Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44563574652(98.3743%)
Q30 bases: 43195998410(95.3554%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44444087495(98.1106%)
Q30 bases: 42745120667(94.3601%)

Read1 after filtering:
total reads: 295205705
total bases: 37823904730
Q20 bases: 37658140841(99.5617%)
Q30 bases: 36930767914(97.6387%)

Read2 after filtering:
total reads: 295205705
total bases: 37871663311
Q20 bases: 37632035538(99.3673%)
Q30 bases: 36781379835(97.1211%)

Filtering result:
reads passed filter: 590411410
reads failed due to low quality: 9093346
reads failed due to too many N: 128464
reads failed due to too short: 366780
reads with adapter trimmed: 346211844
bases trimmed due to adapters: 13592191970

Duplication rate: 45.1665%

Insert size peak (evaluated by paired-end reads): 115

JSON report: aih-tih-sc-c9a01b-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-c9a01b-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-c9a01b-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-c9a01b-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-c9a01b-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-c9a01b-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-c9a01b-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-c9a01b-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 726 seconds