Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 170863978
total bases: 25800460678
Q20 bases: 25157356436(97.5074%)
Q30 bases: 24151177183(93.6075%)

Read2 before filtering:
total reads: 170863978
total bases: 25800460678
Q20 bases: 25184853064(97.614%)
Q30 bases: 24054948722(93.2346%)

Read1 after filtering:
total reads: 167289700
total bases: 19394150437
Q20 bases: 19323456903(99.6355%)
Q30 bases: 18991263922(97.9226%)

Read2 after filtering:
total reads: 167289700
total bases: 19438043467
Q20 bases: 19327178163(99.4296%)
Q30 bases: 18934713067(97.4106%)

Filtering result:
reads passed filter: 334579400
reads failed due to low quality: 5391674
reads failed due to too many N: 65392
reads failed due to too short: 1691490
reads with adapter trimmed: 263783092
bases trimmed due to adapters: 11829924410

Duplication rate: 46.1853%

Insert size peak (evaluated by paired-end reads): 107

JSON report: aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-f4e5c4-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 383 seconds