File Info

Filename
aih-tih-sc-ea2fad-R1_B23WHYVLT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/9f/3052c714d2804daa7db68e4119563e/aih-tih-sc-ea2fad-R1_B23WHYVLT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 186907226
total bases: 28222991126
Q20 bases: 27620541103(97.8654%)
Q30 bases: 26485036669(93.8421%)

Read2 before filtering:
total reads: 186907226
total bases: 28222991126
Q20 bases: 27588852301(97.7531%)
Q30 bases: 26369543891(93.4328%)

Read1 after filtering:
total reads: 183890561
total bases: 20515366227
Q20 bases: 20441315847(99.639%)
Q30 bases: 20086355435(97.9088%)

Read2 after filtering:
total reads: 183890561
total bases: 20562330357
Q20 bases: 20456089583(99.4833%)
Q30 bases: 20063197970(97.5726%)

Filtering result:
reads passed filter: 367781122
reads failed due to low quality: 5208586
reads failed due to too many N: 69566
reads failed due to too short: 755178
reads with adapter trimmed: 306712644
bases trimmed due to adapters: 14593458512

Duplication rate: 44.4259%

Insert size peak (evaluated by paired-end reads): 102

JSON report: aih-tih-sc-ea2fad-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-ea2fad-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-ea2fad-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-ea2fad-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-ea2fad-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-ea2fad-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-ea2fad-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-ea2fad-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 522 seconds