Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 281965510
total bases: 42576792010
Q20 bases: 41527377154(97.5352%)
Q30 bases: 39926204538(93.7746%)
Read2 before filtering:
total reads: 281965510
total bases: 42576792010
Q20 bases: 41586534508(97.6742%)
Q30 bases: 39750644458(93.3622%)
Read1 after filtering:
total reads: 276483938
total bases: 32323952464
Q20 bases: 32205500156(99.6335%)
Q30 bases: 31646764903(97.905%)
Read2 after filtering:
total reads: 276483938
total bases: 32402178644
Q20 bases: 32199279378(99.3738%)
Q30 bases: 31507523234(97.2389%)
Filtering result:
reads passed filter: 552967876
reads failed due to low quality: 9554660
reads failed due to too many N: 109796
reads failed due to too short: 1298688
reads with adapter trimmed: 425627040
bases trimmed due to adapters: 18990624006
Duplication rate: 48.4082%
Insert size peak (evaluated by paired-end reads): 106
JSON report: aih-tih-sc-070e1d-R1_B23WHYVLT4_1.fastp.json
HTML report: aih-tih-sc-070e1d-R1_B23WHYVLT4_1.fastp.html
fastp --in1 aih-tih-sc-070e1d-R1_B23WHYVLT4_1_1.fastq.gz --in2 aih-tih-sc-070e1d-R1_B23WHYVLT4_1_2.fastq.gz --out1 aih-tih-sc-070e1d-R1_B23WHYVLT4_1_1.fastp.fastq.gz --out2 aih-tih-sc-070e1d-R1_B23WHYVLT4_1_2.fastp.fastq.gz --json aih-tih-sc-070e1d-R1_B23WHYVLT4_1.fastp.json --html aih-tih-sc-070e1d-R1_B23WHYVLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 667 seconds