Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 204882892
total bases: 30937316692
Q20 bases: 30344951981(98.0853%)
Q30 bases: 29226551656(94.4702%)

Read2 before filtering:
total reads: 204882892
total bases: 30937316692
Q20 bases: 30321567622(98.0097%)
Q30 bases: 29090221892(94.0296%)

Read1 after filtering:
total reads: 201650062
total bases: 23026935254
Q20 bases: 22945613943(99.6468%)
Q30 bases: 22556931564(97.9589%)

Read2 after filtering:
total reads: 201650062
total bases: 23075579089
Q20 bases: 22954246243(99.4742%)
Q30 bases: 22510597788(97.5516%)

Filtering result:
reads passed filter: 403300124
reads failed due to low quality: 5652126
reads failed due to too many N: 78694
reads failed due to too short: 734840
reads with adapter trimmed: 324939313
bases trimmed due to adapters: 14931636738

Duplication rate: 43.521%

Insert size peak (evaluated by paired-end reads): 106

JSON report: aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-8d3f7c-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 485 seconds