Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44557814051(98.3616%)
Q30 bases: 43285714570(95.5535%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44390183882(97.9916%)
Q30 bases: 42731792759(94.3307%)

Read1 after filtering:
total reads: 294652094
total bases: 37795494562
Q20 bases: 37670004336(99.668%)
Q30 bases: 37059971731(98.0539%)

Read2 after filtering:
total reads: 294652094
total bases: 37845753364
Q20 bases: 37630307931(99.4307%)
Q30 bases: 36856283693(97.3855%)

Filtering result:
reads passed filter: 589304188
reads failed due to low quality: 10159886
reads failed due to too many N: 127864
reads failed due to too short: 408062
reads with adapter trimmed: 333066198
bases trimmed due to adapters: 13492020709

Duplication rate: 32.657%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-8b9375-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-8b9375-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-8b9375-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-8b9375-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-8b9375-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-8b9375-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-8b9375-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-8b9375-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 781 seconds