File Info

Filename
aih-tih-sc-ce6733-R1_B23WHYVLT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/7f/da3db3c5889d3f0e458466c12dc1fe/aih-tih-sc-ce6733-R1_B23WHYVLT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44595495154(98.4448%)
Q30 bases: 43308762545(95.6043%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44413663267(98.0434%)
Q30 bases: 42703604993(94.2684%)

Read1 after filtering:
total reads: 295000533
total bases: 38017546599
Q20 bases: 37873600651(99.6214%)
Q30 bases: 37197191890(97.8422%)

Read2 after filtering:
total reads: 295000533
total bases: 38067199780
Q20 bases: 37821312194(99.3541%)
Q30 bases: 36961168119(97.0945%)

Filtering result:
reads passed filter: 590001066
reads failed due to low quality: 9564420
reads failed due to too many N: 127922
reads failed due to too short: 306592
reads with adapter trimmed: 339648484
bases trimmed due to adapters: 13142490504

Duplication rate: 38.2081%

Insert size peak (evaluated by paired-end reads): 118

JSON report: aih-tih-sc-ce6733-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-ce6733-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-ce6733-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-ce6733-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-ce6733-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-ce6733-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-ce6733-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-ce6733-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 660 seconds