	97.6%	52495.9Mb	423.8M	54.9%	98.4%	59.4%
aih-tih-sc-762402-R1_B23WHYVLT4_1_1																																	138.2bp	98.3%	208.4M																84.0%	53%	151bp	151bp	27%	215.3M
aih-tih-sc-762402-R1_B23WHYVLT4_1_2																																																			82.1%	55%	151bp	151bp	27%	215.3M
aih-tih-sc-762402-R1_B23WHYVLT4_1_trimmed_1																																																			84.0%	54%	127bp	137bp	18%	211.9M	84.0%	54%	127bp	137bp	18%	211.9M
aih-tih-sc-762402-R1_B23WHYVLT4_1_trimmed_2																																																			83.2%	55%	127bp	137bp	18%	211.9M	83.2%	55%	127bp	137bp	18%	211.9M
aih-tih-sc-76a805-R1_B23WHYVLT4_1	9999000000	288251509	149.4bp	137.0bp	0.02%	1.16%	0.48%	0.00%	0.05%	3.65%	0.77%	0.00%	No	0.00%	589291276	0.01%	0.53%	274610676	0.93%	0.96%	0.05%	0.04%	256005075	129163692	14282115	4781060	497.57	222.00	0.73%	0.62%	0.98	0.000				170bp	350bp	53.8%	0.0%	96.8%	84.5%	93.9%	276.7M	38.0%	97.6%	75302.9Mb	589.3M	56.7%	98.2%	53.0%
aih-tih-sc-76a805-R1_B23WHYVLT4_1_1																																	149.4bp	97.9%	288.5M																89.0%	55%	151bp	151bp	18%	517.0M
aih-tih-sc-76a805-R1_B23WHYVLT4_1_2																																																			87.3%	56%	151bp	151bp	18%	517.0M
aih-tih-sc-76a805-R1_B23WHYVLT4_1_trimmed_1																																																			85.5%	56%	131bp	147bp	9%	294.6M	85.5%	56%	131bp	147bp	9%	294.6M
aih-tih-sc-76a805-R1_B23WHYVLT4_1_trimmed_2																																																			85.2%	57%	131bp	147bp	9%	294.6M	85.2%	57%	131bp	147bp	9%	294.6M
aih-tih-sc-79f487-R1_B23WHYVLT4_1	9999000000	376449639	155.5bp	141.0bp	0.03%	1.43%	0.70%	0.00%	0.07%	4.32%	1.06%	0.00%	No	0.00%	547025474	0.01%	0.47%	287880533	0.94%	0.97%	0.05%	0.03%	270746709	136809694	13568423	4138678	556.93	240.00	0.72%	0.62%	0.98	0.000				198bp	498bp	47.7%	0.0%	97.4%	86.2%	94.2%	257.7M	32.9%	97.6%	70690.8Mb	547.0M	55.3%	98.4%	48.6%
aih-tih-sc-79f487-R1_B23WHYVLT4_1_1																																	155.5bp	98.1%	268.3M																84.2%	54%	151bp	151bp	18%	278.1M
aih-tih-sc-79f487-R1_B23WHYVLT4_1_2																																																			82.5%	55%	151bp	151bp	18%	278.1M
aih-tih-sc-79f487-R1_B23WHYVLT4_1_trimmed_1																																																			84.2%	54%	132bp	151bp	9%	273.5M	84.2%	54%	132bp	151bp	9%	273.5M
aih-tih-sc-79f487-R1_B23WHYVLT4_1_trimmed_2																																																			83.8%	55%	132bp	151bp	9%	273.5M	83.8%	55%	132bp	151bp	9%	273.5M
aih-tih-sc-7c610c-R1_B23WHYVLT4_1	9999000000	195969682	123.7bp	116.0bp	0.07%	1.67%	0.65%	0.00%	0.14%	4.73%	0.95%	0.00%	No	0.00%	589599870	0.01%	0.63%	218728232	0.92%	0.95%	0.06%	0.05%	200918305	100905050	13397441	5291419	333.01	154.00	0.70%	0.57%	0.98	0.000				125bp	212bp	63.4%	0.0%	97.5%	82.3%	92.9%	273.8M	38.5%	97.6%	68516.9Mb	589.6M	54.9%	98.3%	72.7%
aih-tih-sc-7c610c-R1_B23WHYVLT4_1_1																																	123.7bp	98.0%	288.8M																89.6%	53%	151bp	151bp	27%	569.8M
aih-tih-sc-7c610c-R1_B23WHYVLT4_1_2																																																			87.8%	54%	151bp	151bp	18%	569.8M
aih-tih-sc-7c610c-R1_B23WHYVLT4_1_trimmed_1																																																			85.3%	54%	119bp	122bp	18%	294.8M	85.3%	54%	119bp	122bp	18%	294.8M
aih-tih-sc-7c610c-R1_B23WHYVLT4_1_trimmed_2																																																			84.8%	55%	119bp	122bp	9%	294.8M	84.8%	55%	119bp	122bp	9%	294.8M
aih-tih-sc-7c6c07-R1_B23WHYVLT4_1	9999000000	323982405	140.2bp	128.0bp	0.01%	3.03%	0.83%	0.00%	0.02%	8.02%	1.14%	0.00%	No	0.00%	590303734	0.01%	0.53%	277685927	0.93%	0.96%	0.06%	0.04%	258882726	130422845	15374449	5490861	488.40	197.00	0.71%	0.59%	0.98	0.000				155bp	336bp	53.3%	0.0%	97.1%	87.7%	95.0%	280.3M	35.2%	97.6%	73475.9Mb	590.3M	54.2%	98.4%	59.1%
aih-tih-sc-7c6c07-R1_B23WHYVLT4_1_1																																	140.2bp	97.8%	288.5M																86.2%	53%	151bp	151bp	18%	368.7M
aih-tih-sc-7c6c07-R1_B23WHYVLT4_1_2																																																			84.4%	54%	151bp	151bp	18%	368.7M
aih-tih-sc-7c6c07-R1_B23WHYVLT4_1_trimmed_1																																																			84.9%	53%	127bp	137bp	9%	295.2M	84.9%	53%	127bp	137bp	9%	295.2M
aih-tih-sc-7c6c07-R1_B23WHYVLT4_1_trimmed_2																																																			84.2%	54%	128bp	137bp	9%	295.2M	84.2%	54%	128bp	137bp	9%	295.2M
aih-tih-sc-7c8bae-R1_B23WHYVLT4_1	9999000000	410335455	149.8bp	134.0bp	0.03%	1.61%	0.58%	0.00%	0.07%	4.68%	0.87%	0.00%	No	0.00%	589070766	0.00%	0.47%	313038085	0.94%	0.97%	0.05%	0.03%	294777783	148828472	15412639	4832564	588.26	237.00	0.71%	0.60%	0.98	0.000				205bp	615bp	47.1%	0.0%	97.4%	90.3%	96.0%	282.7M	32.5%	97.7%	74503.7Mb	589.1M	52.0%	98.2%	52.7%
aih-tih-sc-7c8bae-R1_B23WHYVLT4_1_1																																	149.8bp	98.2%	289.1M																86.3%	51%	151bp	151bp	18%	312.9M
aih-tih-sc-7c8bae-R1_B23WHYVLT4_1_2																																																			84.5%	52%	151bp	151bp	18%	312.9M
aih-tih-sc-7c8bae-R1_B23WHYVLT4_1_trimmed_1																																																			86.1%	51%	129bp	147bp	9%	294.5M	86.1%	51%	129bp	147bp	9%	294.5M
aih-tih-sc-7c8bae-R1_B23WHYVLT4_1_trimmed_2																																																			85.5%	52%	130bp	147bp	9%	294.5M	85.5%	52%	130bp	147bp	9%	294.5M
aih-tih-sc-7d62c4-R1_B23WHYVLT4_1	9999000000	274606814	150.0bp	139.0bp	0.01%	0.80%	0.50%	0.00%	0.03%	2.48%	0.75%	0.00%	No	0.00%	590210632	0.01%	0.56%	259530743	0.93%	0.96%	0.06%	0.04%	241020003	121570928	14375673	4944468	463.08	243.00	0.77%	0.65%	0.98	0.000				178bp	410bp	56.4%	0.0%	96.8%	88.8%	95.5%	281.7M	40.9%	97.5%	75730.3Mb	590.2M	55.0%	98.4%	53.3%
aih-tih-sc-7d62c4-R1_B23WHYVLT4_1_1																																	150.0bp	97.9%	288.8M																87.0%	54%	151bp	151bp	18%	388.3M
aih-tih-sc-7d62c4-R1_B23WHYVLT4_1_2																																																			85.3%	54%	151bp	151bp	18%	388.3M
aih-tih-sc-7d62c4-R1_B23WHYVLT4_1_trimmed_1																																																			85.3%	54%	132bp	147bp	9%	295.1M	85.3%	54%	132bp	147bp	9%	295.1M
aih-tih-sc-7d62c4-R1_B23WHYVLT4_1_trimmed_2																																																			84.7%	55%	132bp	147bp	9%	295.1M	84.7%	55%	132bp	147bp	9%	295.1M
aih-tih-sc-7dd1d5-R1_B23WHYVLT4_1	9999000000	105962616	131.6bp	123.0bp	0.02%	0.72%	0.48%	0.00%	0.04%	2.18%	0.71%	0.00%	No	0.00%	419284868	0.01%	0.67%	136618586	0.91%	0.95%	0.07%	0.05%	124282259	62433690	8937448	3506772	211.95	88.00	0.68%	0.47%	0.98	0.000				138bp	239bp	68.0%	0.0%	97.2%	86.7%	94.7%	198.6M	45.5%	97.5%	50562.9Mb	419.3M	58.0%	98.1%	66.8%
aih-tih-sc-7dd1d5-R1_B23WHYVLT4_1_1																																	131.6bp	97.5%	204.4M																86.3%	56%	151bp	151bp	27%	213.8M
aih-tih-sc-7dd1d5-R1_B23WHYVLT4_1_2																																																			83.9%	57%	151bp	151bp	18%	213.8M
aih-tih-sc-7dd1d5-R1_B23WHYVLT4_1_trimmed_1																																																			86.3%	57%	124bp	127bp	18%	209.6M	86.3%	57%	124bp	127bp	18%	209.6M
aih-tih-sc-7dd1d5-R1_B23WHYVLT4_1_trimmed_2																																																			85.4%	58%	124bp	127bp	9%	209.6M	85.4%	58%	124bp	127bp	9%	209.6M
aih-tih-sc-7fc50e-R1_B23WHYVLT4_1	9999000000	140261447	131.0bp	122.0bp	0.02%	0.81%	0.36%	0.00%	0.04%	2.49%	0.54%	0.00%	No	0.00%	361923558	0.01%	0.58%	152073542	0.91%	0.94%	0.07%	0.06%	137947994	69373039	11359836	4668083	237.62	111.00	0.69%	0.52%	0.98	0.000				134bp	232bp	58.4%	0.0%	96.2%	87.3%	95.0%	172.0M	37.8%	97.7%	43450.0Mb	361.9M	53.3%	98.4%	67.1%
aih-tih-sc-7fc50e-R1_B23WHYVLT4_1_1																																	131.0bp	97.2%	175.8M																82.3%	52%	151bp	151bp	18%	183.9M
aih-tih-sc-7fc50e-R1_B23WHYVLT4_1_2																																																			80.2%	53%	151bp	151bp	18%	183.9M
aih-tih-sc-7fc50e-R1_B23WHYVLT4_1_trimmed_1																																																			82.3%	53%	123bp	127bp	9%	181.0M	82.3%	53%	123bp	127bp	9%	181.0M
aih-tih-sc-7fc50e-R1_B23WHYVLT4_1_trimmed_2																																																			81.3%	53%	123bp	127bp	9%	181.0M	81.3%	53%	123bp	127bp	9%	181.0M
aih-tih-sc-82e8c1-R1_B23WHYVLT4_1	9999000000	308239719	136.1bp	125.0bp	0.03%	1.43%	0.49%	0.00%	0.07%	4.37%	0.71%	0.00%	No	0.00%	564641534	0.01%	0.52%	270996436	0.93%	0.95%	0.06%	0.05%	251126753	126469509	16894783	6499003	458.47	219.00	0.75%	0.63%	0.98	0.000				141bp	292bp	52.3%	0.0%	96.8%	89.7%	95.5%	269.7M	34.7%	97.8%	69063.5Mb	564.6M	50.7%	98.5%	62.5%
aih-tih-sc-82e8c1-R1_B23WHYVLT4_1_1																																	136.1bp	97.6%	275.6M																84.2%	50%	151bp	151bp	27%	286.6M
aih-tih-sc-82e8c1-R1_B23WHYVLT4_1_2																																																			82.4%	51%	151bp	151bp	18%	286.6M
aih-tih-sc-82e8c1-R1_B23WHYVLT4_1_trimmed_1																																																			84.2%	50%	125bp	132bp	18%	282.3M	84.2%	50%	125bp	132bp	18%	282.3M
aih-tih-sc-82e8c1-R1_B23WHYVLT4_1_trimmed_2																																																			83.4%	51%	125bp	132bp	9%	282.3M	83.4%	51%	125bp	132bp	9%	282.3M
aih-tih-sc-884b4c-R1_B23WHYVLT4_1	9999000000	153098839	139.4bp	129.0bp	0.00%	0.38%	0.26%	0.00%	0.01%	1.36%	0.46%	0.00%	No	0.00%	588238020	0.01%	0.70%	177834243	0.90%	0.94%	0.07%	0.06%	160134215	80602994	12640030	4811700	292.67	143.00	0.73%	0.57%	0.98	0.000				171bp	333bp	70.4%	0.0%	96.6%	87.0%	95.0%	279.5M	49.8%	97.4%	73325.1Mb	588.2M	57.5%	98.0%	58.4%
aih-tih-sc-884b4c-R1_B23WHYVLT4_1_1																																	139.4bp	97.3%	286.3M																90.0%	56%	151bp	151bp	27%	441.4M
aih-tih-sc-884b4c-R1_B23WHYVLT4_1_2																																																			88.0%	57%	151bp	151bp	27%	441.4M
aih-tih-sc-884b4c-R1_B23WHYVLT4_1_trimmed_1																																																			87.6%	57%	128bp	137bp	18%	294.1M	87.6%	57%	128bp	137bp	18%	294.1M
aih-tih-sc-884b4c-R1_B23WHYVLT4_1_trimmed_2																																																			86.9%	57%	128bp	137bp	18%	294.1M	86.9%	57%	128bp	137bp	18%	294.1M
aih-tih-sc-89cc59-R1_B23WHYVLT4_1	9999000000	49957570	120.0bp	113.0bp	0.00%	0.52%	0.41%	0.00%	0.01%	1.69%	0.76%	0.00%	No	0.00%	352633012	0.01%	0.84%	57754303	0.81%	0.90%	0.11%	0.10%	46563130	23273901	6148642	2635314	67.97	10.00	0.34%	0.16%	0.97	0.000				129bp	199bp	84.8%	0.0%	96.6%	80.4%	92.4%	163.0M	54.5%	97.1%	40076.9Mb	352.6M	64.3%	97.4%	75.9%
aih-tih-sc-89cc59-R1_B23WHYVLT4_1_1																																	120.0bp	96.8%	170.7M																90.8%	60%	151bp	151bp	27%	181.0M
aih-tih-sc-89cc59-R1_B23WHYVLT4_1_2																																																			88.2%	62%	151bp	151bp	36%	181.0M
aih-tih-sc-89cc59-R1_B23WHYVLT4_1_trimmed_1																																																			90.8%	64%	117bp	117bp	18%	176.3M	90.8%	64%	117bp	117bp	18%	176.3M
aih-tih-sc-89cc59-R1_B23WHYVLT4_1_trimmed_2																																																			90.0%	64%	117bp	117bp	9%	176.3M	90.0%	64%	117bp	117bp	9%	176.3M
aih-tih-sc-8a623b-R1_B23WHYVLT4_1	9999000000	205177536	126.2bp	118.0bp	0.02%	0.91%	0.53%	0.00%	0.04%	2.85%	0.81%	0.00%	No	0.00%	590210554	0.01%	0.63%	218790270	0.92%	0.95%	0.07%	0.05%	200610227	100841195	14280239	5680534	338.89	167.00	0.74%	0.60%	0.98	0.000				137bp	272bp	63.3%	0.0%	96.8%	89.5%	95.8%	282.7M	38.2%	97.6%	69240.1Mb	590.2M	53.9%	98.4%	71.0%
aih-tih-sc-8a623b-R1_B23WHYVLT4_1_1																																	126.2bp	97.7%	288.4M																84.4%	52%	151bp	151bp	18%	314.8M
aih-tih-sc-8a623b-R1_B23WHYVLT4_1_2																																																			82.4%	53%	151bp	151bp	18%	314.8M
aih-tih-sc-8a623b-R1_B23WHYVLT4_1_trimmed_1																																																			84.0%	53%	120bp	122bp	9%	295.1M	84.0%	53%	120bp	122bp	9%	295.1M
aih-tih-sc-8a623b-R1_B23WHYVLT4_1_trimmed_2																																																			83.2%	54%	120bp	122bp	9%	295.1M	83.2%	54%	120bp	122bp	9%	295.1M
aih-tih-sc-8b4971-R1_B23WHYVLT4_1	9999000000	215573148	134.5bp	126.0bp	0.02%	0.75%	0.47%	0.00%	0.05%	2.41%	0.71%	0.00%	No	0.00%	572936290	0.01%	0.60%	230122986	0.92%	0.95%	0.07%	0.05%	211167518	106296298	15186250	5922091	371.18	182.00	0.72%	0.60%	0.98	0.000				140bp	248bp	60.2%	0.0%	96.4%	86.6%	95.0%	272.0M	39.0%	97.6%	69905.6Mb	572.9M	53.7%	98.4%	65.0%
aih-tih-sc-8b4971-R1_B23WHYVLT4_1_1																																	134.5bp	97.5%	279.4M																83.2%	52%	151bp	151bp	18%	291.1M
aih-tih-sc-8b4971-R1_B23WHYVLT4_1_2																																																			81.1%	53%	151bp	151bp	18%	291.1M
aih-tih-sc-8b4971-R1_B23WHYVLT4_1_trimmed_1																																																			83.2%	53%	125bp	132bp	9%	286.5M	83.2%	53%	125bp	132bp	9%	286.5M
aih-tih-sc-8b4971-R1_B23WHYVLT4_1_trimmed_2																																																			82.3%	53%	125bp	132bp	9%	286.5M	82.3%	53%	125bp	132bp	9%	286.5M
aih-tih-sc-8b9375-R1_B23WHYVLT4_1	9999000000	396920371	146.7bp	133.0bp	0.04%	0.76%	0.41%	0.00%	0.10%	2.33%	0.65%	0.00%	No	0.00%	589326844	0.01%	0.48%	309324000	0.92%	0.96%	0.06%	0.04%	286123328	144484221	18439036	6494692	551.77	278.00	0.76%	0.65%	0.98	0.000				165bp	389bp	47.9%	0.0%	96.3%	89.0%	95.4%	281.0M	32.7%	97.7%	73998.2Mb	589.3M	52.1%	98.2%	55.3%
aih-tih-sc-8b9375-R1_B23WHYVLT4_1_1																																	146.7bp	97.5%	287.3M																86.3%	51%	151bp	151bp	18%	396.4M
aih-tih-sc-8b9375-R1_B23WHYVLT4_1_2																																																			84.5%	52%	151bp	151bp	18%	396.4M
aih-tih-sc-8b9375-R1_B23WHYVLT4_1_trimmed_1																																																			84.5%	51%	128bp	142bp	9%	294.7M	84.5%	51%	128bp	142bp	9%	294.7M
aih-tih-sc-8b9375-R1_B23WHYVLT4_1_trimmed_2																																																			84.0%	52%	129bp	142bp	9%	294.7M	84.0%	52%	129bp	142bp	9%	294.7M
aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1	9990000000	119890071	117.0bp	110.0bp	0.06%	0.69%	0.39%	0.00%	0.12%	2.02%	0.57%	0.00%	No	0.00%	403300124	0.01%	0.69%	125744079	0.88%	0.91%	0.10%	0.09%	110649089	55493517	12400286	5489130	165.23	70.00	0.63%	0.43%	0.98	0.000				115bp	168bp	69.3%	0.0%	96.2%	87.2%	95.1%	191.7M	43.5%	97.8%	45067.5Mb	403.3M	52.3%	98.4%	79.3%
aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1_1																																	117.0bp	97.1%	195.8M																84.4%	51%	151bp	151bp	18%	204.9M
aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1_2																																																			82.5%	53%	151bp	151bp	18%	204.9M
aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1_trimmed_1																																																			84.4%	52%	114bp	112bp	9%	201.7M	84.4%	52%	114bp	112bp	9%	201.7M
aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1_trimmed_2																																																			83.6%	52%	114bp	112bp	9%	201.7M	83.6%	52%	114bp	112bp	9%	201.7M
aih-tih-sc-910896-R1_B23WHYVLT4_1	9999000000	135717854	139.5bp	130.0bp	0.03%	1.06%	0.49%	0.00%	0.07%	3.25%	0.74%	0.00%	No	0.00%	481567422	0.01%	0.67%	159968324	0.90%	0.94%	0.08%	0.06%	144569962	72754934	12279696	4883958	257.02	117.00	0.69%	0.53%	0.98	0.000				146bp	262bp	67.2%	0.0%	96.6%	87.5%	95.2%	229.3M	47.2%	97.5%	59617.0Mb	481.6M	55.4%	98.3%	61.1%
aih-tih-sc-910896-R1_B23WHYVLT4_1_1																																	139.5bp	97.5%	234.8M																86.4%	54%	151bp	151bp	18%	245.0M
aih-tih-sc-910896-R1_B23WHYVLT4_1_2																																																			84.2%	55%	151bp	151bp	18%	245.0M
aih-tih-sc-910896-R1_B23WHYVLT4_1_trimmed_1																																																			86.5%	55%	127bp	137bp	9%	240.8M	86.5%	55%	127bp	137bp	9%	240.8M
aih-tih-sc-910896-R1_B23WHYVLT4_1_trimmed_2																																																			85.6%	55%	127bp	137bp	9%	240.8M	85.6%	55%	127bp	137bp	9%	240.8M
aih-tih-sc-9114fc-R1_B23WHYVLT4_1	9999000000	365225827	160.2bp	146.0bp	0.02%	1.29%	0.49%	0.00%	0.04%	4.05%	0.78%	0.00%	No	0.00%	590163638	0.01%	0.49%	303229054	0.93%	0.96%	0.05%	0.04%	283309143	143327534	16425919	5296024	580.24	305.00	0.75%	0.65%	0.98	0.000				204bp	488bp	48.9%	0.0%	96.5%	89.4%	95.8%	282.8M	36.3%	97.6%	77381.1Mb	590.2M	55.1%	98.4%	46.3%
aih-tih-sc-9114fc-R1_B23WHYVLT4_1_1																																	160.2bp	97.8%	288.4M																87.8%	54%	151bp	151bp	18%	457.9M
aih-tih-sc-9114fc-R1_B23WHYVLT4_1_2																																																			86.3%	55%	151bp	151bp	18%	457.9M
aih-tih-sc-9114fc-R1_B23WHYVLT4_1_trimmed_1																																																			85.1%	54%	134bp	151bp	9%	295.1M	85.1%	54%	134bp	151bp	9%	295.1M
aih-tih-sc-9114fc-R1_B23WHYVLT4_1_trimmed_2																																																			84.7%	55%	134bp	151bp	9%	295.1M	84.7%	55%	134bp	151bp	9%	295.1M
aih-tih-sc-934f55-R1_B23WHYVLT4_1	9999000000	394328994	144.1bp	132.0bp	0.03%	0.86%	0.40%	0.00%	0.06%	2.70%	0.61%	0.00%	No	0.00%	590255784	0.01%	0.48%	306871195	0.93%	0.96%	0.05%	0.04%	285533113	144061568	15615653	5300904	552.28	290.00	0.77%	0.67%	0.98	0.000				159bp	347bp	48.5%	0.0%	97.0%	86.3%	94.3%	278.5M	31.7%	97.6%	74053.0Mb	590.3M	53.9%	98.4%	56.5%
aih-tih-sc-934f55-R1_B23WHYVLT4_1_1																																	144.1bp	98.0%	289.1M																84.5%	53%	151bp	151bp	27%	369.1M
aih-tih-sc-934f55-R1_B23WHYVLT4_1_2																																																			82.8%	53%	151bp	151bp	18%	369.1M
aih-tih-sc-934f55-R1_B23WHYVLT4_1_trimmed_1																																																			83.0%	53%	129bp	142bp	9%	295.1M	83.0%	53%	129bp	142bp	9%	295.1M
aih-tih-sc-934f55-R1_B23WHYVLT4_1_trimmed_2																																																			82.5%	54%	129bp	142bp	9%	295.1M	82.5%	54%	129bp	142bp	9%	295.1M
aih-tih-sc-973c73-R1_B23WHYVLT4_1	9999000000	271208766	129.6bp	120.0bp	0.02%	0.77%	0.45%	0.00%	0.05%	2.46%	0.70%	0.00%	No	0.00%	591110626	0.01%	0.56%	261751371	0.92%	0.95%	0.06%	0.05%	241958915	121743828	16040093	6245179	421.10	201.00	0.75%	0.62%	0.98	0.000				139bp	277bp	56.1%	0.0%	96.7%	89.2%	95.7%	282.7M	35.6%	97.7%	70458.7Mb	591.1M	54.2%	98.5%	67.5%
aih-tih-sc-973c73-R1_B23WHYVLT4_1_1																																	129.6bp	97.9%	289.3M																87.9%	53%	151bp	151bp	18%	448.3M
aih-tih-sc-973c73-R1_B23WHYVLT4_1_2																																																			86.5%	54%	151bp	151bp	18%	448.3M
aih-tih-sc-973c73-R1_B23WHYVLT4_1_trimmed_1																																																			85.4%	53%	122bp	127bp	9%	295.6M	85.4%	53%	122bp	127bp	9%	295.6M
aih-tih-sc-973c73-R1_B23WHYVLT4_1_trimmed_2																																																			84.9%	54%	122bp	127bp	9%	295.6M	84.9%	54%	122bp	127bp	9%	295.6M
aih-tih-sc-976eb1-R1_B23WHYVLT4_1	9999000000	38452230	116.0bp	110.0bp	0.03%	0.55%	0.25%	0.00%	0.06%	1.74%	0.40%	0.00%	No	0.00%	144234166	0.03%	0.76%	35140308	0.72%	0.84%	0.15%	0.16%	25331373	12670558	5226720	2432266	36.14	14.00	0.34%	0.08%	0.98	0.000				112bp	141bp	78.1%	0.0%	95.1%	81.7%	91.8%	66.2M	45.5%	97.6%	15975.2Mb	144.2M	54.4%	97.5%	80.2%
aih-tih-sc-976eb1-R1_B23WHYVLT4_1_1																																	116.0bp	94.0%	67.8M																83.6%	53%	151bp	151bp	27%	74.0M
aih-tih-sc-976eb1-R1_B23WHYVLT4_1_2																																																			81.2%	54%	151bp	151bp	27%	74.0M
aih-tih-sc-976eb1-R1_B23WHYVLT4_1_trimmed_1																																																			83.4%	54%	113bp	112bp	18%	72.1M	83.4%	54%	113bp	112bp	18%	72.1M
aih-tih-sc-976eb1-R1_B23WHYVLT4_1_trimmed_2																																																			82.3%	54%	114bp	112bp	9%	72.1M	82.3%	54%	114bp	112bp	9%	72.1M
aih-tih-sc-97c26d-R1_B23WHYVLT4_1	9999000000	93947849	106.7bp	101.0bp	0.04%	1.52%	0.42%	0.00%	0.08%	4.41%	0.63%	0.00%	No	0.00%	220882254	0.01%	0.71%	64852454	0.85%	0.88%	0.12%	0.12%	55207673	27651747	8036016	3696897	75.66	27.00	0.48%	0.22%	0.98	0.000				104bp	141bp	71.2%	0.0%	95.7%	87.2%	95.1%	105.0M	38.9%	97.7%	23121.3Mb	220.9M	51.4%	98.3%	86.1%
aih-tih-sc-97c26d-R1_B23WHYVLT4_1_1																																	106.7bp	96.4%	106.5M																81.3%	51%	151bp	151bp	18%	112.3M
aih-tih-sc-97c26d-R1_B23WHYVLT4_1_2																																																			79.6%	51%	151bp	151bp	27%	112.3M
aih-tih-sc-97c26d-R1_B23WHYVLT4_1_trimmed_1																																																			81.3%	51%	107bp	107bp	18%	110.4M	81.3%	51%	107bp	107bp	18%	110.4M
aih-tih-sc-97c26d-R1_B23WHYVLT4_1_trimmed_2																																																			80.4%	51%	107bp	107bp	9%	110.4M	80.4%	51%	107bp	107bp	9%	110.4M
aih-tih-sc-97ecde-R1_B23WHYVLT4_1	9999000000	99127221	124.4bp	115.0bp	0.04%	0.64%	0.30%	0.00%	0.08%	2.08%	0.48%	0.00%	Yes	22.62%	499479968	0.01%	0.79%	104178614	0.82%	0.87%	0.13%	0.13%	85794500	43046886	13843694	6187176	134.90	62.00	0.63%	0.39%	0.98	0.000				123bp	186bp	79.9%	0.0%	95.8%	85.7%	94.6%	236.2M	50.5%	97.6%	57721.5Mb	499.5M	54.8%	98.2%	72.2%
aih-tih-sc-97ecde-R1_B23WHYVLT4_1_1																																	124.4bp	96.9%	242.0M																87.8%	53%	151bp	151bp	27%	254.3M
aih-tih-sc-97ecde-R1_B23WHYVLT4_1_2																																																			85.7%	55%	151bp	151bp	18%	254.3M
aih-tih-sc-97ecde-R1_B23WHYVLT4_1_trimmed_1																																																			87.8%	54%	118bp	122bp	18%	249.7M	87.8%	54%	118bp	122bp	18%	249.7M
aih-tih-sc-97ecde-R1_B23WHYVLT4_1_trimmed_2																																																			87.0%	55%	118bp	122bp	9%	249.7M	87.0%	55%	118bp	122bp	9%	249.7M
aih-tih-sc-a03f86-R1_B23WHYVLT4_1	9999000000	285557296	151.6bp	137.0bp	0.03%	0.81%	0.48%	0.00%	0.08%	2.76%	0.77%	0.00%	No	0.00%	318215084	0.01%	0.43%	180306209	0.94%	0.96%	0.05%	0.04%	168894009	85317532	9512908	3211361	337.57	163.00	0.73%	0.59%	0.98	0.000				197bp	493bp	43.6%	0.0%	96.7%	90.2%	96.0%	152.7M	30.1%	97.7%	40645.9Mb	318.2M	53.8%	98.5%	52.0%
aih-tih-sc-a03f86-R1_B23WHYVLT4_1_1																																	151.6bp	97.9%	155.7M																81.2%	53%	151bp	151bp	18%	161.5M
aih-tih-sc-a03f86-R1_B23WHYVLT4_1_2																																																			78.8%	54%	151bp	151bp	18%	161.5M
aih-tih-sc-a03f86-R1_B23WHYVLT4_1_trimmed_1																																																			81.3%	53%	131bp	147bp	9%	159.1M	81.3%	53%	131bp	147bp	9%	159.1M
aih-tih-sc-a03f86-R1_B23WHYVLT4_1_trimmed_2																																																			79.9%	54%	131bp	147bp	9%	159.1M	79.9%	54%	131bp	147bp	9%	159.1M
aih-tih-sc-a3a521-R1_B23WHYVLT4_1	9999000000	307005055	136.0bp	125.0bp	0.04%	0.90%	0.64%	0.00%	0.08%	2.67%	0.91%	0.00%	No	0.00%	589939694	0.01%	0.52%	282461256	0.93%	0.96%	0.06%	0.04%	262873826	132457213	15961459	5879252	482.46	256.00	0.76%	0.65%	0.98	0.000				152bp	362bp	52.4%	0.0%	97.0%	89.8%	95.7%	282.4M	35.0%	97.8%	72354.1Mb	589.9M	52.2%	98.5%	61.8%
aih-tih-sc-a3a521-R1_B23WHYVLT4_1_1																																	136.0bp	97.8%	288.6M																84.5%	51%	151bp	151bp	18%	299.5M
aih-tih-sc-a3a521-R1_B23WHYVLT4_1_2																																																			82.8%	52%	151bp	151bp	18%	299.5M
aih-tih-sc-a3a521-R1_B23WHYVLT4_1_trimmed_1																																																			84.5%	51%	125bp	132bp	9%	295.0M	84.5%	51%	125bp	132bp	9%	295.0M
aih-tih-sc-a3a521-R1_B23WHYVLT4_1_trimmed_2																																																			83.9%	52%	126bp	132bp	9%	295.0M	83.9%	52%	126bp	132bp	9%	295.0M
aih-tih-sc-a49d10-R1_B23WHYVLT4_1	9999000000	259867082	135.8bp	125.0bp	0.05%	0.91%	0.38%	0.00%	0.11%	2.79%	0.54%	0.00%	No	0.00%	590241030	0.01%	0.57%	255325010	0.92%	0.95%	0.06%	0.05%	234671970	118039268	15325612	5892289	418.48	181.00	0.71%	0.59%	0.98	0.000				141bp	289bp	57.3%	0.0%	97.2%	86.3%	94.6%	279.2M	38.3%	97.6%	71764.3Mb	590.2M	53.2%	98.4%	65.0%
aih-tih-sc-a49d10-R1_B23WHYVLT4_1_1																																	135.8bp	98.0%	289.3M																88.2%	52%	151bp	151bp	27%	476.7M
aih-tih-sc-a49d10-R1_B23WHYVLT4_1_2																																																			86.2%	53%	151bp	151bp	18%	476.7M
aih-tih-sc-a49d10-R1_B23WHYVLT4_1_trimmed_1																																																			85.2%	52%	125bp	132bp	18%	295.1M	85.2%	52%	125bp	132bp	18%	295.1M
aih-tih-sc-a49d10-R1_B23WHYVLT4_1_trimmed_2																																																			84.4%	53%	125bp	132bp	9%	295.1M	84.4%	53%	125bp	132bp	9%	295.1M
aih-tih-sc-a70f1e-R1_B23WHYVLT4_1	9999000000	97727921	114.2bp	108.0bp	0.03%	1.98%	1.03%	0.00%	0.06%	5.26%	1.38%	0.00%	No	0.00%	491971576	0.01%	0.79%	102670343	0.84%	0.88%	0.12%	0.12%	86373983	43263196	12774380	5766695	124.65	40.00	0.54%	0.35%	0.98	0.000				111bp	167bp	79.7%	0.0%	96.5%	86.9%	94.9%	233.4M	45.6%	97.8%	53698.2Mb	492.0M	51.6%	98.3%	81.8%
aih-tih-sc-a70f1e-R1_B23WHYVLT4_1_1																																	114.2bp	97.1%	238.8M																88.1%	51%	151bp	151bp	18%	250.4M
aih-tih-sc-a70f1e-R1_B23WHYVLT4_1_2																																																			86.3%	52%	151bp	151bp	27%	250.4M
aih-tih-sc-a70f1e-R1_B23WHYVLT4_1_trimmed_1																																																			88.1%	51%	112bp	112bp	9%	246.0M	88.1%	51%	112bp	112bp	9%	246.0M
aih-tih-sc-a70f1e-R1_B23WHYVLT4_1_trimmed_2																																																			87.5%	51%	112bp	112bp	9%	246.0M	87.5%	51%	112bp	112bp	9%	246.0M
aih-tih-sc-ac6a71-R1_B23WHYVLT4_1	9999000000	340501533	148.5bp	134.0bp	0.03%	1.08%	0.59%	0.00%	0.07%	3.51%	0.90%	0.00%	No	0.00%	591045986	0.01%	0.52%	282799339	0.94%	0.97%	0.05%	0.03%	265088987	133905310	14497336	4756332	524.79	256.00	0.76%	0.64%	0.98	0.000				203bp	525bp	52.4%	0.0%	97.1%	91.5%	96.4%	284.8M	37.0%	97.7%	74989.7Mb	591.0M	53.7%	98.5%	53.3%
aih-tih-sc-ac6a71-R1_B23WHYVLT4_1_1																																	148.5bp	98.2%	290.2M																86.9%	52%	151bp	151bp	18%	334.4M
aih-tih-sc-ac6a71-R1_B23WHYVLT4_1_2																																																			85.1%	53%	151bp	151bp	18%	334.4M
aih-tih-sc-ac6a71-R1_B23WHYVLT4_1_trimmed_1																																																			86.3%	53%	130bp	147bp	9%	295.5M	86.3%	53%	130bp	147bp	9%	295.5M
aih-tih-sc-ac6a71-R1_B23WHYVLT4_1_trimmed_2																																																			85.5%	54%	130bp	147bp	9%	295.5M	85.5%	54%	130bp	147bp	9%	295.5M
aih-tih-sc-b157e9-R1_B23WHYVLT4_1	9990000000	194468406	134.6bp	125.0bp	0.03%	0.79%	0.43%	0.00%	0.07%	2.35%	0.62%	0.00%	No	0.00%	590007404	0.01%	0.62%	226366623	0.92%	0.96%	0.06%	0.04%	207225279	104231601	12473288	4648217	368.40	177.00	0.73%	0.60%	0.98	0.000				141bp	269bp	62.3%	0.0%	97.3%	86.6%	94.1%	277.7M	40.6%	97.7%	71851.7Mb	590.0M	54.9%	98.3%	64.7%
aih-tih-sc-b157e9-R1_B23WHYVLT4_1_1																																	134.6bp	98.0%	289.0M																86.8%	54%	151bp	151bp	27%	393.8M
aih-tih-sc-b157e9-R1_B23WHYVLT4_1_2																																																			85.1%	55%	151bp	151bp	18%	393.8M
aih-tih-sc-b157e9-R1_B23WHYVLT4_1_trimmed_1																																																			84.8%	54%	125bp	132bp	18%	295.0M	84.8%	54%	125bp	132bp	18%	295.0M
aih-tih-sc-b157e9-R1_B23WHYVLT4_1_trimmed_2																																																			84.3%	55%	125bp	132bp	9%	295.0M	84.3%	55%	125bp	132bp	9%	295.0M
aih-tih-sc-b845f7-R1_B23WHYVLT4_1	9999000000	243187711	141.7bp	132.0bp	0.03%	0.84%	0.34%	0.00%	0.06%	2.53%	0.52%	0.00%	Yes	1.09%	562449410	0.01%	0.57%	244342608	0.92%	0.95%	0.07%	0.05%	223970026	112981202	16056713	6001961	411.16	200.00	0.75%	0.62%	0.98	0.000				151bp	278bp	57.0%	0.0%	95.8%	87.7%	95.1%	267.5M	39.5%	97.6%	70351.8Mb	562.4M	55.9%	98.3%	58.8%
aih-tih-sc-b845f7-R1_B23WHYVLT4_1_1																																	141.7bp	97.4%	273.8M																85.3%	54%	151bp	151bp	27%	286.1M
aih-tih-sc-b845f7-R1_B23WHYVLT4_1_2																																																			83.4%	55%	151bp	151bp	18%	286.1M
aih-tih-sc-b845f7-R1_B23WHYVLT4_1_trimmed_1																																																			85.3%	55%	128bp	137bp	18%	281.2M	85.3%	55%	128bp	137bp	18%	281.2M
aih-tih-sc-b845f7-R1_B23WHYVLT4_1_trimmed_2																																																			84.6%	56%	128bp	137bp	9%	281.2M	84.6%	56%	128bp	137bp	9%	281.2M
aih-tih-sc-b93682-R1_B23WHYVLT4_1	9999000000	404108442	171.0bp	154.0bp	0.04%	2.62%	0.60%	0.00%	0.07%	7.75%	0.94%	0.00%	No	0.00%	590831830	0.01%	0.51%	292017403	0.94%	0.97%	0.05%	0.03%	273967680	138979783	15072780	4264100	597.17	227.00	0.71%	0.61%	0.98	0.000				304bp	875bp	50.8%	0.0%	97.1%	90.6%	96.3%	284.6M	38.3%	97.7%	78859.3Mb	590.8M	53.8%	98.5%	40.6%
aih-tih-sc-b93682-R1_B23WHYVLT4_1_1																																	171.0bp	97.9%	289.3M																88.8%	53%	151bp	151bp	18%	440.3M
aih-tih-sc-b93682-R1_B23WHYVLT4_1_2																																																			87.0%	54%	151bp	151bp	18%	440.3M
aih-tih-sc-b93682-R1_B23WHYVLT4_1_trimmed_1																																																			86.7%	53%	137bp	151bp	9%	295.4M	86.7%	53%	137bp	151bp	9%	295.4M
aih-tih-sc-b93682-R1_B23WHYVLT4_1_trimmed_2																																																			86.2%	54%	137bp	151bp	9%	295.4M	86.2%	54%	137bp	151bp	9%	295.4M
aih-tih-sc-be4b28-R1_B23WHYVLT4_1	9999000000	174667886	124.4bp	116.0bp	0.04%	1.28%	0.53%	0.00%	0.09%	3.51%	0.74%	0.00%	No	0.00%	452472898	0.01%	0.60%	183135220	0.93%	0.95%	0.06%	0.05%	169824525	85300319	10678985	4206353	279.96	121.00	0.67%	0.53%	0.98	0.000				126bp	250bp	59.9%	0.0%	97.4%	89.4%	95.6%	216.3M	36.2%	97.8%	52447.7Mb	452.5M	52.1%	98.3%	73.3%
aih-tih-sc-be4b28-R1_B23WHYVLT4_1_1																																	124.4bp	98.0%	221.8M																84.0%	51%	151bp	151bp	27%	230.0M
aih-tih-sc-be4b28-R1_B23WHYVLT4_1_2																																																			81.9%	52%	151bp	151bp	27%	230.0M
aih-tih-sc-be4b28-R1_B23WHYVLT4_1_trimmed_1																																																			83.9%	51%	118bp	122bp	18%	226.2M	83.9%	51%	118bp	122bp	18%	226.2M
aih-tih-sc-be4b28-R1_B23WHYVLT4_1_trimmed_2																																																			83.1%	52%	119bp	122bp	9%	226.2M	83.1%	52%	119bp	122bp	9%	226.2M
aih-tih-sc-c04072-R1_B23WHYVLT4_1	9999000000	202521146	148.8bp	140.0bp	0.01%	0.64%	0.51%	0.00%	0.03%	2.25%	0.83%	0.00%	No	0.00%	590997126	0.01%	0.63%	219503936	0.93%	0.96%	0.06%	0.04%	203191637	102597970	12222784	4195091	399.77	190.00	0.74%	0.61%	0.98	0.000				221bp	543bp	63.3%	0.0%	96.9%	90.7%	95.9%	283.3M	46.9%	97.6%	76803.3Mb	591.0M	54.9%	98.5%	51.7%
aih-tih-sc-c04072-R1_B23WHYVLT4_1_1																																	148.8bp	98.0%	289.5M																87.3%	53%	151bp	151bp	18%	314.9M
aih-tih-sc-c04072-R1_B23WHYVLT4_1_2																																																			85.5%	54%	151bp	151bp	18%	314.9M
aih-tih-sc-c04072-R1_B23WHYVLT4_1_trimmed_1																																																			87.0%	54%	133bp	147bp	18%	295.5M	87.0%	54%	133bp	147bp	18%	295.5M
aih-tih-sc-c04072-R1_B23WHYVLT4_1_trimmed_2																																																			86.3%	55%	133bp	147bp	18%	295.5M	86.3%	55%	133bp	147bp	18%	295.5M
aih-tih-sc-c55577-R1_B23WHYVLT4_1	9999000000	67812585	133.2bp	125.0bp	0.05%	1.11%	0.43%	0.00%	0.12%	3.60%	0.74%	0.00%	No	0.00%	388340914	0.01%	0.79%	81466803	0.86%	0.92%	0.09%	0.08%	69942643	35096053	7223838	2943870	118.24	36.00	0.53%	0.30%	0.98	0.000				131bp	188bp	79.9%	0.0%	97.1%	72.5%	88.7%	172.3M	55.7%	97.4%	46769.9Mb	388.3M	58.8%	97.8%	65.8%
aih-tih-sc-c55577-R1_B23WHYVLT4_1_1																																	133.2bp	97.5%	189.4M																89.4%	57%	151bp	151bp	27%	198.6M
aih-tih-sc-c55577-R1_B23WHYVLT4_1_2																																																			87.0%	58%	151bp	151bp	18%	198.6M
aih-tih-sc-c55577-R1_B23WHYVLT4_1_trimmed_1																																																			89.5%	58%	124bp	127bp	18%	194.2M	89.5%	58%	124bp	127bp	18%	194.2M
aih-tih-sc-c55577-R1_B23WHYVLT4_1_trimmed_2																																																			88.6%	59%	124bp	127bp	9%	194.2M	88.6%	59%	124bp	127bp	9%	194.2M
aih-tih-sc-c5cb90-R1_B23WHYVLT4_1	9999000000	118989974	121.4bp	114.0bp	0.09%	2.41%	0.80%	0.00%	0.16%	6.52%	1.18%	0.00%	No	0.00%	587142262	0.01%	0.76%	140599935	0.88%	0.93%	0.09%	0.07%	123687857	61991068	12026879	5018067	192.71	71.00	0.62%	0.44%	0.98	0.000				123bp	194bp	76.7%	0.0%	97.3%	79.3%	91.7%	269.1M	47.4%	97.5%	67689.7Mb	587.1M	56.1%	97.9%	74.8%
aih-tih-sc-c5cb90-R1_B23WHYVLT4_1_1																																	121.4bp	97.7%	286.7M																91.1%	54%	151bp	151bp	27%	513.3M
aih-tih-sc-c5cb90-R1_B23WHYVLT4_1_2																																																			88.9%	56%	151bp	151bp	18%	513.3M
aih-tih-sc-c5cb90-R1_B23WHYVLT4_1_trimmed_1																																																			87.9%	55%	118bp	117bp	18%	293.6M	87.9%	55%	118bp	117bp	18%	293.6M
aih-tih-sc-c5cb90-R1_B23WHYVLT4_1_trimmed_2																																																			87.3%	56%	118bp	122bp	9%	293.6M	87.3%	56%	118bp	122bp	9%	293.6M
aih-tih-sc-c63171-R1_B23WHYVLT4_1	9999000000	222123216	129.8bp	122.0bp	0.04%	1.13%	0.58%	0.00%	0.10%	3.41%	0.87%	0.00%	No	0.00%	590163676	0.01%	0.59%	243813832	0.92%	0.95%	0.06%	0.05%	224384664	112831576	15075965	5880100	389.66	191.00	0.71%	0.60%	0.98	0.000				135bp	247bp	59.1%	0.0%	97.0%	84.3%	93.7%	276.6M	36.4%	97.6%	70388.6Mb	590.2M	54.3%	98.4%	68.4%
aih-tih-sc-c63171-R1_B23WHYVLT4_1_1																																	129.8bp	97.7%	288.3M																84.8%	53%	151bp	151bp	18%	335.7M
aih-tih-sc-c63171-R1_B23WHYVLT4_1_2																																																			83.1%	54%	151bp	151bp	18%	335.7M
aih-tih-sc-c63171-R1_B23WHYVLT4_1_trimmed_1																																																			84.0%	53%	122bp	127bp	9%	295.1M	84.0%	53%	122bp	127bp	9%	295.1M
aih-tih-sc-c63171-R1_B23WHYVLT4_1_trimmed_2																																																			83.5%	54%	122bp	127bp	9%	295.1M	83.5%	54%	122bp	127bp	9%	295.1M
aih-tih-sc-c7b68f-R1_B23WHYVLT4_1	9999000000	241786799	131.8bp	122.0bp	0.06%	1.17%	0.89%	0.00%	0.13%	3.41%	1.22%	0.00%	No	0.00%	590092498	0.01%	0.58%	247569352	0.93%	0.96%	0.05%	0.04%	231269015	116337297	13090411	4814267	407.06	180.00	0.71%	0.59%	0.98	0.000				144bp	341bp	58.4%	0.0%	97.6%	90.4%	96.0%	283.1M	37.9%	97.7%	70531.9Mb	590.1M	52.9%	98.3%	67.0%
aih-tih-sc-c7b68f-R1_B23WHYVLT4_1_1																																	131.8bp	98.3%	290.1M																86.4%	52%	151bp	151bp	27%	322.9M
aih-tih-sc-c7b68f-R1_B23WHYVLT4_1_2																																																			84.8%	53%	151bp	151bp	18%	322.9M
aih-tih-sc-c7b68f-R1_B23WHYVLT4_1_trimmed_1																																																			85.8%	52%	122bp	127bp	18%	295.0M	85.8%	52%	122bp	127bp	18%	295.0M
aih-tih-sc-c7b68f-R1_B23WHYVLT4_1_trimmed_2																																																			85.6%	53%	122bp	127bp	9%	295.0M	85.6%	53%	122bp	127bp	9%	295.0M
aih-tih-sc-c9a01b-R1_B23WHYVLT4_1	9999000000	203431774	142.5bp	130.0bp	0.04%	0.76%	0.55%	0.00%	0.08%	2.52%	0.86%	0.00%	No	0.00%	590387040	0.01%	0.64%	211418440	0.92%	0.95%	0.06%	0.05%	194293279	98076013	13256807	4744223	365.53	165.00	0.73%	0.59%	0.97	0.000				188bp	437bp	64.6%	0.0%	96.9%	90.7%	96.2%	284.1M	44.9%	97.4%	73785.1Mb	590.4M	55.5%	98.4%	57.5%
aih-tih-sc-c9a01b-R1_B23WHYVLT4_1_1																																	142.5bp	98.0%	289.4M																90.2%	54%	151bp	151bp	18%	471.3M
aih-tih-sc-c9a01b-R1_B23WHYVLT4_1_2																																																			88.2%	55%	151bp	151bp	18%	471.3M
aih-tih-sc-c9a01b-R1_B23WHYVLT4_1_trimmed_1																																																			87.6%	55%	128bp	137bp	9%	295.2M	87.6%	55%	128bp	137bp	9%	295.2M
aih-tih-sc-c9a01b-R1_B23WHYVLT4_1_trimmed_2																																																			86.7%	55%	128bp	137bp	9%	295.2M	86.7%	55%	128bp	137bp	9%	295.2M
aih-tih-sc-ce6733-R1_B23WHYVLT4_1	9999000000	271078159	145.0bp	133.0bp	0.04%	1.08%	0.65%	0.00%	0.08%	3.37%	1.00%	0.00%	No	0.00%	590004620	0.01%	0.55%	264114698	0.93%	0.96%	0.05%	0.04%	246181763	124116390	13912472	4791281	471.05	205.00	0.73%	0.61%	0.98	0.000				168bp	356bp	55.6%	0.0%	97.2%	85.8%	94.2%	278.0M	38.1%	97.5%	74264.3Mb	590.0M	56.5%	98.3%	56.3%
aih-tih-sc-ce6733-R1_B23WHYVLT4_1_1																																	145.0bp	98.0%	289.0M																88.9%	55%	151bp	151bp	18%	523.9M
aih-tih-sc-ce6733-R1_B23WHYVLT4_1_2																																																			87.4%	56%	151bp	151bp	18%	523.9M
aih-tih-sc-ce6733-R1_B23WHYVLT4_1_trimmed_1																																																			85.4%	56%	129bp	142bp	9%	295.0M	85.4%	56%	129bp	142bp	9%	295.0M
aih-tih-sc-ce6733-R1_B23WHYVLT4_1_trimmed_2																																																			85.1%	56%	129bp	142bp	9%	295.0M	85.1%	56%	129bp	142bp	9%	295.0M
aih-tih-sc-d113b5-R1_B23WHYVLT4_1	9999000000	122273024	125.0bp	116.0bp	0.01%	0.97%	0.53%	0.00%	0.03%	3.09%	0.85%	0.00%	No	0.00%	589843474	0.01%	0.72%	164781056	0.91%	0.94%	0.07%	0.06%	149501803	75077443	11071434	4409135	245.99	121.00	0.70%	0.54%	0.98	0.000				143bp	286bp	72.6%	0.0%	97.3%	89.0%	95.5%	281.7M	45.9%	97.6%	68808.7Mb	589.8M	56.2%	98.3%	71.3%
aih-tih-sc-d113b5-R1_B23WHYVLT4_1_1																																	125.0bp	98.0%	289.0M																87.6%	54%	151bp	151bp	18%	313.6M
aih-tih-sc-d113b5-R1_B23WHYVLT4_1_2																																																			86.0%	55%	151bp	151bp	18%	313.6M
aih-tih-sc-d113b5-R1_B23WHYVLT4_1_trimmed_1																																																			87.3%	55%	119bp	122bp	18%	294.9M	87.3%	55%	119bp	122bp	18%	294.9M
aih-tih-sc-d113b5-R1_B23WHYVLT4_1_trimmed_2																																																			86.9%	56%	120bp	122bp	18%	294.9M	86.9%	56%	120bp	122bp	18%	294.9M
aih-tih-sc-d12f1f-R1_B23WHYVLT4_1	9999000000	460889132	145.7bp	131.0bp	0.02%	0.94%	0.59%	0.00%	0.04%	2.84%	0.79%	0.00%	Yes	0.00%	590234764	0.01%	0.46%	321183073	0.94%	0.97%	0.05%	0.03%	302147502	152500731	16064425	5350841	592.89	267.00	0.73%	0.63%	0.98	0.000				166bp	415bp	45.8%	0.0%	97.1%	90.5%	95.9%	283.1M	31.2%	97.7%	74344.8Mb	590.2M	52.3%	98.4%	54.8%
aih-tih-sc-d12f1f-R1_B23WHYVLT4_1_1																																	145.7bp	98.0%	289.4M																87.8%	51%	151bp	151bp	27%	493.1M
aih-tih-sc-d12f1f-R1_B23WHYVLT4_1_2																																																			85.9%	52%	151bp	151bp	18%	493.1M
aih-tih-sc-d12f1f-R1_B23WHYVLT4_1_trimmed_1																																																			85.0%	51%	129bp	142bp	18%	295.1M	85.0%	51%	129bp	142bp	18%	295.1M
aih-tih-sc-d12f1f-R1_B23WHYVLT4_1_trimmed_2																																																			84.2%	52%	129bp	142bp	9%	295.1M	84.2%	52%	129bp	142bp	9%	295.1M
aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1	9999000000	145417756	133.9bp	125.0bp	0.02%	0.63%	0.36%	0.00%	0.05%	2.02%	0.57%	0.00%	No	0.00%	439882292	0.01%	0.65%	153679252	0.90%	0.93%	0.08%	0.07%	137597666	69240644	12335037	5040165	236.92	117.00	0.70%	0.53%	0.98	0.000				137bp	215bp	65.6%	0.0%	95.9%	87.8%	95.2%	209.3M	44.6%	97.6%	53633.7Mb	439.9M	55.4%	98.3%	64.8%
aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1_1																																	133.9bp	97.2%	213.8M																82.3%	54%	151bp	151bp	27%	223.7M
aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1_2																																																			79.9%	55%	151bp	151bp	18%	223.7M
aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1_trimmed_1																																																			82.3%	55%	125bp	132bp	18%	219.9M	82.3%	55%	125bp	132bp	18%	219.9M
aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1_trimmed_2																																																			81.1%	55%	125bp	132bp	9%	219.9M	81.1%	55%	125bp	132bp	9%	219.9M
aih-tih-sc-d5506e-R1_B23WHYVLT4_1	9999000000	114071772	131.1bp	122.0bp	0.03%	0.78%	0.31%	0.00%	0.06%	2.71%	0.54%	0.00%	No	0.00%	512515456	0.01%	0.76%	124822796	0.89%	0.93%	0.08%	0.07%	110929708	55749605	10259596	4150021	191.73	85.00	0.66%	0.46%	0.97	0.000				155bp	306bp	76.2%	0.0%	97.0%	89.3%	95.7%	245.2M	51.8%	97.3%	61837.7Mb	512.5M	56.0%	98.2%	65.1%
aih-tih-sc-d5506e-R1_B23WHYVLT4_1_1																																	131.1bp	97.9%	250.8M																89.0%	54%	151bp	151bp	36%	260.9M
aih-tih-sc-d5506e-R1_B23WHYVLT4_1_2																																																			86.5%	55%	151bp	151bp	18%	260.9M
aih-tih-sc-d5506e-R1_B23WHYVLT4_1_trimmed_1																																																			89.1%	55%	124bp	127bp	27%	256.3M	89.1%	55%	124bp	127bp	27%	256.3M
aih-tih-sc-d5506e-R1_B23WHYVLT4_1_trimmed_2																																																			87.8%	56%	124bp	132bp	18%	256.3M	87.8%	56%	124bp	132bp	18%	256.3M
aih-tih-sc-e9e54b-R1_B23WHYVLT4_1	9999000000	135557710	129.0bp	122.0bp	0.03%	1.17%	0.51%	0.00%	0.06%	3.48%	0.80%	0.00%	No	0.00%	580189612	0.01%	0.71%	166119716	0.89%	0.93%	0.08%	0.07%	147138893	73916766	14068060	5835369	240.51	107.00	0.69%	0.51%	0.98	0.000				130bp	204bp	72.0%	0.0%	96.4%	85.8%	94.5%	274.2M	48.7%	97.5%	69111.4Mb	580.2M	56.6%	98.1%	69.2%
aih-tih-sc-e9e54b-R1_B23WHYVLT4_1_1																																	129.0bp	97.2%	282.1M																85.4%	55%	151bp	151bp	18%	295.6M
aih-tih-sc-e9e54b-R1_B23WHYVLT4_1_2																																																			83.6%	56%	151bp	151bp	18%	295.6M
aih-tih-sc-e9e54b-R1_B23WHYVLT4_1_trimmed_1																																																			85.4%	56%	122bp	127bp	9%	290.1M	85.4%	56%	122bp	127bp	9%	290.1M
aih-tih-sc-e9e54b-R1_B23WHYVLT4_1_trimmed_2																																																			85.0%	56%	122bp	127bp	9%	290.1M	85.0%	56%	122bp	127bp	9%	290.1M
aih-tih-sc-ea2fad-R1_B23WHYVLT4_1	9999000000	97867574	111.7bp	106.0bp	0.04%	1.16%	0.58%	0.00%	0.09%	3.51%	0.88%	0.00%	No	0.00%	367781122	0.01%	0.72%	101931556	0.90%	0.92%	0.09%	0.08%	91289842	45753039	8704569	3776658	133.64	53.00	0.59%	0.37%	0.98	0.000				114bp	193bp	72.7%	0.0%	97.2%	89.4%	96.0%	176.5M	44.4%	97.7%	40149.6Mb	367.8M	52.5%	98.4%	82.0%
aih-tih-sc-ea2fad-R1_B23WHYVLT4_1_1																																	111.7bp	97.9%	180.0M																85.2%	51%	151bp	151bp	18%	186.9M
aih-tih-sc-ea2fad-R1_B23WHYVLT4_1_2																																																			83.3%	52%	151bp	151bp	27%	186.9M
aih-tih-sc-ea2fad-R1_B23WHYVLT4_1_trimmed_1																																																			85.2%	52%	112bp	112bp	9%	183.9M	85.2%	52%	112bp	112bp	9%	183.9M
aih-tih-sc-ea2fad-R1_B23WHYVLT4_1_trimmed_2																																																			84.4%	52%	112bp	112bp	9%	183.9M	84.4%	52%	112bp	112bp	9%	183.9M
aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1	9999000000	308367226	136.7bp	126.0bp	0.04%	1.19%	0.67%	0.00%	0.09%	3.55%	0.97%	0.00%	Yes	0.00%	589560698	0.01%	0.53%	275953427	0.93%	0.96%	0.05%	0.04%	256889959	129361502	15054801	5422713	470.76	215.00	0.72%	0.61%	0.98	0.000				147bp	308bp	53.6%	0.0%	97.1%	84.4%	93.6%	275.9M	34.9%	97.7%	72152.1Mb	589.6M	53.2%	98.3%	62.9%
aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1_1																																	136.7bp	97.9%	288.5M																87.2%	52%	151bp	151bp	27%	448.5M
aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1_2																																																			85.5%	53%	151bp	151bp	18%	448.5M
aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1_trimmed_1																																																			84.6%	52%	125bp	132bp	18%	294.8M	84.6%	52%	125bp	132bp	18%	294.8M
aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1_trimmed_2																																																			84.1%	53%	125bp	132bp	9%	294.8M	84.1%	53%	125bp	132bp	9%	294.8M
aih-tih-sc-f14fdc-R1_B23WHYVLT4_1	9999000000	384743452	142.6bp	132.0bp	0.02%	0.82%	0.43%	0.00%	0.04%	2.78%	0.70%	0.00%	No	0.00%	590640504	0.01%	0.50%	293128143	0.93%	0.96%	0.06%	0.04%	272597632	137523349	16526364	5882019	524.62	264.00	0.77%	0.66%	0.98	0.000				174bp	401bp	50.7%	0.0%	96.8%	90.3%	96.0%	283.5M	34.2%	97.5%	73879.7Mb	590.6M	53.5%	98.4%	57.1%
aih-tih-sc-f14fdc-R1_B23WHYVLT4_1_1																																	142.6bp	97.9%	289.1M																86.9%	52%	151bp	151bp	18%	438.8M
aih-tih-sc-f14fdc-R1_B23WHYVLT4_1_2																																																			85.5%	53%	151bp	151bp	18%	438.8M
aih-tih-sc-f14fdc-R1_B23WHYVLT4_1_trimmed_1																																																			84.6%	53%	128bp	137bp	9%	295.3M	84.6%	53%	128bp	137bp	9%	295.3M
aih-tih-sc-f14fdc-R1_B23WHYVLT4_1_trimmed_2																																																			84.1%	53%	128bp	142bp	9%	295.3M	84.1%	53%	128bp	142bp	9%	295.3M
aih-tih-sc-f39d87-R1_B23WHYVLT4_1	9999000000	179899818	120.1bp	112.0bp	0.08%	1.85%	0.56%	0.00%	0.16%	5.33%	0.86%	0.00%	No	0.00%	459945424	0.01%	0.58%	190896714	0.92%	0.95%	0.06%	0.05%	175160881	87969713	12246206	4957400	281.52	124.00	0.68%	0.54%	0.98	0.000				118bp	185bp	58.9%	0.0%	96.9%	85.5%	94.3%	216.9M	33.7%	97.7%	51982.2Mb	459.9M	52.9%	98.4%	75.8%
aih-tih-sc-f39d87-R1_B23WHYVLT4_1_1																																	120.1bp	97.9%	225.1M																83.3%	51%	151bp	151bp	27%	233.8M
aih-tih-sc-f39d87-R1_B23WHYVLT4_1_2																																																			80.9%	53%	151bp	151bp	18%	233.8M
aih-tih-sc-f39d87-R1_B23WHYVLT4_1_trimmed_1																																																			83.3%	52%	116bp	117bp	18%	230.0M	83.3%	52%	116bp	117bp	18%	230.0M
aih-tih-sc-f39d87-R1_B23WHYVLT4_1_trimmed_2																																																			82.1%	53%	116bp	117bp	9%	230.0M	82.1%	53%	116bp	117bp	9%	230.0M
aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1	9999000000	82768656	119.7bp	114.0bp	0.02%	0.68%	0.30%	0.00%	0.04%	2.20%	0.47%	0.00%	No	0.00%	334579400	0.01%	0.75%	83530550	0.83%	0.88%	0.13%	0.12%	69544890	34853065	10894138	4938774	105.04	46.00	0.58%	0.32%	0.98	0.000				117bp	160bp	75.7%	0.0%	95.7%	84.9%	94.2%	157.7M	46.2%	97.7%	37926.0Mb	334.6M	54.0%	97.9%	77.2%
aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1_1																																	119.7bp	96.4%	161.2M																85.3%	53%	151bp	151bp	18%	170.9M
aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1_2																																																			83.4%	54%	151bp	151bp	36%	170.9M
aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1_trimmed_1																																																			85.2%	53%	116bp	117bp	9%	167.3M	85.2%	53%	116bp	117bp	9%	167.3M
aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1_trimmed_2																																																			84.6%	54%	116bp	117bp	9%	167.3M	84.6%	54%	116bp	117bp	9%	167.3M
aih-tih-sc-f71b32-R1_B23WHYVLT4_1	9999000000	359517249	148.3bp	136.0bp	0.03%	1.39%	0.51%	0.00%	0.06%	4.08%	0.74%	0.00%	No	0.00%	590340282	0.01%	0.49%	301121218	0.93%	0.96%	0.06%	0.04%	280249434	141540567	17466861	6078069	543.22	263.00	0.73%	0.63%	0.98	0.000				170bp	390bp	49.3%	0.0%	96.3%	87.8%	95.1%	280.8M	34.3%	97.7%	74851.0Mb	590.3M	53.6%	98.4%	54.3%
aih-tih-sc-f71b32-R1_B23WHYVLT4_1_1																																	148.3bp	97.6%	288.0M																85.1%	52%	151bp	151bp	18%	317.6M
aih-tih-sc-f71b32-R1_B23WHYVLT4_1_2																																																			83.2%	53%	151bp	151bp	18%	317.6M
aih-tih-sc-f71b32-R1_B23WHYVLT4_1_trimmed_1																																																			84.7%	53%	130bp	142bp	9%	295.2M	84.7%	53%	130bp	142bp	9%	295.2M
aih-tih-sc-f71b32-R1_B23WHYVLT4_1_trimmed_2																																																			84.0%	53%	130bp	142bp	9%	295.2M	84.0%	53%	130bp	142bp	9%	295.2M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_01_RNA_13_B23WHYVLT4_1	629.3M	0.0M	0.0M	37.0M	3.2M	571.9M	286.1M	285.8M	286.0M	285.9M	256.3M	315.7M	570.3M	0.0M
FFPE_V4_0002_RNA_0001_B23WHYVLT4_1	630.1M	0.0M	0.0M	38.1M	3.7M	570.2M	285.2M	285.0M	285.1M	285.1M	265.8M	304.4M	568.5M	0.0M
NTC_0001_0001_B23WHYVLT4_1	0.2M	0.0M	0.0M	0.1M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M	0.0M
aih-tih-sc-0183f6-R1_B23WHYVLT4_1	492.2M	0.0M	0.0M	60.4M	3.4M	403.2M	201.7M	201.4M	201.6M	201.5M	245.3M	157.9M	401.9M	0.0M
aih-tih-sc-027d27-R1_B23WHYVLT4_1	569.3M	0.0M	0.0M	48.1M	3.7M	497.4M	248.8M	248.5M	248.7M	248.6M	281.5M	215.9M	495.8M	0.0M
aih-tih-sc-03bdd8-R1_B23WHYVLT4_1	649.7M	0.0M	0.0M	57.7M	4.3M	563.3M	281.8M	281.5M	281.7M	281.6M	299.8M	263.5M	561.4M	0.0M
aih-tih-sc-070e1d-R1_B23WHYVLT4_1	611.3M	0.0M	0.0M	55.7M	3.6M	529.2M	264.8M	264.5M	264.7M	264.5M	290.8M	238.5M	527.2M	0.0M
aih-tih-sc-099ac4-R1_B23WHYVLT4_1	641.9M	0.0M	0.0M	49.4M	4.9M	566.7M	283.5M	283.2M	283.4M	283.3M	302.0M	264.7M	564.9M	0.0M
aih-tih-sc-0a6b7b-R1_B23WHYVLT4_1	646.6M	0.0M	0.0M	54.1M	3.5M	564.0M	282.1M	281.9M	282.1M	281.9M	284.6M	279.4M	562.2M	0.0M
aih-tih-sc-0fc41c-R1_B23WHYVLT4_1	499.5M	0.0M	0.0M	47.4M	3.9M	428.0M	214.1M	213.9M	214.0M	214.0M	240.9M	187.1M	426.7M	0.0M
aih-tih-sc-13a2f6-R1_B23WHYVLT4_1	230.8M	0.0M	0.0M	21.3M	1.9M	199.2M	99.7M	99.5M	99.6M	99.6M	115.3M	83.9M	198.4M	0.0M
aih-tih-sc-16054b-R1_B23WHYVLT4_1	634.4M	0.0M	0.0M	41.5M	3.9M	570.8M	285.6M	285.2M	285.5M	285.3M	283.0M	287.9M	569.0M	0.0M
aih-tih-sc-176637-R1_B23WHYVLT4_1	408.7M	0.0M	0.0M	28.1M	2.5M	365.9M	183.1M	182.9M	183.0M	182.9M	184.6M	181.4M	364.7M	0.0M
aih-tih-sc-18a6f2-R1_B23WHYVLT4_1	417.2M	0.0M	0.0M	29.2M	2.4M	373.9M	187.0M	186.8M	187.0M	186.9M	206.6M	167.2M	372.5M	0.0M
aih-tih-sc-1ba302-R1_B23WHYVLT4_1	638.8M	0.0M	0.0M	45.2M	3.7M	570.4M	285.4M	285.0M	285.2M	285.1M	279.2M	291.1M	568.7M	0.0M
aih-tih-sc-1d89ab-R1_B23WHYVLT4_1	640.7M	0.0M	0.0M	48.3M	4.1M	567.5M	283.9M	283.5M	283.8M	283.7M	307.4M	260.1M	565.6M	0.0M
aih-tih-sc-1d9134-R1_B23WHYVLT4_1	507.2M	0.0M	0.0M	30.0M	2.7M	461.2M	230.7M	230.5M	230.7M	230.5M	222.3M	238.9M	459.7M	0.0M
aih-tih-sc-20b7e4-R1_B23WHYVLT4_1	247.4M	0.0M	0.0M	24.3M	1.9M	210.9M	105.6M	105.4M	105.5M	105.5M	133.3M	77.7M	210.2M	0.0M
aih-tih-sc-2a5468-R1_B23WHYVLT4_1	637.0M	0.0M	0.0M	47.8M	4.0M	563.9M	282.1M	281.9M	282.0M	281.9M	286.8M	277.1M	562.3M	0.0M
aih-tih-sc-2f84cc-R1_B23WHYVLT4_1	269.9M	0.0M	0.0M	24.7M	2.3M	233.0M	116.6M	116.4M	116.5M	116.5M	141.9M	91.1M	232.2M	0.0M
aih-tih-sc-3376ed-R1_B23WHYVLT4_1	630.8M	0.0M	0.0M	39.1M	3.6M	570.1M	285.2M	284.9M	285.1M	285.0M	271.3M	298.8M	568.1M	0.0M
aih-tih-sc-37dd87-R1_B23WHYVLT4_1	634.5M	0.0M	0.0M	41.5M	3.5M	570.7M	285.4M	285.2M	285.4M	285.3M	289.6M	281.0M	568.9M	0.0M
aih-tih-sc-3924cb-R1_B23WHYVLT4_1	629.6M	0.0M	0.0M	37.2M	3.6M	571.9M	286.1M	285.8M	286.0M	285.9M	288.5M	283.4M	570.1M	0.0M
aih-tih-sc-3b3c1e-R1_B23WHYVLT4_1	639.0M	0.0M	0.0M	46.6M	4.1M	568.7M	284.5M	284.2M	284.4M	284.3M	321.7M	247.0M	566.9M	0.0M
aih-tih-sc-3e91d2-R1_B23WHYVLT4_1	638.1M	0.0M	0.0M	45.3M	5.0M	565.7M	282.9M	282.7M	282.9M	282.8M	273.5M	292.1M	563.7M	0.0M
aih-tih-sc-445ab1-R1_B23WHYVLT4_1	636.2M	0.0M	0.0M	44.5M	3.9M	569.4M	284.9M	284.5M	284.8M	284.7M	287.5M	282.0M	567.7M	0.0M
aih-tih-sc-446670-R1_B23WHYVLT4_1	486.3M	0.0M	0.0M	40.9M	3.6M	422.0M	211.1M	210.9M	211.1M	211.0M	220.7M	201.3M	420.8M	0.0M
aih-tih-sc-4cd8a8-R1_B23WHYVLT4_1	453.6M	0.0M	0.0M	41.6M	2.8M	390.5M	195.4M	195.1M	195.3M	195.2M	229.3M	161.2M	389.2M	0.0M
aih-tih-sc-4dcd88-R1_B23WHYVLT4_1	635.7M	0.0M	0.0M	42.9M	3.8M	570.7M	285.4M	285.2M	285.4M	285.3M	301.6M	269.1M	568.8M	0.0M
aih-tih-sc-4f4d6e-R1_B23WHYVLT4_1	457.1M	0.0M	0.0M	24.0M	2.3M	419.4M	209.8M	209.6M	209.8M	209.6M	209.7M	209.7M	417.9M	0.0M
aih-tih-sc-505123-R1_B23WHYVLT4_1	294.7M	0.0M	0.0M	26.8M	1.8M	255.2M	127.7M	127.5M	127.6M	127.6M	168.0M	87.1M	254.3M	0.0M
aih-tih-sc-51d534-R1_B23WHYVLT4_1	596.6M	0.0M	0.0M	51.0M	3.1M	518.3M	259.3M	259.0M	259.2M	259.1M	262.1M	256.2M	516.7M	0.0M
aih-tih-sc-51ee59-R1_B23WHYVLT4_1	629.0M	0.0M	0.0M	36.2M	3.5M	572.8M	286.5M	286.3M	286.4M	286.3M	284.9M	287.8M	571.1M	0.0M
aih-tih-sc-522d83-R1_B23WHYVLT4_1	638.5M	0.0M	0.0M	47.5M	3.7M	565.9M	283.1M	282.8M	283.0M	282.9M	284.9M	280.9M	564.1M	0.0M
aih-tih-sc-5c902f-R1_B23WHYVLT4_1	509.3M	0.0M	0.0M	65.6M	4.7M	411.6M	206.1M	205.6M	205.8M	205.8M	252.0M	159.6M	410.1M	0.0M
aih-tih-sc-5ef3cb-R1_B23WHYVLT4_1	608.5M	0.0M	0.0M	56.2M	5.1M	526.8M	263.7M	263.2M	263.5M	263.4M	335.2M	191.7M	525.3M	0.0M
aih-tih-sc-60f9b9-R1_B23WHYVLT4_1	282.0M	0.0M	0.0M	25.6M	2.2M	243.2M	121.7M	121.5M	121.6M	121.6M	135.5M	107.7M	242.5M	0.0M
aih-tih-sc-6284ec-R1_B23WHYVLT4_1	595.7M	0.0M	0.0M	42.1M	3.8M	531.7M	266.0M	265.7M	265.9M	265.8M	279.6M	252.1M	530.0M	0.0M
aih-tih-sc-62dadb-R1_B23WHYVLT4_1	200.0M	0.0M	0.0M	19.5M	1.6M	171.2M	85.7M	85.5M	85.6M	85.6M	106.7M	64.5M	170.6M	0.0M
aih-tih-sc-63b0e7-R1_B23WHYVLT4_1	633.2M	0.0M	0.0M	41.0M	4.1M	570.0M	285.1M	284.9M	285.1M	284.9M	298.8M	271.3M	568.2M	0.0M
aih-tih-sc-63c8b4-R1_B23WHYVLT4_1	623.7M	0.0M	0.0M	39.1M	4.2M	564.0M	282.2M	281.9M	282.1M	281.9M	286.7M	277.3M	562.4M	0.0M
aih-tih-sc-6473fb-R1_B23WHYVLT4_1	512.4M	0.0M	0.0M	42.0M	3.2M	449.2M	224.8M	224.4M	224.7M	224.6M	263.9M	185.4M	447.5M	0.0M
aih-tih-sc-6e7384-R1_B23WHYVLT4_1	627.3M	0.0M	0.0M	34.4M	3.1M	573.4M	286.8M	286.6M	286.8M	286.6M	277.8M	295.7M	571.7M	0.0M
aih-tih-sc-72546a-R1_B23WHYVLT4_1	635.2M	0.0M	0.0M	42.5M	4.2M	570.7M	285.6M	285.1M	285.4M	285.3M	301.8M	268.9M	568.9M	0.0M
aih-tih-sc-758b5a-R1_B23WHYVLT4_1	639.8M	0.0M	0.0M	47.3M	3.8M	566.2M	283.2M	283.0M	283.2M	283.1M	283.1M	283.1M	564.3M	0.0M
aih-tih-sc-75c3a9-R1_B23WHYVLT4_1	637.6M	0.0M	0.0M	45.3M	3.7M	569.1M	284.8M	284.4M	284.7M	284.5M	293.9M	275.2M	567.1M	0.0M
aih-tih-sc-762402-R1_B23WHYVLT4_1	448.2M	0.0M	0.0M	22.8M	2.7M	412.5M	206.4M	206.1M	206.4M	206.1M	185.2M	227.4M	411.1M	0.0M
aih-tih-sc-76a805-R1_B23WHYVLT4_1	658.2M	0.0M	0.0M	67.0M	4.3M	557.9M	279.1M	278.8M	279.0M	278.9M	293.2M	264.8M	556.2M	0.0M
aih-tih-sc-79f487-R1_B23WHYVLT4_1	600.6M	0.0M	0.0M	51.9M	3.6M	519.4M	259.8M	259.6M	259.7M	259.7M	256.4M	263.0M	517.9M	0.0M
aih-tih-sc-7c610c-R1_B23WHYVLT4_1	669.2M	0.0M	0.0M	77.4M	4.4M	552.2M	276.2M	276.0M	276.1M	276.0M	306.6M	245.5M	550.5M	0.0M
aih-tih-sc-7c6c07-R1_B23WHYVLT4_1	642.7M	0.0M	0.0M	50.3M	3.4M	565.5M	282.9M	282.6M	282.8M	282.7M	296.1M	269.5M	563.7M	0.0M
aih-tih-sc-7c8bae-R1_B23WHYVLT4_1	629.6M	0.0M	0.0M	38.7M	2.8M	570.2M	285.2M	285.0M	285.1M	285.1M	270.8M	299.4M	568.4M	0.0M
aih-tih-sc-7d62c4-R1_B23WHYVLT4_1	638.6M	0.0M	0.0M	46.1M	4.1M	569.0M	284.7M	284.4M	284.6M	284.4M	287.0M	282.0M	567.0M	0.0M
aih-tih-sc-7dd1d5-R1_B23WHYVLT4_1	461.3M	0.0M	0.0M	40.1M	3.4M	401.4M	200.9M	200.6M	200.8M	200.7M	225.5M	176.0M	399.9M	0.0M
aih-tih-sc-7fc50e-R1_B23WHYVLT4_1	395.9M	0.0M	0.0M	32.7M	2.8M	346.9M	173.6M	173.3M	173.5M	173.4M	196.6M	150.2M	345.8M	0.0M
aih-tih-sc-82e8c1-R1_B23WHYVLT4_1	606.0M	0.0M	0.0M	38.7M	3.0M	546.0M	273.1M	272.9M	273.1M	273.0M	295.4M	250.6M	543.7M	0.0M
aih-tih-sc-884b4c-R1_B23WHYVLT4_1	646.3M	0.0M	0.0M	55.9M	5.1M	563.9M	282.2M	281.7M	282.1M	281.8M	290.2M	273.7M	562.1M	0.0M
aih-tih-sc-89cc59-R1_B23WHYVLT4_1	409.0M	0.0M	0.0M	54.4M	5.0M	330.3M	165.3M	164.9M	165.2M	165.1M	191.7M	138.6M	328.7M	0.0M
aih-tih-sc-8a623b-R1_B23WHYVLT4_1	635.1M	0.0M	0.0M	42.7M	3.9M	570.4M	285.3M	285.1M	285.3M	285.1M	301.4M	269.0M	568.6M	0.0M
aih-tih-sc-8b4971-R1_B23WHYVLT4_1	631.7M	0.0M	0.0M	56.6M	3.8M	548.8M	274.5M	274.2M	274.5M	274.3M	305.8M	243.0M	547.0M	0.0M
aih-tih-sc-8b9375-R1_B23WHYVLT4_1	635.4M	0.0M	0.0M	43.8M	4.8M	567.5M	283.9M	283.6M	283.9M	283.7M	296.9M	270.7M	565.5M	0.0M
aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1	442.3M	0.0M	0.0M	37.5M	2.7M	386.7M	193.4M	193.3M	193.4M	193.3M	230.1M	156.6M	385.5M	0.0M
aih-tih-sc-910896-R1_B23WHYVLT4_1	527.0M	0.0M	0.0M	43.7M	3.1M	462.6M	231.5M	231.1M	231.3M	231.3M	257.9M	204.7M	461.1M	0.0M
aih-tih-sc-9114fc-R1_B23WHYVLT4_1	636.0M	0.0M	0.0M	44.0M	3.5M	570.1M	285.2M	284.9M	285.1M	285.0M	286.1M	283.9M	568.4M	0.0M
aih-tih-sc-934f55-R1_B23WHYVLT4_1	648.5M	0.0M	0.0M	56.2M	5.7M	561.6M	280.9M	280.7M	280.9M	280.7M	297.1M	264.5M	559.9M	0.0M
aih-tih-sc-973c73-R1_B23WHYVLT4_1	637.8M	0.0M	0.0M	44.6M	3.8M	570.4M	285.4M	285.1M	285.3M	285.1M	305.1M	265.3M	568.6M	0.0M
aih-tih-sc-976eb1-R1_B23WHYVLT4_1	163.1M	0.0M	0.0M	18.3M	4.6M	133.8M	67.0M	66.8M	66.9M	66.9M	89.1M	44.7M	133.3M	0.0M
aih-tih-sc-97c26d-R1_B23WHYVLT4_1	242.3M	0.0M	0.0M	20.6M	1.6M	211.9M	106.0M	105.9M	106.0M	105.9M	130.7M	81.2M	211.2M	0.0M
aih-tih-sc-97ecde-R1_B23WHYVLT4_1	554.5M	0.0M	0.0M	53.2M	4.5M	476.5M	238.4M	238.1M	238.3M	238.2M	288.8M	187.7M	475.0M	0.0M
aih-tih-sc-a03f86-R1_B23WHYVLT4_1	340.2M	0.0M	0.0M	21.0M	1.9M	307.8M	154.0M	153.9M	154.0M	153.9M	151.4M	156.5M	306.9M	0.0M
aih-tih-sc-a3a521-R1_B23WHYVLT4_1	632.5M	0.0M	0.0M	40.5M	3.6M	569.7M	284.9M	284.7M	284.9M	284.8M	291.8M	277.8M	567.9M	0.0M
aih-tih-sc-a49d10-R1_B23WHYVLT4_1	650.3M	0.0M	0.0M	58.0M	5.3M	563.2M	281.8M	281.4M	281.6M	281.5M	298.4M	264.8M	561.5M	0.0M
aih-tih-sc-a70f1e-R1_B23WHYVLT4_1	540.8M	0.0M	0.0M	46.6M	3.5M	471.7M	236.0M	235.7M	235.9M	235.8M	276.5M	195.2M	470.0M	0.0M
aih-tih-sc-ac6a71-R1_B23WHYVLT4_1	626.2M	0.0M	0.0M	33.3M	3.2M	574.6M	287.4M	287.2M	287.4M	287.2M	274.6M	300.0M	572.8M	0.0M
aih-tih-sc-b157e9-R1_B23WHYVLT4_1	645.6M	0.0M	0.0M	53.2M	6.7M	560.7M	280.5M	280.2M	280.5M	280.3M	305.4M	255.3M	558.8M	0.0M
aih-tih-sc-b845f7-R1_B23WHYVLT4_1	613.3M	0.0M	0.0M	48.8M	4.3M	539.7M	270.0M	269.7M	269.9M	269.8M	301.5M	238.2M	537.9M	0.0M
aih-tih-sc-b93682-R1_B23WHYVLT4_1	630.9M	0.0M	0.0M	38.3M	3.0M	573.4M	286.8M	286.6M	286.7M	286.7M	253.2M	320.2M	571.7M	0.0M
aih-tih-sc-be4b28-R1_B23WHYVLT4_1	486.9M	0.0M	0.0M	32.6M	2.6M	436.6M	218.4M	218.2M	218.3M	218.2M	233.2M	203.4M	435.1M	0.0M
aih-tih-sc-c04072-R1_B23WHYVLT4_1	629.2M	0.0M	0.0M	35.7M	4.1M	572.9M	286.6M	286.3M	286.6M	286.3M	260.0M	313.0M	570.7M	0.0M
aih-tih-sc-c55577-R1_B23WHYVLT4_1	478.0M	0.0M	0.0M	88.1M	4.3M	347.6M	174.0M	173.6M	173.8M	173.8M	211.0M	136.6M	346.5M	0.0M
aih-tih-sc-c5cb90-R1_B23WHYVLT4_1	683.5M	0.0M	0.0M	93.7M	4.9M	543.9M	272.2M	271.7M	272.0M	271.9M	307.2M	236.7M	541.9M	0.0M
aih-tih-sc-c63171-R1_B23WHYVLT4_1	660.0M	0.0M	0.0M	67.7M	4.4M	557.9M	279.1M	278.8M	279.0M	278.9M	302.4M	255.5M	556.2M	0.0M
aih-tih-sc-c7b68f-R1_B23WHYVLT4_1	630.6M	0.0M	0.0M	38.2M	3.2M	571.8M	286.0M	285.8M	286.0M	285.9M	289.6M	282.2M	569.8M	0.0M
aih-tih-sc-c9a01b-R1_B23WHYVLT4_1	629.9M	0.0M	0.0M	37.6M	3.9M	572.7M	286.5M	286.2M	286.4M	286.3M	277.2M	295.5M	571.0M	0.0M
aih-tih-sc-ce6733-R1_B23WHYVLT4_1	651.7M	0.0M	0.0M	59.7M	4.0M	560.8M	280.6M	280.2M	280.5M	280.4M	287.7M	273.1M	559.1M	0.0M
aih-tih-sc-d113b5-R1_B23WHYVLT4_1	637.0M	0.0M	0.0M	44.6M	4.2M	569.4M	284.8M	284.5M	284.8M	284.6M	292.5M	276.9M	567.2M	0.0M
aih-tih-sc-d12f1f-R1_B23WHYVLT4_1	629.1M	0.0M	0.0M	36.8M	3.0M	571.5M	285.9M	285.7M	285.8M	285.7M	294.9M	276.6M	569.5M	0.0M
aih-tih-sc-d2f1f4-R1_B23WHYVLT4_1	479.5M	0.0M	0.0M	38.1M	3.7M	422.1M	211.2M	210.9M	211.1M	211.0M	252.9M	169.2M	420.8M	0.0M
aih-tih-sc-d5506e-R1_B23WHYVLT4_1	551.9M	0.0M	0.0M	37.8M	3.6M	494.2M	247.2M	247.0M	247.2M	247.0M	255.4M	238.8M	492.8M	0.0M
aih-tih-sc-e9e54b-R1_B23WHYVLT4_1	643.1M	0.0M	0.0M	60.6M	4.9M	553.4M	276.9M	276.5M	276.7M	276.6M	325.1M	228.3M	551.5M	0.0M
aih-tih-sc-ea2fad-R1_B23WHYVLT4_1	396.8M	0.0M	0.0M	27.7M	1.9M	355.8M	178.0M	177.8M	178.0M	177.9M	197.3M	158.6M	354.8M	0.0M
aih-tih-sc-ea6ef3-R1_B23WHYVLT4_1	657.7M	0.0M	0.0M	66.0M	4.0M	556.6M	278.4M	278.1M	278.3M	278.2M	290.5M	266.1M	554.8M	0.0M
aih-tih-sc-f14fdc-R1_B23WHYVLT4_1	631.0M	0.0M	0.0M	38.5M	4.0M	571.8M	286.0M	285.7M	286.0M	285.8M	289.0M	282.8M	570.0M	0.0M
aih-tih-sc-f39d87-R1_B23WHYVLT4_1	510.2M	0.0M	0.0M	48.6M	3.5M	437.4M	218.8M	218.6M	218.7M	218.6M	254.3M	183.1M	436.0M	0.0M
aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1	374.0M	0.0M	0.0M	37.9M	3.1M	318.5M	159.4M	159.1M	159.3M	159.2M	198.3M	120.1M	317.4M	0.0M
aih-tih-sc-f71b32-R1_B23WHYVLT4_1	643.1M	0.0M	0.0M	50.8M	3.4M	566.2M	283.2M	283.0M	283.1M	283.1M	293.0M	273.2M	564.5M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	383138563	0.3541%
GCCAGTTTTGCCATCAGGACCAGGGCTGCCAGGGCTTCCAGTCAGACCCT	6	1800533	0.0017%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	9573	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	7530	0.0000%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	3	3946	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	3	3020	0.0000%
CTGGAAGACCGAGTGGTGTGTAATGACAAGTTCGCCGAGGACGGGGCACG	2	78	0.0000%
GGCACAGTGTACAGCACGCTGAAGACGCCAATGCGCACCATGAGCTTCTC	2	83	0.0000%
ATTTCCACGAGCACCAGCAGGGCCAGGGGCTCCAGGGCGACCTCTCTCAC	2	433539	0.0004%
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGGG	2	9574	0.0000%
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGGGGG	2	8115	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTACGCGCATATCTAGT	1	256352	0.0002%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAGACTAGATGATCTGGTG	1	345	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAGACTAGATGATCTGGTG	1	309	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAGACTAGATGATCTGGTA	1	260	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAGACTAGATGATCTGGGG	1	249	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAGACTAGATGATCTGGTA	1	238	0.0000%
GCTGCCGGGGGGGCTGTAACACTCGGCAGCA	1	234	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAGACTAGATGATCTGGGG	1	220	0.0000%
GATCGGAAAGAGCACACGTCTGAACTCCAGTCACAGACTAGATGATCTGG	1	163	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	157385174	0.3252%
GCCAGTTTTGCCATCAGGACCAGGGCTGCCAGGGCTTCCAGTCAGACCCT	3	830134	0.0017%
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	2	1986	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	4740	0.0000%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	3760	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	1832	0.0000%
CTGGAAGACCGAGTGGTGTGTAATGACAAGTTCGCCGAGGACGGGGCACG	2	78	0.0000%
GGCACAGTGTACAGCACGCTGAAGACGCCAATGCGCACCATGAGCTTCTC	2	83	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAGACTAGATGATCTGGTG	1	345	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAGACTAGATGATCTGGTG	1	309	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAGACTAGATGATCTGGTA	1	260	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAGACTAGATGATCTGGGG	1	249	0.0000%
GATCGGAGAGCACACGTCTGAACTCCAGTCACAGACTAGATGATCTGGTA	1	238	0.0000%
GCTGCCGGGGGGGCTGTAACACTCGGCAGCA	1	234	0.0000%
GATCGGAAGAGCACACGTCTGAACTCAGTCACAGACTAGATGATCTGGGG	1	220	0.0000%
GATCGGAAAGAGCACACGTCTGAACTCCAGTCACAGACTAGATGATCTGG	1	163	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGCAGC	1	139	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCGTCACAGACTAGATGATCTGGTG	1	134	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCCAGTCACAGACTAGATGATCTGG	1	129	0.0000%
GATCGGAAGAGCACACGTCTGAACTCCGTCACAGACTAGATGATCTGGTA	1	123	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0018/B23WHYVLT4/nfcore_rnafusion__2cae617--20260515-145204' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0018_2-2cae617 --rundir 's3://natera-labdata-rnd-dev-s3/illumina/20260501_LH00995_0036_B23WHYVLT4/' --bclconvert_samplesheet 's3://natera-labdata-rnd-dev-s3/illumina/20260501_LH00995_0036_B23WHYVLT4/bclconvert_samplesheet_corrected.csv' --flowcell_id 20260501_LH00995_0036_B23WHYVLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0018/B23WHYVLT4/nfcore_rnafusion__2cae617--20260515-145204'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0018_2-2cae617
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0018/B23WHYVLT4/nfcore_rnafusion__2cae617--20260515-145204
rundir: s3://natera-labdata-rnd-dev-s3/illumina/20260501_LH00995_0036_B23WHYVLT4/
flowcell_id: 20260501_LH00995_0036_B23WHYVLT4
strand: reverse
bclconvert_samplesheet: s3://natera-labdata-rnd-dev-s3/illumina/20260501_LH00995_0036_B23WHYVLT4/bclconvert_samplesheet_corrected.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks