Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44289404572(97.7691%)
Q30 bases: 42691697420(94.2422%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44283163845(97.7553%)
Q30 bases: 42402446215(93.6036%)

Read1 after filtering:
total reads: 294923131
total bases: 35227054148
Q20 bases: 35097066639(99.631%)
Q30 bases: 34475957074(97.8678%)

Read2 after filtering:
total reads: 294923131
total bases: 35293623522
Q20 bases: 35085305912(99.4098%)
Q30 bases: 34339676014(97.2971%)

Filtering result:
reads passed filter: 589846262
reads failed due to low quality: 9322688
reads failed due to too many N: 119740
reads failed due to too short: 711310
reads with adapter trimmed: 427648994
bases trimmed due to adapters: 18736258242

Duplication rate: 45.8997%

Insert size peak (evaluated by paired-end reads): 105

JSON report: aih-tih-sc-d113b5-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-d113b5-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-d113b5-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-d113b5-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-d113b5-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-d113b5-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-d113b5-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-d113b5-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 630 seconds