File Info

Filename
aih-tih-sc-e9e54b-R1_B23WHYVLT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/34/c0a9bbabd1fab3bf2e8a9f98f125c8/aih-tih-sc-e9e54b-R1_B23WHYVLT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 295626602
total bases: 44639616902
Q20 bases: 43975946654(98.5133%)
Q30 bases: 42524016638(95.2607%)

Read2 before filtering:
total reads: 295626602
total bases: 44639616902
Q20 bases: 43671043280(97.8302%)
Q30 bases: 41885354993(93.83%)

Read1 after filtering:
total reads: 290094806
total bases: 35414519003
Q20 bases: 35275152004(99.6065%)
Q30 bases: 34641069560(97.816%)

Read2 after filtering:
total reads: 290094806
total bases: 35479876593
Q20 bases: 35251351855(99.3559%)
Q30 bases: 34470302628(97.1545%)

Filtering result:
reads passed filter: 580189612
reads failed due to low quality: 10234210
reads failed due to too many N: 120694
reads failed due to too short: 708688
reads with adapter trimmed: 409160337
bases trimmed due to adapters: 16904558136

Duplication rate: 48.7339%

Insert size peak (evaluated by paired-end reads): 109

JSON report: aih-tih-sc-e9e54b-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-e9e54b-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-e9e54b-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-e9e54b-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-e9e54b-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-e9e54b-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-e9e54b-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-e9e54b-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 864 seconds