Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44275620681(97.7387%)
Q30 bases: 42758139502(94.3888%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44376994102(97.9625%)
Q30 bases: 42588080542(94.0134%)

Read1 after filtering:
total reads: 295108100
total bases: 35427859172
Q20 bases: 35305804188(99.6555%)
Q30 bases: 34719131799(97.9995%)

Read2 after filtering:
total reads: 295108100
total bases: 35491040618
Q20 bases: 35280930374(99.408%)
Q30 bases: 34528065948(97.2867%)

Filtering result:
reads passed filter: 590216200
reads failed due to low quality: 9167276
reads failed due to too many N: 121134
reads failed due to too short: 495390
reads with adapter trimmed: 425671284
bases trimmed due to adapters: 18386545691

Duplication rate: 38.2319%

Insert size peak (evaluated by paired-end reads): 108

JSON report: aih-tih-sc-8a623b-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-8a623b-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-8a623b-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-8a623b-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-8a623b-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-8a623b-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-8a623b-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-8a623b-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 787 seconds