File Info

Filename
aih-tih-sc-97c26d-R1_B23WHYVLT4_1.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/86/ec3d966a7897e711ca9e18d6e64edd/aih-tih-sc-97c26d-R1_B23WHYVLT4_1.fastp.log
Size
1.6 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 112339611
total bases: 16963281261
Q20 bases: 16484886878(97.1798%)
Q30 bases: 15716849628(92.6522%)

Read2 before filtering:
total reads: 112339611
total bases: 16963281261
Q20 bases: 16585800483(97.7747%)
Q30 bases: 15815217544(93.2321%)

Read1 after filtering:
total reads: 110441127
total bases: 11814864351
Q20 bases: 11770313057(99.6229%)
Q30 bases: 11561038928(97.8516%)

Read2 after filtering:
total reads: 110441127
total bases: 11845136943
Q20 bases: 11784448643(99.4877%)
Q30 bases: 11560247045(97.5949%)

Filtering result:
reads passed filter: 220882254
reads failed due to low quality: 2793178
reads failed due to too many N: 39500
reads failed due to too short: 964290
reads with adapter trimmed: 193477901
bases trimmed due to adapters: 9782993810

Duplication rate: 38.8521%

Insert size peak (evaluated by paired-end reads): 95

JSON report: aih-tih-sc-97c26d-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-97c26d-R1_B23WHYVLT4_1.fastp.html

fastp --in1 aih-tih-sc-97c26d-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-97c26d-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-97c26d-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-97c26d-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-97c26d-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-97c26d-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 205 seconds