Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44647576533(98.5598%)
Q30 bases: 43454803258(95.9267%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44456834395(98.1387%)
Q30 bases: 42840267709(94.5701%)

Read1 after filtering:
total reads: 295174180
total bases: 38302513810
Q20 bases: 38178889513(99.6772%)
Q30 bases: 37571682519(98.0919%)

Read2 after filtering:
total reads: 295174180
total bases: 38347775720
Q20 bases: 38112786590(99.3872%)
Q30 bases: 37287782585(97.2358%)

Filtering result:
reads passed filter: 590348360
reads failed due to low quality: 9222476
reads failed due to too many N: 130404
reads failed due to too short: 298760
reads with adapter trimmed: 325917339
bases trimmed due to adapters: 12620317598

Duplication rate: 34.3124%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-f71b32-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-f71b32-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-f71b32-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-f71b32-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-f71b32-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-f71b32-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-f71b32-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-f71b32-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 780 seconds