Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44345393451(97.8927%)
Q30 bases: 42850428761(94.5926%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44326083779(97.8501%)
Q30 bases: 42524490881(93.873%)

Read1 after filtering:
total reads: 295085475
total bases: 36040890472
Q20 bases: 35912628078(99.6441%)
Q30 bases: 35291630649(97.9211%)

Read2 after filtering:
total reads: 295085475
total bases: 36103708893
Q20 bases: 35881441054(99.3844%)
Q30 bases: 35104986740(97.2337%)

Filtering result:
reads passed filter: 590170950
reads failed due to low quality: 9312794
reads failed due to too many N: 122452
reads failed due to too short: 393804
reads with adapter trimmed: 410226992
bases trimmed due to adapters: 17141719532

Duplication rate: 36.4256%

Insert size peak (evaluated by paired-end reads): 108

JSON report: aih-tih-sc-c63171-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-c63171-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-c63171-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-c63171-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-c63171-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-c63171-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-c63171-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-c63171-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 721 seconds