Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 959867
total bases: 144939917
Q20 bases: 125321474(86.4644%)
Q30 bases: 96421127(66.5249%)
Read2 before filtering:
total reads: 959867
total bases: 144939917
Q20 bases: 138308101(95.4244%)
Q30 bases: 112309537(77.487%)
Read1 after filtering:
total reads: 23328
total bases: 2724352
Q20 bases: 2518318(92.4373%)
Q30 bases: 2205704(80.9625%)
Read2 after filtering:
total reads: 23328
total bases: 2739696
Q20 bases: 2644388(96.5212%)
Q30 bases: 2398770(87.5561%)
Filtering result:
reads passed filter: 46656
reads failed due to low quality: 55308
reads failed due to too many N: 10
reads failed due to too short: 1817760
reads with adapter trimmed: 962432
bases trimmed due to adapters: 139260251
Duplication rate: 65.8145%
Insert size peak (evaluated by paired-end reads): 151
JSON report: NTC_0001_0001_B23WHYVLT4_1.fastp.json
HTML report: NTC_0001_0001_B23WHYVLT4_1.fastp.html
fastp --in1 NTC_0001_0001_B23WHYVLT4_1_1.fastq.gz --in2 NTC_0001_0001_B23WHYVLT4_1_2.fastq.gz --out1 NTC_0001_0001_B23WHYVLT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_B23WHYVLT4_1_2.fastp.fastq.gz --json NTC_0001_0001_B23WHYVLT4_1.fastp.json --html NTC_0001_0001_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 4 seconds